Search Results

Search found 46865 results on 1875 pages for 'string array'.

Page 184/1875 | < Previous Page | 180 181 182 183 184 185 186 187 188 189 190 191  | Next Page >

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Cross-platform iteration of Unicode string

  - by kizzx2

  I want to iterate each character of a Unicode string, treating each surrogate pair and combining character sequence as a single unit (one grapheme). Example The text "??????" is comprised of the code points: U+0928, U+092E, U+0938, U+094D, U+0924, U+0947, of which, U+0938 and U+0947 are combining marks. static void Main(string[] args) { const string s = "??????"; Console.WriteLine(s.Length); // Ouptuts "6" var l = 0; var e = System.Globalization.StringInfo.GetTextElementEnumerator(s); while(e.MoveNext()) l++; Console.WriteLine(l); // Outputs "4" } So there we have it in .NET. We also have Win32's CharNextW() #include <Windows.h> #include <iostream> #include <string> int main() { const wchar_t * s = L"??????"; std::cout << std::wstring(s).length() << std::endl; // Gives "6" int l = 0; while(CharNextW(s) != s) { s = CharNextW(s); ++l; } std::cout << l << std::endl; // Gives "4" return 0; } Question Both ways I know of are specific to Microsoft. Are there portable ways to do it? I heard about ICU but I couldn't find something related quickly (UnicodeString(s).length() still gives 6). Would be an acceptable answer to point to the related function/module in ICU. C++ doesn't have a notion of Unicode, so a lightweight cross-platform library for dealing with these issues would make an acceptable answer.

  Read the article

• Setting Nullable Integer to String Containing Nothing yields 0

  - by Brian MacKay

  I've been pulling my hair out over some unexpected behavior from nullable integers. If I set an Integer to Nothing, it becomes Nothing as expected. If I set an Integer? to a String that is Nothing, it becomes 0! Of course I get this whether I explicitly cast the String to Integer? or not. I realize I could work around this pretty easily but I want to know what I'm missing. Dim NullString As String = Nothing Dim NullableInt As Integer? = CType(NullString, Integer?) 'Expected NullableInt to be Nothing, but it's 0! NullableInt = Nothing 'This works -- NullableInt now contains Nothing. How is this EDIT: Previously I had my code up here so without the explicit conversion to 'Integer?' and everyone seemed to be fixated on that. I want to be clear that this is not an issue that would have been caught by Option Strict On -- check out the accepted answer. This is a quirk of the string-to-integer conversion rules which predate nullable types, but still impact them.

  Read the article

• C++ Initialize array in constructor EXC_BAD_ACCESS

  - by user890395

  I'm creating a simple constructor and initializing an array: // Construtor Cinema::Cinema(){ // Initalize reservations for(int i = 0; i < 18; i++){ for(int j = 0; j < 12; j++){ setReservation(i, j, 0); } } // Set default name setMovieName("N/A"); // Set default price setPrice(8); } The setReservation function: void Cinema::setReservation(int row, int column, int reservation){ this->reservations[row][column] = reservation; } The setMovieName function: void Cinema::setMovieName(std::string movieName){ this->movieName = movieName; } For some odd reason when I run the program, the setMovieName function gives the following error: "Program Received Signal: EXC_BAD_ACCESS" If I take out the for-loop that initializes the array of reservations, the problem goes away and the movie name is set without any problems. Any idea what I'm doing wrong? This is the Cinema.h file: #ifndef Cinema_h #define Cinema_h class Cinema{ private: int reservations[17][11]; std::string movieName; float price; public: // Construtor Cinema(); // getters/setters int getReservation(int row, int column); int getNumReservations(); std::string getMovieName(); float getPrice(); void setReservation(int row, int column, int reservation); void setMovieName(std::string movieName); void setPrice(float price); }; #endif

  Read the article

• Instrumenting a string

  - by George Polevoy

  Somewhere in C++ era i have crafted a library, which enabled string representation of the computation history. Having a math expression like: TScalar Compute(TScalar a, TScalar b, TScalar c) { return ( a + b ) * c; } I could render it's string representation: r = Compute(VerbalScalar("a", 1), VerbalScalar("b", 2), VerbalScalar("c", 3)); Assert.AreEqual(9, r.Value); Assert.AreEqual("(a+b)*c==(1+2)*3", r.History ); C++ operator overloading allowed for substitution of a simple type with a complex self-tracking entity with an internal tree representation of everything happening with the objects. Now i would like to have the same possibility for NET strings, only instead of variable names i would like to see a stack traces of all the places in code which affected a string. And i want it to work with existing code, and existing compiled assemblies. Also i want all this to hook into visual studio debugger, so i could set a breakpoint, and see everything that happened with a string. Which technology would allow this kind of things? I know it sound like an utopia, but I think visual studio code coverage tools actually do the same kind of job while instrumenting the assemblies.

