Search Results

Search found 10662 results on 427 pages for 'cursor position'.

Page 188/427 | < Previous Page | 184 185 186 187 188 189 190 191 192 193 194 195  | Next Page >

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• SEM/SEO tasks doubts

  - by Josemalive

  Hello, Actually i think that i have an strong knowledge of SEO, but im having some doubts about the following: I will have to increase the position in Google of certain product pages of a company in the next months. I supposed that not only will be sufficient the following tasks: Improve usability of those pages. Change the pages title. Add meta description and keywords. Url's in a REST way. 301's http header to dont lose page rank for the new URLS Optimizing content for Google. Configure links of the website (follow and no follow attributes) Get more inbounds links (Link building tasks). Create RSS. Put main website in Twitter (using twitter feed) using the RSS. Put main website in Facebook. Create a Youtube channel. Invest in Adwords. Invest in other online advertising companies. Use sitemap.xml and Google Webmaster tools. Use Google Trends to analyze the volume of searches of certain keywords. Use Google Analytics to analyze weak points and good points of your site, and find new oportunities in keywords. Use tools to find new keywords related with your content. Do you have some internet links, or knowledge about all the tasks that a SEO Expert should do? Could you share some knowledge about what kind of business could be do with another companies (B2B) to increase the search engine position of those product pages. Do you know more tecniques about how to get more inbound links? (i only know the link interchange) Thanks in advance. Best Regards. Jose.

  Read the article

• Silverlight: how to use a scroll viewer to wrap a list view without specifying height?

  - by John Nicholas

  I have a control that has a list that varies in length greatly. This control appears in various places meaning that i cannot calculate its position and desired height easily. Moreover all I want is for the scrollviewer to simply size itself according to its parent. currently it insists on sizing itself according to the content. currently when i have a list that exceeds the height of the screen the whole control extends off the bottom and the scrollviewer shows no bar (because it has stretched to the heigth of the contents and so thinks it is not required). I've not included code as the object graph is fairly deep. What i am looking for is a set of conditions that would cause the scrollviewer to resize itself according to its content rather than its parent. I have it working in a similar situation involving grids and datagrids, the unique part of this control is that there is a list containing controls. Any ideas? I would prefer solutions that don't require use of code behind - but im really not in a position to be choosey.

  Read the article

• Java & android: Help linking an item in a listView to its correct view, but not the way i know of.

  - by Capsud

  Hi, i'm developing an android app, and what i have is a String array of restaurants in one class... static final String[] AtoZ = new String[] { "Ananda", "Brambles Cafe", "Brannigans", "Buona Sera", "Cafe Mao", "Cafe Mimo", "Dante", "Eddie Rockets", "Frango's World Cuisine", "Nando's", "Overends Restaurant @ Airfield House", "Pizza Hut", "Roly Saul", "Siam Thai","Smokey Joes","Sohag Tandoori", "TGI Friday","The Rockfield Lounge", "Winters Bar", "Al Boschetto","Baan Thai", "Bella Cuba", "Bellamys","Bianconis","Canal Bank Cafe", "Canalettos Restaurant","Chandni Restaurant", "Chill Out Cafe", "Crowes", "Da Vincenzo", "Druids", "Dylan", "Epic Restaurant", "Jewel in the Crown", "Juniors", "Kanum Thai","Kites", "Koishi","Maia Restaurant", "Mangetu Restaurant", "Millers Pizza Kitchens", "O'Connells Restaurant", "Ocras Restaurant", "Orchid Szechuan Restaurant", "Roly's Bistro", "Ryans Beggars Bush", }; i have created a view for each of these restaurants aswell in my layouts folder. so this array is going to be displayed in a listView in my android app. What i want to know is what is the quickest way of linking the item clicked to its correct view, without having to type out each position in the array and have a serious of if statements which would take a year with this! i dont want to be doing something like this if(position == 1){ setContentView(R.layout.bentleys); as it would take a year doing that for each one... Please help. thanks alot.

  Read the article

• How do I get uri of HTTP packet with winpcap?

  - by Gtker

  Based on this article I can get all incoming packets. /* Callback function invoked by libpcap for every incoming packet */ void packet_handler(u_char *param, const struct pcap_pkthdr *header, const u_char *pkt_data) { struct tm *ltime; char timestr[16]; ip_header *ih; udp_header *uh; u_int ip_len; u_short sport,dport; time_t local_tv_sec; /* convert the timestamp to readable format */ local_tv_sec = header->ts.tv_sec; ltime=localtime(&local_tv_sec); strftime( timestr, sizeof timestr, "%H:%M:%S", ltime); /* print timestamp and length of the packet */ printf("%s.%.6d len:%d ", timestr, header->ts.tv_usec, header->len); /* retireve the position of the ip header */ ih = (ip_header *) (pkt_data + 14); //length of ethernet header /* retireve the position of the udp header */ ip_len = (ih->ver_ihl & 0xf) * 4; uh = (udp_header *) ((u_char*)ih + ip_len); /* convert from network byte order to host byte order */ sport = ntohs( uh->sport ); dport = ntohs( uh->dport ); /* print ip addresses and udp ports */ printf("%d.%d.%d.%d.%d -> %d.%d.%d.%d.%d\n", ih->saddr.byte1, ih->saddr.byte2, ih->saddr.byte3, ih->saddr.byte4, sport, ih->daddr.byte1, ih->daddr.byte2, ih->daddr.byte3, ih->daddr.byte4, dport); } But how do I extract URI information in packet_handler?

