Search Results

Search found 108599 results on 4344 pages for 'one click publish'.

Page 186/4344 | < Previous Page | 182 183 184 185 186 187 188 189 190 191 192 193  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • In listview,Viewstub cannot be found after the previous one is inflate

    - by user2958132
    I am using some list item layout and in the item layout, there is a Viewstub where I want to put some image in.I don't have the source of list item layout and just know there are some TextViews and ViewStubs in it. My purpose is to find the ViewStub first and set my personal layout and play with it. However, some of the ViewStub cannot be found. public class TJAdapter extends CursorAdapter { .... public void bindView(View view, Context context, Cursor cursor) { ViewStub contentstub = (ViewStub)item.findViewById(R.id.content_stub); if (contentstub == null){ LOG.error("TJ,contentstub is null"); } else { LOG.error("TJ,contentstub is not null"); contentstub.setLayoutResource(R.layout.icon_image); View iconImage = contentstub.inflate(); } .... } public View newView(Context context, Cursor cursor, ViewGroup parent) { final View view = mInflater.inflate(R.layout.list_item, parent, false); bindView(view, context, cursor); } And the log output is like this: TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null I spent a lot of time on it and have no idea why this happens. Can some body help?

    Read the article

  • Skipping one item in the column

    - by zurna
    I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

    Read the article

  • Microsecond (or one ms) time resolution on an embedded device (Linux Kernel)

    - by ChrisDiRulli
    Hey guys, I have a kernel module I've built that requires at least 1 ms time resolution. I currently use do_gettimeofday() but I'm concerned that this won't work once I move my module to an embedded device. The device has a 180 Mz processor (MIPS) and the default HZ value in the kernel is 100. Thus using jiffies will only give me at best 10 ms resolution. That won't cut it. What I'd like to know is if do_gettimeofday() is based on the timer interrupt (HZ). Can it be guaranteed to provide at least 1 ms of resolution? Thanks!

    Read the article

  • Amazon EC2 EBS automatic backup one-liner works manually but not from cron

    - by dan
    I am trying to implement an automatic backup system for my EBS on Amazon AWS. When I run this command as ec2-user: /opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** everything works fine. But if I add this line into /etc/crontab and restart the crond service: 15 12 * * * ec2-user /opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** that doesn't work. I checked var/log/cron and there is this line, therefore the command gets executed: Dec 13 12:15:01 ip-10-204-111-94 CROND[4201]: (ec2-user) CMD (/opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** ) Can you please help me to troubleshoot the problem? I guess is some environment problem - maybe the lack of some variable. If that's the case I don't know what to do about it. Thanks.

    Read the article

  • Consolidate data from many different databases into one with minimum latency

    - by NTDLS
    I have 12 databases totaling roughly 1.0TB, each on a different physical server running SQL 2005 Enterprise - all with the same exact schema. I need to offload this data into a separate single database so that we can use for other purposes (reporting, web services, ect) with a maximum of 1 hour latency. It should also be noted that these servers are all in the same rack, connected by gigabit connections and that the inserts to the databases are minimal (Avg. 2500 records/hour). The current method is very flakey: The data is currently being replicated (SQL Server Transactional Replication) from each of the 12 servers to a database on another server (yes, 12 different employee tables from 12 different servers into a single employee table on a different server). Every table has a primary key and the rows are unique across all tables (there is a FacilityID in each table). What are my options, these has to be a simple way to do this.

    Read the article

  • Can one prevent Genshi from parsing HTML entities?

    - by DNS
    I have the following Python code using Genshi (simplified): with open(pathToHTMLFile, 'r') as f: template = MarkupTemplate(f.read()) finalPage = template.generate().render('html', doctype = 'html') The source HTML file contains entities such as &copy;, &trade; and &reg;. Genshi replaces these with their UTF-8 character, which causes problems with the viewer (the output is used as a stand-alone file, not a response to a web request) that eventually sees the resulting HTML. Is there any way to prevent Genshi from parsing these entities? The more common ones like &amp; are passed through just fine.

    Read the article

  • Combining multiple lines into one line

    - by mkal
    I have this use case of an xml file with input like Input: <abc a="1"> <val>0.25</val> </abc> <abc a="2"> <val>0.25</val> </abc> <abc a="3"> <val>0.35</val> </abc> ... Output: <abc a="1"><val>0.25</val></abc> <abc a="2"><val>0.25</val></abc> <abc a="3"><val>0.35</val></abc> I have around 200K lines in a file in the Input format, how can I quickly convert this into output format.