  Read the article

• "Function object is unsubscriptable" in basic integer to string mapping function

  - by IanWhalen

  I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

  Read the article

• Getting the full-name of the current user, returns an empty string (C#/C++)

  - by Nir

  I try to get the full-name of the current log-in user (Fullname, not username). The following code C#, C++ works fine but on XP computers not connected to the Net, I get empty string as result if I run it ~20 minutes after login (It runs OK whithin the first ~20 minutes after login) A Win32 API (GetUserNameEx) is used rather that PrincipalContext since it PrincipalContext may takes up to 15 seconds when working offline. Any Help why am I getting an empty string as result though a user full name is specified??? - C# Code public static string CurrentUserFullName { get { const int EXTENDED_NAME_FORMAT_NAME_DISPLAY = 3; StringBuilder userName = new StringBuilder(256); uint length = (uint) userName.Capacity; string ret; if (GetUserNameEx(EXTENDED_NAME_FORMAT_NAME_DISPLAY, userName, ref length)) { ret = userName.ToString(); } else { int errorCode = Marshal.GetLastWin32Error(); throw new Win32Exception("GetUserNameEx Failed. Error code - " + errorCode); } return ret; } } [DllImport("Secur32.dll", CharSet = CharSet.Auto, SetLastError = true)] private static extern bool GetUserNameEx(int nameFormat, StringBuilder lpNameBuffer, ref uint lpnSize); - Code in C++ #include "stdafx.h" #include <windows.h> #define SECURITY_WIN32 #include <Security.h> #pragma comment( lib, "Secur32.lib" ) int _tmain(int argc, _TCHAR* argv[]) { char szName[100]; ULONG nChars = sizeof( szName ); if ( GetUserNameEx( NameDisplay, szName, &nChars ) ) { printf( "Name: %s\n", szName); } else { printf( "Failed to GetUserNameEx\n" ); printf( "%d\n", GetLastError() ); } return 0; }

  Read the article

• Select multi-select form from array

  - by Budove

  Here's the issue. I have a database column called pymnt_meth_pref, which contains a comma separated string of payment methods chosen from a multiselect form. <td>Payment Methods Used:<br /> <input type="checkbox" name="pyment_meth_pref[]" value="Cash">I can pay with cash.<br /> <input type="checkbox" name="pyment_meth_pref[]" value="Check">I can pay by check.<br /> <input type="checkbox" name="pyment_meth_pref[]" value="Credit Card">I can pay by credit card.<br /> <input type="checkbox" name="pyment_meth_pref[]" value="Paypal">I can pay with Paypal.<br /> </td> This array is posted to a variable and turned into a comma separated string if (isset($_POST['pyment_meth_pref'])) $pymntmethpref = implode(", ", $_POST['pyment_meth_pref']); if (isset($_POST['pyment_meth_acc'])) $pymntmethacc = implode(", ", $_POST['pyment_meth_acc']); This is then inserted into the database as a comma separated string. What I would like to do, is take this string and apply the values to the original form when the user goes back to the form as 'pre-selected' checkboxes, indicated that the user has already selected those values previously, and keeping those values in the database if they choose to edit any other information in the form. I'm assuming this would need to be done with javascript but if there is a way to do it with PHP I'd rather do it that way.

