Search Results

Search found 108599 results on 4344 pages for 'one click publish'.

Page 186/4344 | < Previous Page | 182 183 184 185 186 187 188 189 190 191 192 193  | Next Page >

  • javascript regex: match altered version of first match with only one expression

    - by theseion
    Hi there I'm writing a brush for Alex Gorbatchev's Syntax Highlighter to get highlighting for Smalltalk code. Now, consider the following Smalltalk code: aCollection do: [ :each | each shout ] I want to find the block argument ":each" and then match "each" every time it occurrs afterwards (for simplicity, let's say every occurrence an not just inside the brackets). Note that the argument can have any name, e.g. ":myArg". My attempt to match ":each": \:([\d\w]+) This seems to work. The problem is for me to match the occurrences of "each". I thought something like this could work: \:([\d\w]+)|\1 but the right hand side of the alternation seems to be treated as an independent expression, so backreferencing doesn't work. So my question is: is it even possible to accomplish what I want in a single expression? Or would I have to use the backreference within a second expression (via another function call)? Cheers.

    Read the article

  • In listview,Viewstub cannot be found after the previous one is inflate

    - by user2958132
    I am using some list item layout and in the item layout, there is a Viewstub where I want to put some image in.I don't have the source of list item layout and just know there are some TextViews and ViewStubs in it. My purpose is to find the ViewStub first and set my personal layout and play with it. However, some of the ViewStub cannot be found. public class TJAdapter extends CursorAdapter { .... public void bindView(View view, Context context, Cursor cursor) { ViewStub contentstub = (ViewStub)item.findViewById(R.id.content_stub); if (contentstub == null){ LOG.error("TJ,contentstub is null"); } else { LOG.error("TJ,contentstub is not null"); contentstub.setLayoutResource(R.layout.icon_image); View iconImage = contentstub.inflate(); } .... } public View newView(Context context, Cursor cursor, ViewGroup parent) { final View view = mInflater.inflate(R.layout.list_item, parent, false); bindView(view, context, cursor); } And the log output is like this: TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null I spent a lot of time on it and have no idea why this happens. Can some body help?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Handling one-to-many relationship with ZF partialLoop

    - by snaken
    Lets say i'm listing musical artists, each artist has basic information like Name, Age etc. stored in an artist table. They also have entries in an Albums table (album name/album cover etc), referencing the artist table using the artist id as a foreign key. I have the Model_Artist (Artist.php) file: class Model_Artist extends Zend_Db_Table_Abstract { protected $_name = 'artist'; protected $_dependentTables = array('Model_ArtistAlbums'); public function fetchArtistss() { $select = $this->select(); return $this->fetchAll($select); } } and to the Model_ArtistAlbums (ArtistAlbums.php) file class Model_ArtistAlbums extends Zend_Db_Table_Abstract { protected $_name = 'albums'; protected $_referenceMap = array( 'Artists' => array( 'columns' => 'alb_art_id', 'refTableClass' => 'Model_Artist', 'refColumns' => 'art_id' ) ); // etc } in my controller: public function indexAction() { /* THIS WORKS $art = new Model_Artist(); $artRowset = $art->find(1); $art1 = $artRowset->current(); $artalbums = $art1->findDependentRowset('Model_ArtistAlbums'); foreach($artalbums as $album){ echo $album->alb_title."<br>"; } */ $arts = new Model_Artist(); $this->view->artists = $arts->fetchArtists(); } in the view file: $this->partial()->setObjectKey('artist'); echo $this->partialLoop('admin/list-artists.phtml', $this->artists); but with this code in artists/list-artists.phtml: foreach($this->artist->findDependentRowset('albums') as $album): // other stuff endforeach; i get this error: Fatal error: Call to a member function findDependentRowset() on a non-object A var_dump of $this->artist = NULL.

    Read the article

  • Combining multiple lines into one line

    - by mkal
    I have this use case of an xml file with input like Input: <abc a="1"> <val>0.25</val> </abc> <abc a="2"> <val>0.25</val> </abc> <abc a="3"> <val>0.35</val> </abc> ... Output: <abc a="1"><val>0.25</val></abc> <abc a="2"><val>0.25</val></abc> <abc a="3"><val>0.35</val></abc> I have around 200K lines in a file in the Input format, how can I quickly convert this into output format.

