Search Results

Search found 13288 results on 532 pages for 'print expression'.

Page 187/532 | < Previous Page | 183 184 185 186 187 188 189 190 191 192 193 194  | Next Page >

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

  • Looking for another regex explanation

    - by Sam
    In my regex expression, I was trying to match a password between 8 and 16 character, with at least 2 of each of the following: lowercase letters, capital letters, and digits. In my expression I have: ^((?=.*\d)(?=.*[a-z])(?=.*[A-Z])(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16})$ But I don't understand why it wouldn't work like this: ^((?=\d)(?=[a-z])(?=[A-Z])(?=\d)(?=[a-z])(?=[A-Z]){8,16})$ Doesnt ".*" just meant "zero or more of any character"? So why would I need that if I'm just checking for specific conditions? And why did I need the period before the curly braces defining the limit of the password? And one more thing, I don't understand what it means to "not consume any of the string" in reference to "?=".

    Read the article

  • Network printing -- setting up and printing over network using Mac OS X

    - by crippledlambda
    I've connected a USB printer to a Mac OS X (10.4) machine -- this computer is connected to a network with a registered IP address -- and enabled sharing through the System Preferences setting (under "Shared" and "Print & Fax". Is this printer shared through the Bonjour or CUPS protocol (does it matter that I know)? How do I sent a print job to this computer (also from a 10.4 OS X machine)? It does not show up in the list of printers in the Default Network when I go to "add printer"; do I need to do anything else (on either machine)? Thanks much!

    Read the article

  • Unable to delete a file using bash script

    - by user3719091
    I'm having problems removing a file in a bash script. I saw the other post with the same problem but none of those solutions solved my problem. The bash script is an OP5 surveillance check and it calls an Expect process that saves a temporary file to the local drive which the bash script reads from. Once it has read the file and checked its status I would like to remove the temporary file. I'm pretty new to scripting so my script may not be as optimal as it can be. Either way it does the job except removing the file once it's done. I will post the entire code below: #!/bin/bash #GET FLAGS while getopts H:c:w: option do case "${option}" in H) HOSTADDRESS=${OPTARG};; c) CRITICAL=${OPTARG};; w) WARNING=${OPTARG};; esac done ./expect.vpn.check.sh $HOSTADDRESS #VARIABLES VPNCount=$(grep -o '[0-9]\+' $HOSTADDRESS.op5.vpn.results) # Check if the temporary results file exists if [ -f $HOSTADDRESS.op5.vpn.results ] then # If the file exist, Print "File Found" message echo Temporary results file exist. Analyze results. else # If the file does NOT exist, print "File NOT Found" message and send message to OP5 echo Temporary results file does NOT exist. Unable to analyze. # Exit with status Critical (exit code 2) exit 2 fi if [[ "$VPNCount" > $CRITICAL ]] then # If the amount of tunnels exceeds the critical threshold, echo out a warning message and current threshold and send warning to OP5 echo "The amount of VPN tunnels exceeds the critical threshold - ($VPNCount)" # Exit with status Critical (exit code 2) exit 2 elif [[ "$VPNCount" > $WARNING ]] then # If the amount of tunnels exceeds the warning threshold, echo out a warning message and current threshold and send warning to OP5 echo "The amount of VPN tunnels exceeds the warning threshold - ($VPNCount)" # Exit with status Warning (exit code 1) exit 1 else # The amount of tunnels do not exceed the warning threshold. # Print an OK message echo OK - $VPNCount # Exit with status OK exit 0 fi #Clean up temporary files. rm -f $HOSTADDRESS.op5.vpn.results I have tried the following solutions: Create a separate variable called TempFile that specifies the file. And specify that in the rm command. I tried creating another if statement similar to the one I use to verify that file exist and then rm the filename. I tried adding the complete name of the file (no variables, just plain text of the file) I can: Remove the file using the full name in both a separate script and directly in the CLI. Is there something in my script that locks the file that prevents me from removing it? I'm not sure what to try next. Thanks in advance!

    Read the article

  • Properly escaping forward slash in bash script for usage with sed

    - by user331839
    I'm trying to determine the size of the files that would be newly copied when syncing two folders by running rsync in dry mode and then summing up the sizes of the files listed in the output of rsync. Currently I'm stuck at prefixing the files by their parent folder. I found out how to prefix lines using sed and how to escape using sed, but I'm having troubles combining those two. This is how far I got: source="/my/source/folder/" target="/my/target/folder/" escaped=`echo "$source" | sed -e 's/[\/&]/\\//g'` du `rsync -ahnv $source $target | tail -n +2 | head -n -3 | sed "s/^/$escaped/"` | awk '{i+=$1} END {print i}' This is the output I get from bash -x myscript.sh + source=/my/source/folder/ + target=/my/target/folder ++ echo /my/source/folder/ ++ sed -e 's/[\/&]/\//g' + escaped=/my/source/folder/ + awk '{i+=$1} END {print i}' ++ rsync -ahnv /my/source/folder/ /my/target/folder/ ++ sed 's/^//my/source/folder//' ++ head -n -3 ++ tail -n +2 sed: -e expression #1, char 8: unknown option to `s' + du 80268 Any ideas on how to properly escape would be highly appreciated.