  Read the article

• How to update a string property of an sqlite database item

  - by Thomas Joos

  hi all, I'm trying to write an application that checks if there is an active internet connection. If so it reads an xml and checks every 'lastupdated' item ( php generated string ). It compares it to the database items and if there is a new value, this particular item needs to be updated. My code seems to work ( compiles, no error messages, no failures, .. ) but I notice that the particular property does not change, it becomese (null). When I output the binded string value it returns the correct string value I want to update into the db.. Any idea what I'm doing wrong? const char *sql = "update myTable Set last_updated=? Where node_id =?"; sqlite3_stmt *statement; // Preparing a statement compiles the SQL query into a byte-code program in the SQLite library. // The third parameter is either the length of the SQL string or -1 to read up to the first null terminator. if (sqlite3_prepare_v2(database, sql, -1, &statement, NULL) == SQLITE_OK){ NSLog(@"last updated item: %@", [d lastupdated]); sqlite3_bind_text(statement, 1, [d lastupdated],-1,SQLITE_TRANSIENT); sqlite3_bind_int (statement, 2, [d node_id]); }else { NSLog(@"SQLite statement error!"); } if(SQLITE_DONE != sqlite3_step(statement)){ NSAssert1(0, @"Error while updating. '%s'", sqlite3_errmsg(database)); }else { NSLog(@"SQLite Update done!"); }

  Read the article

• Fast find object by string property

  - by Andrew Kalashnikov

  Hello, colleagues. I've got task to fast find object by its string property. Object: class DicDomain { public virtual string Id{ get; set; } public virtual string Name { get; set; } } For storing my object I use List[T] dictionary where T is DicDomain for now . I've got 5-10 such lists, which contain about 500-20000 at each one. Task is find objects by its Name. I use next code now: List<T> entities = dictionary.FindAll(s => s.Name.Equals(word, StringComparison.OrdinalIgnoreCase)); I've got some questions: Is my search speed optimal. I think now. Data structure. It List good for this task. What about hashtable,sorted... Method Find. May be i should use string intern?? I haven't much exp at these tasks. Can u give me good advice for increase perfomance. Thanks

  Read the article

• Sorting an array of strings in reverse alphabetical order in Java

  - by Quacky

  I've been tasked with turning this code into a reverse sort, but for the life of me cannot figure out how to do it. These are my sort, findlargest and swap methods. I have a feeling I am missing something glaringly obvious here, any help would be really appreciated. public static void sort(String[] arr) { for (int pass = 1; pass < arr.length; pass++) { int largestPos = findLargest(arr, arr.length - pass); if (largestPos != arr.length - pass) { swap(arr, largestPos, arr.length - pass); } } } public static int findLargest(String[] arr, int num) { int largestPos = 0; for (int i = 1; i <= num; i++) { if (arr[i].compareToIgnoreCase(arr[largestPos]) > 0) { largestPos = i; } } return largestPos; } public static void swap(String[] arr, int first, int second) { String temp = arr[first]; arr[first] = arr[second]; arr[second] = temp; } }

  Read the article

• Java - Counting how many characters show up in another string

  - by Vu Châu

  I am comparing two strings, in Java, to see how many characters from the first string show up in the second string. The following is some expectations: matchingChars("AC", "BA") ? 1 matchingChars("ABBA", "B") ? 2 matchingChars("B", "ABBA") ? 1 My approach is as follows: public int matchingChars(String str1, String str2) { int count = 0; for (int a = 0; a < str1.length(); a++) { for (int b = 0; b < str2.length(); b++) { char str1Char = str1.charAt(a); char str2Char = str2.charAt(b); if (str1Char == str2Char) { count++; str1 = str1.replace(str1Char, '0'); } } } return count; } I know my approach is not the best, but I think it should do it. However, for matchingChars("ABBA", "B") ? 2 My code yields "1" instead of "2". Does anyone have any suggestion or advice? Thank you very much.

  Read the article

• Unable to parse variable length string separated by delimiter

  - by Technext

  Hi, I have a problem with parsing a string, which consists only of directory path. For ex. My input string is Abc\Program Files\sample\ My output should be Abc//Program Files//sample The script should work for input path of any length i.e., it can contain any no. of subdirectories. (For ex., abc\temp\sample\folder\joe) I have looked for help in many links but to no avail. Looks like FOR command extracts only one whole line or a string (when we use ‘token’ keyword in FOR syntax) but my problem is that I am not aware of the input path length and hence, the no. of tokens. My idea was to use \ as a delimiter and then extract each word before and after it (), and put the words to an output file along with // till we reach the end of the string. I tried implementing the following but it did not work: @echo off FOR /F "delims=\" %%x in (orig.txt) do ( IF NOT %%x == "" echo.%%x//output.txt ) The file orig.txt contains only one line i.e, Abc\Program Files\sample\ The output that I get contains only: Abc// The above output contains blank spaces as well after ‘Abc//’ My desired output should be: Abc//program Files//sample// Can anyone please help me with this? Regards, Technext