    Read the article

  • MonoRail - Select parent category from one dropdown, show child category dropdown

    - by Justin
    Hey, I'm new to MonoRail and am trying to figure out how to have it so that I can select a parent category in a dropdown then have it show a second dropdown with the categories that are children of the parent. If I were using what I'm used to, ASP.NET MVC, I would have a javascript function that would be called onchange of the first dropdown and would make an ajax call to a controller method (passing in the selected parent category id) that would grab all child categories of that parent category and return them in JSON. Then in the callback javascript function I would eval the JSON and populate the second dropdown with the child categories. How would I do this using MonoRail/jQuery? Here's the code I have so far: $FormHelper.Select("business.category.id", $categories, "%{value='id', text='name', firstoption='Select a Category'}") $FormHelper.Select("business.category.id", $childCategories, "%{value='id', text='name', firstoption='Select a Sub-Category'}") Then in BusinessController.cs: private void AddDataToModels() { PropertyBag["categories"] = CategoryRepository.GetParentCategories(); PropertyBag["childCategories"] = CategoryRepository.GetChildCategories(1); } Thanks for any input on how to approach this! Justin

    Read the article

  • Handling one-to-many relationship with ZF partialLoop

    - by snaken
    Lets say i'm listing musical artists, each artist has basic information like Name, Age etc. stored in an artist table. They also have entries in an Albums table (album name/album cover etc), referencing the artist table using the artist id as a foreign key. I have the Model_Artist (Artist.php) file: class Model_Artist extends Zend_Db_Table_Abstract { protected $_name = 'artist'; protected $_dependentTables = array('Model_ArtistAlbums'); public function fetchArtistss() { $select = $this->select(); return $this->fetchAll($select); } } and to the Model_ArtistAlbums (ArtistAlbums.php) file class Model_ArtistAlbums extends Zend_Db_Table_Abstract { protected $_name = 'albums'; protected $_referenceMap = array( 'Artists' => array( 'columns' => 'alb_art_id', 'refTableClass' => 'Model_Artist', 'refColumns' => 'art_id' ) ); // etc } in my controller: public function indexAction() { /* THIS WORKS $art = new Model_Artist(); $artRowset = $art->find(1); $art1 = $artRowset->current(); $artalbums = $art1->findDependentRowset('Model_ArtistAlbums'); foreach($artalbums as $album){ echo $album->alb_title."<br>"; } */ $arts = new Model_Artist(); $this->view->artists = $arts->fetchArtists(); } in the view file: $this->partial()->setObjectKey('artist'); echo $this->partialLoop('admin/list-artists.phtml', $this->artists); but with this code in artists/list-artists.phtml: foreach($this->artist->findDependentRowset('albums') as $album): // other stuff endforeach; i get this error: Fatal error: Call to a member function findDependentRowset() on a non-object A var_dump of $this->artist = NULL.

    Read the article

  • ArrayAdapter need to be clear even i am creating a new one

    - by Roi
    Hello I'm having problems understanding how the ArrayAdapter works. My code is working but I dont know how.(http://amy-mac.com/images/2013/code_meme.jpg) I have my activity, inside it i have 2 private classes.: public class MainActivity extends Activity { ... private void SomePrivateMethod(){ autoCompleteTextView.setAdapter(new ArrayAdapter<String>(this, android.R.layout.simple_spinner_dropdown_item, new ArrayList<String>(Arrays.asList("")))); autoCompleteTextView.addTextChangedListener(new MyTextWatcher()); } ... private class MyTextWatcher implements TextWatcher { ... } private class SearchAddressTask extends AsyncTask<String, Void, String[]> { ... } } Now inside my textwatcher class i call the search address task: @Override public void afterTextChanged(Editable s) { new SearchAddressTask().execute(s.toString()); } So far so good. In my SearchAddressTask I do some stuff on doInBackground() that returns the right array. On the onPostExecute() method i try to just modify the AutoCompleteTextView adapter to add the values from the array obtained in doInBackground() but the adapter cannot be modified: NOT WORKING CODE: protected void onPostExecute(String[] addressArray) { ArrayAdapter<String> adapter = (ArrayAdapter<String>) autoCompleteDestination.getAdapter(); adapter.clear(); adapter.addAll(new ArrayList<String>(Arrays.asList(addressArray))); adapter.notifyDataSetChanged(); Log.d("SearchAddressTask", "adapter isEmpty : " + adapter.isEmpty()); // Returns true!!??! } I dont get why this is not working. Even if i run it on UI Thread... I kept investigating, if i recreate the arrayAdapter, is working in the UI (Showing the suggestions), but i still need to clear the old adapter: WORKING CODE: protected void onPostExecute(String[] addressArray) { ArrayAdapter<String> adapter = (ArrayAdapter<String>) autoCompleteDestination.getAdapter(); adapter.clear(); autoCompleteDestination.setAdapter(new ArrayAdapter<String>(NewDestinationActivity.this,android.R.layout.simple_spinner_dropdown_item, new ArrayList<String>(Arrays.asList(addressArray)))); //adapter.notifyDataSetChanged(); // no needed Log.d("SearchAddressTask", "adapter isEmpty : " + adapter.isEmpty()); // keeps returning true!!??! } So my question is, what is really happening with this ArrayAdapter? why I cannot modify it in my onPostExecute()? Why is working in the UI if i am recreating the adapter? and why i need to clear the old adapter then? I dont know there are so many questions that I need some help in here!! Thanks!!