    Read the article

  • MacBook Pro with Time Capsule can not see Samsung CLX 3175FW wireless printer on Bonjour

    - by syncopat
    I have a MacBook Pro running OS X 10.6 and another MacBook Pro running OS X 10.5. Neither see my Samsung printer when I click on Bonjour. Needless to say neither will print. I have a Time Capsule connected wirelessly to my MacBook Pros. I have tried reinstalling drivers for the printer but nothing seems to work. I tried this approach because when Apple replaced my Time Capsule and I went to print the way I had initially been running printing requests would get hung up. Any suggestions would be helpful?

    Read the article

  • Xerox phaser 7760 prints gray as pink.

    - by Leif
    I have a Xerox phaser 7760 and 60 iMacs that dual boot xp and osx 10.5. They print without problem to other printers, but if you print to the 7760 anything gray scale comes out with a pink tint. This happens from all 60 computers windows or mac boot from any application. I have reinstalled the driver and run the color balance on the printer. The printer does fine on internal prints of gray for diagnostic pages. Any ideas on how to solve this?

    Read the article

  • Canon MF3200 Printer Problems

    - by Derick K.
    I bought a Canon MF3200 and used it on an old Windows laptop. The laptop broke, and now I'm trying to setup the printer on a laptop with Windows 7. I downloaded the new driver, and Windows was able to install it and mark it "Ready to Go." But whenever I try to print, an error comes up and it doesn't print. I tried to troubleshoot, to no avail. What else can I do? Any ideas on what the error might be?

    Read the article

  • nginx can't load images,css,js

    - by EquinoX
    When I point to a URL in nginx where it has images extension such as: http://50.56.81.42/phpMyAdmin/themes/original/img/logo_right.png (as example) it gives me the 404 error as it can't find the file, but the file is actually there. What is potentially wrong? UPDATE: Here's the error log that I was able to pull out: 2011/02/27 05:53:29 [error] 18679#0: *225 open() "/usr/local/nginx/html/phpMyAdmin/js/mooRainbow/mooRainbow.css" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/js/mooRainbow/mooRainbow.css HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:53:29 [error] 18679#0: *226 open() "/usr/local/nginx/html/phpMyAdmin/print.css" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/print.css HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:53:29 [error] 18679#0: *228 open() "/usr/local/nginx/html/phpMyAdmin/themes/original/img/logo_right.png" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/themes/original/img/logo_right.png HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:53:29 [error] 18679#0: *223 open() "/usr/local/nginx/html/phpMyAdmin/themes/original/img/b_help.png" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/themes/original/img/b_help.png HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:53:29 [error] 18679#0: *227 open() "/usr/local/nginx/html/phpMyAdmin/themes/original/img/s_warn.png" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/themes/original/img/s_warn.png HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:53:29 [error] 18679#0: *227 open() "/usr/local/nginx/html/phpMyAdmin/favicon.ico" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/favicon.ico HTTP/1.1", host: "50.56.81.42" 2011/02/27 05:54:39 [error] 18679#0: *237 open() "/usr/local/nginx/html/phpMyAdmin/print.css" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/print.css HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:54:39 [error] 18679#0: *235 open() "/usr/local/nginx/html/phpMyAdmin/js/mooRainbow/mooRainbow.css" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/js/mooRainbow/mooRainbow.css HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:54:39 [error] 18679#0: *238 open() "/usr/local/nginx/html/phpMyAdmin/themes/original/img/logo_right.png" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/themes/original/img/logo_right.png HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:54:39 [error] 18679#0: *239 open() "/usr/local/nginx/html/phpMyAdmin/themes/original/img/b_help.png" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/themes/original/img/b_help.png HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:54:39 [error] 18679#0: *233 open() "/usr/local/nginx/html/phpMyAdmin/themes/original/img/s_warn.png" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/themes/original/img/s_warn.png HTTP/1.1", host: "50.56.81.42", referrer: "http://50.56.81.42/phpMyAdmin/main.php" 2011/02/27 05:54:39 [error] 18679#0: *233 open() "/usr/local/nginx/html/phpMyAdmin/favicon.ico" failed (2: No such file or directory), client: 70.176.18.156, server: localhost, request: "GET /phpMyAdmin/favicon.ico HTTP/1.1", host: "50.56.81.42" Here's my nginx.conf file, in case I am missing something: #user nobody; worker_processes 1; #error_log logs/error.log; #error_log logs/error.log notice; #error_log logs/error.log info; #pid logs/nginx.pid; events { worker_connections 1024; } http { include mime.types; default_type application/octet-stream; #log_format main '$remote_addr - $remote_user [$time_local] "$request" ' # '$status $body_bytes_sent "$http_referer" ' # '"$http_user_agent" "$http_x_forwarded_for"'; #access_log logs/access.log main; sendfile on; #tcp_nopush on; #keepalive_timeout 0; keepalive_timeout 65; #gzip on; server { listen 80; server_name localhost; #charset koi8-r; #access_log logs/host.access.log main; location / { root html; index index.html index.htm; } #error_page 404 /404.html; # redirect server error pages to the static page /50x.html # error_page 500 502 503 504 /50x.html; location = /50x.html { root html; } location ~ \.(js|css|png|jpg|jpeg|gif|ico|html)$ { expires max; } # proxy the PHP scripts to Apache listening on 127.0.0.1:80 # #location ~ \.php$ { # proxy_pass http://127.0.0.1; #} # pass the PHP scripts to FastCGI server listening on 127.0.0.1:9000 # location ~ \.php$ { root /usr/share/nginx/html; fastcgi_pass 127.0.0.1:9000; fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME /usr/share/nginx/html$fastcgi_script_name; include fastcgi_params; } # deny access to .htaccess files, if Apache's document root # concurs with nginx's one location ~ /\.ht { deny all; } } # another virtual host using mix of IP-, name-, and port-based configuration # #server { # listen 8000; # listen somename:8080; # server_name somename alias another.alias; # location / { # root html; # index index.html index.htm; # } #} # HTTPS server # #server { # listen 443; # server_name localhost; # ssl on; # ssl_certificate cert.pem; # ssl_certificate_key cert.key; # ssl_session_timeout 5m; # ssl_protocols SSLv2 SSLv3 TLSv1; # ssl_ciphers ALL:!ADH:!EXPORT56:RC4+RSA:+HIGH:+MEDIUM:+LOW:+SSLv2:+EXP; # ssl_prefer_server_ciphers on; # location / { # root html; # index index.html index.htm; # } #} } What does this mean? It can't pull out the .css, etc....