    Read the article

  • MonoRail - Select parent category from one dropdown, show child category dropdown

    - by Justin
    Hey, I'm new to MonoRail and am trying to figure out how to have it so that I can select a parent category in a dropdown then have it show a second dropdown with the categories that are children of the parent. If I were using what I'm used to, ASP.NET MVC, I would have a javascript function that would be called onchange of the first dropdown and would make an ajax call to a controller method (passing in the selected parent category id) that would grab all child categories of that parent category and return them in JSON. Then in the callback javascript function I would eval the JSON and populate the second dropdown with the child categories. How would I do this using MonoRail/jQuery? Here's the code I have so far: $FormHelper.Select("business.category.id", $categories, "%{value='id', text='name', firstoption='Select a Category'}") $FormHelper.Select("business.category.id", $childCategories, "%{value='id', text='name', firstoption='Select a Sub-Category'}") Then in BusinessController.cs: private void AddDataToModels() { PropertyBag["categories"] = CategoryRepository.GetParentCategories(); PropertyBag["childCategories"] = CategoryRepository.GetChildCategories(1); } Thanks for any input on how to approach this! Justin

    Read the article

  • Consolidate data from many different databases into one with minimum latency

    - by NTDLS
    I have 12 databases totaling roughly 1.0TB, each on a different physical server running SQL 2005 Enterprise - all with the same exact schema. I need to offload this data into a separate single database so that we can use for other purposes (reporting, web services, ect) with a maximum of 1 hour latency. It should also be noted that these servers are all in the same rack, connected by gigabit connections and that the inserts to the databases are minimal (Avg. 2500 records/hour). The current method is very flakey: The data is currently being replicated (SQL Server Transactional Replication) from each of the 12 servers to a database on another server (yes, 12 different employee tables from 12 different servers into a single employee table on a different server). Every table has a primary key and the rows are unique across all tables (there is a FacilityID in each table). What are my options, these has to be a simple way to do this.

    Read the article

  • Reading one or more to understand ? [closed]

    - by Tarik
    I love coding and designing applications but there is something annoying me so much. Some times I can't focus and understand what I am reading when learning new code or a new subject or whatever and that really annoys me because It causes me to read again and again and again which really puts me off and frustrate me. Does something like this happen to you or is there some problem with me ?

    Read the article

  • Amazon EC2 EBS automatic backup one-liner works manually but not from cron

    - by dan
    I am trying to implement an automatic backup system for my EBS on Amazon AWS. When I run this command as ec2-user: /opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** everything works fine. But if I add this line into /etc/crontab and restart the crond service: 15 12 * * * ec2-user /opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** that doesn't work. I checked var/log/cron and there is this line, therefore the command gets executed: Dec 13 12:15:01 ip-10-204-111-94 CROND[4201]: (ec2-user) CMD (/opt/aws/bin/ec2-create-snapshot --region us-east-1 -K /home/ec2-user/pk.pem -C /home/ec2-user/cert.pem -d "vol-******** snapshot" vol-******** ) Can you please help me to troubleshoot the problem? I guess is some environment problem - maybe the lack of some variable. If that's the case I don't know what to do about it. Thanks.

    Read the article

  • How does one calculate CPU utilization programmatically ?

    - by Scott Davies
    Hi, I have a benchmarking program that calculates the time (in milliseconds and ticks), for a persistance to Entity Framework 4.0. Is there a way to calculate CPU load ? I am guessing that I would need to query Windows to find out my CPU frequency, how many cores, etc. Does this sound right ? If so, what part of the .NET framework relates to querying the system ? I am guessing System.Diagnostics ? Thanks, Scott

    Read the article

  • More than one location provider at same time

    - by Rabarama
    I have some problems with location systems. I have a service that implements locationlistener. I want to get the best location using network when possible, gps if network is not enough accurate (accuracy greater than 300mt). The problem is this. I need location (accurate if possible, inaccuarte otherways) every 5 minutes. I start with a : LocationManager lm=(LocationManager)getApplicationContext().getSystemService(LOCATION_SERVICE); Criteria criteria = new Criteria(); criteria.setAccuracy(Criteria.ACCURACY_COARSE); criteria.setAltitudeRequired(false); criteria.setBearingRequired(false); String provider=lm.getBestProvider(criteria, true); if(provider!=null){ lm.requestLocationUpdates( provider,5*60*1000,0,this); In "onLocationChanged" i listen to locations and when i get a location with accuracy greater than 300mt, i want to change to gps location system. If I remove allupdates and then request for gps updates, like this: lm.removeUpdates((android.location.LocationListener) this); Criteria criteria = new Criteria(); criteria.setAccuracy(Criteria.ACCURACY_FINE); criteria.setAltitudeRequired(false); criteria.setBearingRequired(false); String provider=lm.getBestProvider(criteria, true); if(provider!=null){ lm.requestLocationUpdates( provider,5*60*1000,0,this); } system stops waiting for gpsupdate, and if i'm in a close room it can stay without location updates for hours, ignoring timeupdate indications. Is there a way to tell locationprovider to switch to network if gps is not giving a location in "x" seconds? or how to understand when gps is not localizing? or if i requestlocationupdates from 2 providers at same time (network and gps), can be a problem? Any suggestion?