  Read the article

• Passing.getText() String to another class

  - by DanMc

  I'm currently working on a first year university project and I have a problem, although I doubt it's a very complicated one, but I've been searching and I just can't find a suitable answer to it. The problem concerns two classes. A gui class (class1) and another class (class2). I have a JTextField in class1 and am trying to pass through the .getText() value to class2 and store it in a String type variable. The current code I'm trying to achieve this with is the following: (Class1) private JTextField textField = new JTextField("Something"); ... public String getTextFieldString() { return textField.getText(); } (Class2) private c1 Class1 = new Class1(); private String s = new String(); ... s = c1.getTextFieldString(); I'm pretty new to coding, I've read that maybe I need to pass through an argument somewhere and I assume that's because textField is not static in itself, it changes when somebody enters a new value. (sorry for stating the obvious there.) Anyway, help is appreciated. Thanks a lot!

  Read the article

• String Index Out Of Bound Exception error

  - by Fd Fehfhd

  Im not really sure why a am getting this error. But here is my code it is meant to test palindromes disregarding punctuation. So here is my code import java.util.Scanner; public class PalindromeTester { public static void main(String [] args) { Scanner kb = new Scanner(System.in); String txt = ""; int left; int right; int cntr = 0; do { System.out.println("Enter a word, phrase, or sentence (blank line to stop):"); txt = kb.nextLine(); txt = txt.toLowerCase(); char yP; String noP = ""; for (int i = 0; i < txt.length(); i++) { yP = txt.charAt(i); if (Character.isLetterOrDigit(txt.charAt(yP))) { noP += yP; } } txt = noP; left = 0; right = txt.length() -1; while (txt.charAt(left) == txt.charAt(right) && right > left) { left++; right--; } if (left > right) { System.out.println("Palindrome"); cntr++; } else { System.out.println("Not a palindrome"); } } while (!txt.equals("")); System.out.println("You found " + cntr + " palindromes. Thank you for using palindromeTester."); } } And if i test it and then i put enter so it will tell me how many palindromes you found the error i am getting is javav.lang.StringIndexOutOfBoundException : String index out of range 0 at PalindromeTester.main(PalindromeTester.java:38) and line 28 is while (txt.charAt(left) == txt.charAt(right) && right > left) Thanks for the help in advance

  Read the article

• NHibernate with string primary key and relationships

  - by John_

  I've have just been stumped with this problem for an hour and I annoyingly found the problem eventually. THE CIRCUMSTANCES I have a table which users a string as a primary key, this table has various many to one and many to many relationships all off this primary key. When searching for multiple items from the table all relationships were brought back. However whenever I tried to get the object by the primary key (string) it was not bringing back any relationships, they were always set to 0. THE PARTIAL SOLUTION So I looked into my logs to see what the SQL was doing and that was returning the correct results. So I tried various things in all sorts of random ways and eventually worked out it was. The case of the string being passed into the get method was not EXACTLY the same case as it was in the database, so when it tried to match up the relationship items with the main entity it was finding nothing (Or at least NHIbernate wasn't because as I stated above the SQL was actually returning the correct results) THE REAL SOLUTION Has anyone else come across this? If so how do you tell NHibernate to ignore case when matching SQL results to the entity? It is silly because it worked perfectly well before now all of a sudden it has started to pay attention to the case of the string.

  Read the article

• find nearest match to array of doubles

  - by Scott

  Given the code below, how do I compare a List of objects's values with a test value? I'm building a geolocation application. I'll be passing in longitude and latitude and would like to have the service answer back with the location closest to those values. I started down the path of converting to a string, and formatting the values down to two decimal places, but that seemed a bit too ghetto, and I'm looking for a more elegant solution. public class Location : IEnumerable { public string label { get; set; } public double lat { get; set; } public double lon { get; set; } //Implement IEnumerable public IEnumerator GetEnumerator() { return (IEnumerator)this; } } [HandleError] public class HomeController : Controller { private List<Location> myList = new List<Location> { new Location { label="Atlanta Midtown", lon=33.657674, lat=-84.423130}, new Location { label="Atlanta Airport", lon=33.794151, lat=-84.387228}, new Location { label="Stamford, CT", lon=41.053758, lat=-73.530979}, ... } public static int Main(String[] args) { string inLat = "-80.987654"; double dblInLat = double.Parse(inLat); // here's where I would like to find the closest location to the inLat // once I figure out this, I'll implement the Longitude, and I'll be set }