    Read the article

  • Delay between printing via lp in opensuse

    - by adamweeks
    I am experiencing a 10-15 second delay when printing multiple documents to a barcode printer in opensuse. I have had the same setup on other systems with older versions of opensuse without any issue. The setup is as follows: The print queue is setup as a "generic with driver Raw Queue". The files being sent down to the printers are simple text files with the lp command: lp -dprinter1 /path/file The printer is a JetDirect compatible device (Intermec brand) with a standard 9100 port socket setup. If I send a multi-page document to the printer, it will print nonstop the multiple pages. If I send 2 or more text files down via separate "lp" commands, the delay will be there between each printout. I've tried multiple different printers and they all experience the same issue.

    Read the article

  • Brother Printer not picking up A5 size paper

    - by Mirage
    I have Brother HL 5040D printer . I want to print some stuff on A5 size. I have done setting on MS word. There is small tray in Brother Printer manin tray where i can put any samll paper and then move the clamps so that it fits the paper. But when i give print command the printer tries to pick up paper but is unable to do so. Then it gave paper light means it can't load the paper. What should i do

    Read the article

  • How to modify PATH variable for X11 during log-in?

    - by user1028435
    Original question is here: Overwriting "Print Screen" actions in linux without administrative rights. Decided to revise my question, based on what I learned there: Essentially, my problem is that I am working on some lab computers (read: no administrative rights) that, if I log in, I need to change the PATH variable as X11 starts. The reason is that I need to change the PATH variable at this time, as opposed to later, is that the Print Screen command seems to "bind" during login (forgive my bad explanation of this). You can see in the work-around I listed in the previous section, that I can make it work by starting a new X, but I was wondering if it is possible to change upon login. Any ideas?

    Read the article

  • Printer ports missing from network printers, Windows 7 laptops

    - by pigeon
    Have an odd issue where users take their laptops home and back into the office with network printers that get mapped via a login script but fail to print. After tracking down a user with this problem I found that the print driver had no ports available to it. We've mapped network printers for this site all the time but only since the introduction of the Konica Minolta C220 Bizhub has this issue cropped up. The issue occurs with Windows 7 users and it takes them 2 /3 reboots to have the ports recreated. Should I be looking at the server for this or at the Windows 7 machines?

    Read the article

  • Why do Finder and du report different file size?

    - by flipdoubt
    I am writing a geektool 3 script to show the size of a particular VMware Fusion virtual machine. Get Info in Finder says the file is "52.91 GB". I run the following du command to get the file size: > du -hs ~/Documents/Virtual\ Machines.localized/MY-PRECIOUS-7.vmwarevm | awk '{print $1}' This du -hs command returns the file size as "49G". What accounts for the difference from what Finder reports? Alternatively, I have tried replacing the -s option with the -d option like so: du -hd ~/Documents/Virtual\ Machines.localized/MY-PRECIOUS-7.vmwarevm | awk '{print $1}' This du -hd command returns the file size as "59G". What accounts for the difference between Finder, du -hd, and du -hs? Also, this du -hd command produces no output in geektool 3. What gives?

    Read the article

< Previous Page | 183 184 185 186 187 188 189 190 191 192 193 194  | Next Page >