    Read the article

  • Multiple Windows Forms on one application

    - by Shukhrat Raimov
    I have two windows forms, first is initial and second is invoked when button on the first is pressed. It's two different windows, with different tasks. I programmed for both MVP pattern. But in the Main() I have this: static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); ViewFirst viewFirst = new ViewFirst();//First Form PresenterFirst presenterFirst = new PresenterFirst(viewFirst); Application.Run(viewFirst); } And I Have Second Windows Form: ViewSecond viewSecond = new ViewSecond();//Second Form PresenterSecond presenterSecond = new PresenterSecond(viewSecond); I want to run it in this app as soon as the button on the first is clicked. How could I do this? My button on the first WF is: private void history_button_Click(object sender, EventArgs e) { ViewSecond db = new ViewSecond();//second Form where I have sepparate WF. db.Show(); }

    Read the article

  • How does one save cookies in HTTP Builder 0.5.0/HTTPClient

    - by Misha Koshelev
    I am trying per instructions here: http://www.innovation.ch/java/HTTPClient/advanced_info.html However, if I am using HTTP Builder, the following lines System.setProperty("HTTPClient.cookies.save","true") System.setProperty("HTTPClient.cookies.jar","/home/misha/.httpclient_cookies") do not seem to create a file: ~/.httpclient_cookies I will post a solution as always when figure it out. :) Misha

    Read the article

  • Multiple circles -> One Polygon?

    - by Josh
    Using Google Maps API v3, I was able to create multiple google.maps.Circle objects on my map. However, I now need to "connect" them somehow. I have the following map with multiple circles: I now need to get it to look something like this: I've looked all over the Internet for solutions, but to no avail. Any ideas?

    Read the article

  • Can one prevent Genshi from parsing HTML entities?

    - by DNS
    I have the following Python code using Genshi (simplified): with open(pathToHTMLFile, 'r') as f: template = MarkupTemplate(f.read()) finalPage = template.generate().render('html', doctype = 'html') The source HTML file contains entities such as &copy;, &trade; and &reg;. Genshi replaces these with their UTF-8 character, which causes problems with the viewer (the output is used as a stand-alone file, not a response to a web request) that eventually sees the resulting HTML. Is there any way to prevent Genshi from parsing these entities? The more common ones like &amp; are passed through just fine.

    Read the article

  • Indexing only one MySQL column value

    - by BrainCore
    I have a MySQL InnoDB table with a status column. The status can be 'done' or 'processing'. As the table grows, at most .1% of the status values will be 'processing,' whereas the other 99.9% of the values will be 'done.' This seems like a great candidate for an index due to the high selectivity for 'processing' (though not for 'done'). Is it possible to create an index for the status column that only indexes the value 'processing'? I do not want the index to waste an enormous amount of space indexing 'done.'