  Read the article

• .Net SQL Parameter for String List Problem

  - by JK

  I am writing a C# program in which I send a query to SQL Server to be processed and a dataset returns. I am using parameters to pass information to the query before it is sent to SQL server. This works fine except in the situation below. The query looks like this: reportQuery = " Select * From tableName Where Account_Number in (@AccountNum); and Account_Date = @AccountDate "; The AccountDate parameter works find but not the AccountNum parameter. I need the final query to execute like this: Select * From tableName Where Account_Number in ('AX3456','YZYL123','ZZZ123'); and Account_Date = '1-Jan-2010' The problem is that I have these account numbers (actually text) in a C# string list. To feed it to the parameter, I have been declaring the parameter as a string. I turn the list into one string and feed it to the parameter. I think the problem is that I am feeding the paramater this: "'AX3456','YZYL123','ZZZ123'" when it wants this 'AX3456','YZYL123','ZZZ123' How do I get the string list into the query using a parameter and have it execute as shown above? This is how I am declaring and assigning the parameter. SqlParameter AccountNumsParam = new SqlParameter(); AccountNumsParam.ParameterName = "@AccountNums"; AccountNumsParam.SqlDbType = SqlDbType.NVarChar; AccountNumsParam.Value = AccountNumsString; FYI, AccountNumString == "'AX3456','YZYL123','ZZZ123'"

  Read the article

• SQL Server 2008 Prior String Extract

  - by Saidur Rahman

  I have strings like the ones below in a SQL column. I want to extract them as a Gigabyte amount in aggregate. Example: Original Column ---------> Expected Output from a TSQL function ------------------------------------------- $15 / 1GB 24m + Intern 120MB ----------> 1.12 GB $19.95 / 500MB + $49.95 / 9GB Blackberry -----> 9.5GB $174.95 Blackberry 24GB + $10 / 1GB Datapack ----> 25GB $79 / 6GB --> 6GB Null --> Null $20 Plan --> 0GB Note: for our purpose, 1000MB = 1 GB (not 1024). The pattern is numbers followed by GB/MB, usually they are combined like 1GB (without any space but may sometimes may contain a space, it is not particularly important if hard to implement for this exception). Sometimes there are up to three or four instances of GB/MB occurring in the same string which are usually separated by a + sign (see row 2 and 3 of my example above). I have seen how we extract the dollar values in one of the answers where numbers were followed by $ or extract all integers in a string but I don't want to extract the dollar values or all the integers in a string. I just want the sum of GB/MB in the string.

  Read the article

• Loop through Array with conditional output based on key/value pair

  - by Daniel C

  I have an array with the following columns: Task Status I would like to print out a table that shows a list of the Tasks, but not the Status column. Instead, for Tasks where the Status = 0, I want to add a tag <del> to make the completed task be crossed out. Here's my current code: foreach ($row as $key => $val){ if ($key != 'Status') print "<td>$val</td>"; else if ($val == '0') print "<td><del>$val</del></td>"; } This seems to be correct, but when I print it out, it prints all the tasks with the <del> tag. So basically the "else" clause is being run every time. Here is the var_dump($row): array 'Task' => string 'Task A' (length=6) 'Status' => string '3' (length=1) array 'Task' => string 'Task B' (length=6) 'Status' => string '0' (length=1)

  Read the article

• Java loop to collect the second and third elements every three in an array

  - by mhollander38

  I have a file with data in the form timestamp, coordinate, coordinate, seperated by spaces, as here; 14:25:01.215 370.0 333.0 I need to loop through and add the coordinates only to an array. The data from the file is read in and put into as String[] called info, from split(" "). I have two problems, I think the end of the file has a extra " " which I need to lose appropriately and I also want confirmation/suggestions of my loop, at the moment I am getting sporadic out of bounds exceptions. My loop is as follows; String[] info; info = dataHolder.split(" "); ArrayList<String> coOrds1 = new ArrayList<String>(); for (int counter = 0; counter < info.length; counter = counter+3) { coOrds1.add(info[counter+1]); coOrds1.add(info[counter+2]); } Help and suggestions appreciated. The text file is here but the class receives in a UDP packet from another class so I am unsure if this potentially adds " " at the end or not.