    Read the article

  • PHP: Array of objects is empty when I come to retrieve one from the array

    - by Tom
    Good morning, I am trying to load rows from a database and then create objects from them and add these objects to a private array. Here are my classes: <?php include("databaseconnect.php"); class stationItem { private $code = ''; private $description = ''; public function setCode($code ){ $this->code = $code; } public function getCode(){ return $this->code; } public function setDescription($description){ $this->description = $description; } public function getDescription(){ return $this->description; } } class stationList { private $stationListing; function __construct() { connect(); $stationListing = array(); $result = mysql_query('SELECT * FROM stations'); while ($row = mysql_fetch_assoc($result)) { $station = new stationItem(); $station->setCode($row['code']); $station->setDescription($row['description']); array_push($stationListing, $station); } mysql_free_result($result); } public function getStation($index){ return $stationListing[$index]; } } ?> As you can see I am creating a stationItem object per database row (which for now has a code and description) and I then push these on to the end of my array which is held as a private variable in stationList. This is code which creates this classes and attempts to access the properties on them: $stations = new stationList(); $station = $stations->getStation(0); echo $station->getCode(); I am finding that the sizeof($stationList) at the end of the constructor is 1 but then it is zero when we come to try to get an object from the array using the index. Therefore the error that I get is: Fatal error: Call to a member function getCode() on a non-object Please can someone explain to me why this is happening? I guess I am misunderstanding how object references work in PHP5.

    Read the article

  • Play and Stop in One button

    - by Ardi
    i'm newbie, i'm tried to make play audio play and stop for 1 button only, but i'm in trouble now. if i touch a button when audio is playing, it doesn't stop, even playing audio again and make a double sound. here's my code public class ProjectisengActivity extends Activity{ ImageButton mainkan; MediaPlayer mp; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.test2); mainkan=(ImageButton)findViewById(R.id.imageButton1); mainkan.setOnClickListener(new OnClickListener(){ @Override public void onClick(View v){ go(); } }); public void go(){ mp=MediaPlayer.create(ProjectisengActivity.this, R.raw.test); if(mp.isPlaying()){ mp.stop(); try { mp.prepare(); } catch (IllegalStateException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } mp.seekTo(0); } else { mp.start(); } i'm create for android 3.0 (HoneyComb) thanks for help

    Read the article

  • Multiple Windows Forms on one application

    - by Shukhrat Raimov
    I have two windows forms, first is initial and second is invoked when button on the first is pressed. It's two different windows, with different tasks. I programmed for both MVP pattern. But in the Main() I have this: static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); ViewFirst viewFirst = new ViewFirst();//First Form PresenterFirst presenterFirst = new PresenterFirst(viewFirst); Application.Run(viewFirst); } And I Have Second Windows Form: ViewSecond viewSecond = new ViewSecond();//Second Form PresenterSecond presenterSecond = new PresenterSecond(viewSecond); I want to run it in this app as soon as the button on the first is clicked. How could I do this? My button on the first WF is: private void history_button_Click(object sender, EventArgs e) { ViewSecond db = new ViewSecond();//second Form where I have sepparate WF. db.Show(); }

    Read the article

  • How does one save cookies in HTTP Builder 0.5.0/HTTPClient

    - by Misha Koshelev
    I am trying per instructions here: http://www.innovation.ch/java/HTTPClient/advanced_info.html However, if I am using HTTP Builder, the following lines System.setProperty("HTTPClient.cookies.save","true") System.setProperty("HTTPClient.cookies.jar","/home/misha/.httpclient_cookies") do not seem to create a file: ~/.httpclient_cookies I will post a solution as always when figure it out. :) Misha

    Read the article

  • How can I overlay one image onto another?

    - by Edward Tanguay
    I would like to display an image composed of two images. I want image rectangle.png to show with image sticker.png on top of it with its left-hand corner at pixel 10, 10. Here is as far as I got, but how do I combine the images? Image image = new Image(); image.Source = new BitmapImage(new Uri(@"c:\test\rectangle.png")); image.Stretch = Stretch.None; image.HorizontalAlignment = HorizontalAlignment.Left; Image imageSticker = new Image(); imageSticker.Source = new BitmapImage(new Uri(@"c:\test\sticker.png")); image.OverlayImage(imageSticker, 10, 10); //how to do this? TheContent.Content = image;

    Read the article

  • Replace string in one file with contents of a second file

    - by jag7720
    I have two files: fileA: date >> /root/kvno.out kvno serverXXX\$ >> /root/kvno.out fileB: foobar I need to create a new file, fileC, with the same contents as fileA, except with the string XXX being replaced with the contents of fileB: date >> /root/kvno.out kvno serverfoobar\$ >> /root/kvno.out I'd like to do this using sed. I tried some of the examples I found but I only get the contents of fileB in fileC.

    Read the article

  • Reading one or more to understand ? [closed]

    - by Tarik
    I love coding and designing applications but there is something annoying me so much. Some times I can't focus and understand what I am reading when learning new code or a new subject or whatever and that really annoys me because It causes me to read again and again and again which really puts me off and frustrate me. Does something like this happen to you or is there some problem with me ?

    Read the article

< Previous Page | 182 183 184 185 186 187 188 189 190 191 192 193  | Next Page >