    Read the article

  • ArrayAdapter need to be clear even i am creating a new one

    - by Roi
    Hello I'm having problems understanding how the ArrayAdapter works. My code is working but I dont know how.(http://amy-mac.com/images/2013/code_meme.jpg) I have my activity, inside it i have 2 private classes.: public class MainActivity extends Activity { ... private void SomePrivateMethod(){ autoCompleteTextView.setAdapter(new ArrayAdapter<String>(this, android.R.layout.simple_spinner_dropdown_item, new ArrayList<String>(Arrays.asList("")))); autoCompleteTextView.addTextChangedListener(new MyTextWatcher()); } ... private class MyTextWatcher implements TextWatcher { ... } private class SearchAddressTask extends AsyncTask<String, Void, String[]> { ... } } Now inside my textwatcher class i call the search address task: @Override public void afterTextChanged(Editable s) { new SearchAddressTask().execute(s.toString()); } So far so good. In my SearchAddressTask I do some stuff on doInBackground() that returns the right array. On the onPostExecute() method i try to just modify the AutoCompleteTextView adapter to add the values from the array obtained in doInBackground() but the adapter cannot be modified: NOT WORKING CODE: protected void onPostExecute(String[] addressArray) { ArrayAdapter<String> adapter = (ArrayAdapter<String>) autoCompleteDestination.getAdapter(); adapter.clear(); adapter.addAll(new ArrayList<String>(Arrays.asList(addressArray))); adapter.notifyDataSetChanged(); Log.d("SearchAddressTask", "adapter isEmpty : " + adapter.isEmpty()); // Returns true!!??! } I dont get why this is not working. Even if i run it on UI Thread... I kept investigating, if i recreate the arrayAdapter, is working in the UI (Showing the suggestions), but i still need to clear the old adapter: WORKING CODE: protected void onPostExecute(String[] addressArray) { ArrayAdapter<String> adapter = (ArrayAdapter<String>) autoCompleteDestination.getAdapter(); adapter.clear(); autoCompleteDestination.setAdapter(new ArrayAdapter<String>(NewDestinationActivity.this,android.R.layout.simple_spinner_dropdown_item, new ArrayList<String>(Arrays.asList(addressArray)))); //adapter.notifyDataSetChanged(); // no needed Log.d("SearchAddressTask", "adapter isEmpty : " + adapter.isEmpty()); // keeps returning true!!??! } So my question is, what is really happening with this ArrayAdapter? why I cannot modify it in my onPostExecute()? Why is working in the UI if i am recreating the adapter? and why i need to clear the old adapter then? I dont know there are so many questions that I need some help in here!! Thanks!!

    Read the article

  • SQL Query - group by more than one column, but distinct

    - by Ranhiru
    I have a bidding table, as follows: SellID INT FOREIGN KEY REFERENCES SellItem(SellID), CusID INT FOREIGN KEY REFERENCES Customer(CusID), Amount FLOAT NOT NULL, BidTime DATETIME DEFAULT getdate() Now in my website I need to show the user the current bids; only the highest bid but without repeating the same user. SELECT CusID, Max(Amount) FROM Bid WHERE SellID = 10 GROUP BY CusID ORDER BY Max(Amount) DESC This is the best I have achieved so far. This gives the CusID of each user with the maximum bid and it is ordered ascending. But I need to get the BidTime for each result as well. When I try to put the BidTime in to the query: SELECT CusID, Max(Amount), BidTime FROM Bid WHERE SellID = 10 GROUP BY CusID ORDER BY Max(Amount) DESC I am told that "Column 'Bid.BidTime' is invalid in the select list because it is not contained in either an aggregate function or the GROUP BY clause." Thus I tried: SELECT CusID, Max(Amount), BidTime FROM Bid WHERE SellID = 10 GROUP BY CusID, BidTime ORDER BY Max(Amount) DESC But this returns all the rows. No distinction. Any suggestions on solving this issue?

    Read the article

  • Strange, regex.split Method matches one null element

    - by dontoo
    Regex rx = new Regex(@"[+-]"); string[] substrings = rx.Split(expression); expression = "-9a3dcbh-3bca-4ab4cf-3hc" //This is the iput string I want to split that string between + or -. My VS debugger shows substring array like this: substrings[0] = null //???Why substrings[1] = 9a3dcbh substrings[2] = 3bca substrings[3] = 4ab4cf substrings[4] = 3hc Why is the first element of arry null, is it because I am matching +-, and there is no + in my input string?

    Read the article

  • Play and Stop in One button

    - by Ardi
    i'm newbie, i'm tried to make play audio play and stop for 1 button only, but i'm in trouble now. if i touch a button when audio is playing, it doesn't stop, even playing audio again and make a double sound. here's my code public class ProjectisengActivity extends Activity{ ImageButton mainkan; MediaPlayer mp; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.test2); mainkan=(ImageButton)findViewById(R.id.imageButton1); mainkan.setOnClickListener(new OnClickListener(){ @Override public void onClick(View v){ go(); } }); public void go(){ mp=MediaPlayer.create(ProjectisengActivity.this, R.raw.test); if(mp.isPlaying()){ mp.stop(); try { mp.prepare(); } catch (IllegalStateException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } mp.seekTo(0); } else { mp.start(); } i'm create for android 3.0 (HoneyComb) thanks for help

    Read the article

< Previous Page | 182 183 184 185 186 187 188 189 190 191 192 193  | Next Page >