  Read the article

• Iterating over a String to check for a number and printing out the String value if it doesn't have a number

  - by wheelerlc64

  I have set up my function for checking for a number in a String, and printing out that String if it has no numbers, and putting up an error message if it does. Here is my code: public class NumberFunction { public boolean containsNbr(String str) { boolean containsNbr = false; if(str != null && !str.isEmpty()) { for(char c : str.toCharArray()) { if(containsNbr = Character.isDigit(c)) { System.out.println("Can't contain numbers in the word."); break; } else { System.out.println(str); } } } return containsNbr; } } import com.imports.validationexample.function.NumberFunction; public class Main { public static void main(String[] args) { NumberFunction nf = new NumberFunction(); System.out.println(nf.containsNbr("bill4")); } } I am trying to get it to print out the result to the console, but the result keeps printing multiple times and prints the boolean value, which I do not want, something like this: bill4 bill4 bill4 bill4 Can't contain numbers in the word. true Why is this happening? I've tried casting but that hasn't worked out either. Any help would be much appreciated.

  Read the article

• Working with a string as an array of characters

  - by Malfunction

  I'm having some trouble with a string represented as an array of characters. What I'd like to do, as I would do in java, is the following: while (i < chars.length) { char ch = chars[i]; if ((WORD_CHARS.indexOf(ch) >= 0) == punctuation) { String token = buffer.toString(); if (token.length() > 0) { parts.add(token); } buffer = new StringBuffer(); } buffer.append(ch); i++; } What I'm doing is something like this: while(i < strlen(chars)) { char ch = chars[i]; if(([WORD_CHARS rangeOfString:ch] >= 0) == punctuation) { NSString *token = buffer.toString(); if([token length] > 0) { [parts addObject:token]; } buffer = [NSMutableString string]; } [buffer append(ch)]; i++; } I'm not sure how I'm supposed to convert String token = buffer.toString(); to objective c, where buffer is an NSMutableString. Also, how do I check this if condition in objective c? if ((WORD_CHARS.indexOf(ch) >= 0) == punctuation) WORD_CHARS is an NSString. I'm also having trouble with appending ch to buffer. Any help is greatly appreciated.

  Read the article

• List View Array from Database

  - by leenolasco

  I have retrieved data and successfully shown it in text view. What do i modify in my codes to make it look like a list view? And also how do modify my listview programatically(adding size and padding)? Here is my a part of my DBclass in selecting the items that I've displayed getFAData() { // TODO Auto-generated method stub String [] columns = new String[]{Row_Name}; Cursor c = ourDB.query(db_Table, columns, null, null, null, null, null); String res = ""; int iRow = c.getColumnIndex(Row_Name); //int iDesc = c.getColumnIndex(Row_Desc); //int iID = c.getColumnIndex(Row_id); for (c.moveToFirst(); !c.isAfterLast(); c.moveToNext()) { res = res + c.getString(iRow) + "\n"; } return res; } And here is class file: public class FirstAid extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.firstaid); displayresult(); } public void displayresult (){ TextView tvFa = (TextView) findViewById(R.id.tvFA); tvFa.setMovementMethod(new ScrollingMovementMethod()); DbHelper tblFa = new DbHelper(this); tblFa.open(); String result = tblFa.getFAData(); tblFa.close(); tvFa.setText(result); } }

  Read the article

• Help with string equality in Java

  - by annayena

  The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static or global variables. Also it's prohibited to use the method equals in the String class. Can use local variables and method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" ---> true 1: TheExamIsEasy; 2: "Th*mIsEasy*" ---> true 1: TheExamIsEasy; 2: "*" ---> true 1: TheExamIsEasy; 2: "TheExamIsEasy" ---> true 1: TheExamIsEasy; 2: "The*IsHard" ---> FALSE I am stucked on this question for many hours now! I need the solution in Java please kindly help me.

  Read the article

< Previous Page | 180 181 182 183 184 185 186 187 188 189 190 191  | Next Page >