  Read the article

• Determine whether a canvas has been inserted into each page

  - by Hadi Teo

  Hi, Currently i have a code which will print OMR Mark on each pages. Basically i insert a canvas into each page and subsequently an OMR Mark Line Series are inserted into the canvas. Recently i found an issue that somehow one of the canvas is placed out of a page and it appears at the previous page instead of the current page. Below is the code snippet in how i inserted canvas as well as OMR Marks into each page: ' Start Code Snippet Sub GenerateOMR() Dim ShpCanvas As Shape Dim MaxPages As Integer Dim PNo As Integer ClearOMR MaxPages = Selection.Information(wdNumberOfPagesInDocument) For PNo = 1 To MaxPages Selection.GoTo What:=wdGoToPage, Which:=wdGoToFirst, Count:=PNo, Name:="" Select Case PNo Case 1 Set ShpCanvas = ActiveDocument.Shapes.AddCanvas(0, 0.5, 600, 300) Case Else Set ShpCanvas = ActiveDocument.Shapes.AddCanvas(0, 0, 600, 300) End Select ' Add a canvas on each page With ShpCanvas .Name = "OMR_Canvas_" & CStr(PNo) .RelativeHorizontalPosition = wdRelativeHorizontalPositionPage .RelativeVerticalPosition = wdRelativeVerticalPositionPage End With ' Insert a white background rectange and remove the rectangle border line With ShpCanvas.CanvasItems.AddShape(msoShapeRectangle, 536, 0, 64, 300) .Name = "OMR_WhiteBackground_" & CStr(PNo) .Fill.ForeColor.RGB = RGB(255, 255, 255) .Line.ForeColor.RGB = RGB(255, 255, 255) End With PrintOMRPage ShpCanvas, PNo Next PNo End Sub ' End Code Snippet There is a custom method called PrintOMRPage method which is not relevant here. My question now, how do i know whether a canvas has been inserted into a page ? Basically i will loop in all the pages and check whether a canvas has been inserted into that page. Apparently i cannot find the correct way. I have tried to check using ActiveDocument.Shapes(1).Top and validate whether the Top position is a negative value. But apparently the Top position is always measured from the top of each page. Thanks for the help. hadi teo

  Read the article

• How does real-time collaboration with multiple clients work in a system using operation transformati

  - by Saikat Chakrabarti

  I just finished reading High-Latency, Low-Bandwidth Windowing in the Jupiter Collaboration System and I mostly followed everything until part 6: global consistency. This part describes how the system described in the paper can be extended to accomodate for multiple clients connected to the server. However, the explanation is very short and essentially says the system will work if the central server merely forwards client messages to all the other clients. I don't really understand how this works though. What state vector would be sent in the message that is sent to all the other clients? Does the server maintain separate state vectors for each client? Does it maintain a separate copy of the widgets locally for each client? The simple example I can think of is this setup: imagine client A, server, and client B with client A and client B both connected to the server. To start, all three have the state object "ABCD". Then, client A sends the message "insert character F at position 0" at the same time client B sends the message "insert character G at position 0" to the server. It seems like simply relaying client A's message to client B and vice versa doesn't actually handle this case. So what exactly does the server do?

  Read the article

• DjangoUnicodeDecodeError while storing pickle'd data.

  - by Jack M.

  I've got a simple dict object I'm trying to store in the database after it has been run through pickle. It seems that Django doesn't like trying to encode this error. I've checked with MySQL, and the query isn't even getting there before it is throwing the error, so I don't believe that is the problem. The dict I'm storing looks like this: { 'ordered': [ { 'value': u'First\xd1ame Last\xd1ame', 'label': u'Full Name' }, { 'value': u'123-456-7890', 'label': u'Phone Number' }, { 'value': u'[email protected]', 'label': u'Email Address' } ], 'cleaned_data': { u'Phone Number': u'123-456-7890', u'Full Name': u'First\xd1ame Last\xd1ame', u'Email Address': u'[email protected]' }, 'post_data': <QueryDict: { u'Phone Number': [u'1234567890'], u'Full Name_1': [u'Last\xd1ame'], u'Full Name_0': [u'First\xd1ame'], u'Email Address': [u'[email protected]'] }>, 'user': <User: itis> } The error that gets thrown is: 'utf8' codec can't decode bytes in position 52-53: invalid data. Position 52-53 is the first instance of \xd1 (Ñ) in the pickled data. So far, I've dug around StackOverflow and found a few questions where the database encoding for the objects was wrong. This doesn't help me because there is no MySQL query yet. This is happening before the database. Google also didn't help much when searching for unicode errors on pickled data. It is probably worth mentioning that if I don't use the Ñ, this code works fine.

  Read the article

• CSS Menu disappear

  - by WtFudgE

  Hi, I created a menu in html/css but where I wanted the subitems to be shown on parent item hover. The problem is when I hover on it in IE it only shows it's subitems when I hover on the text in the menu item, If I hover over the element and not the text the subitems disappear again. So if I hover and want to move my mouse to my submenu the submenu disappears unless I'm fast enough. This is very annoying, does anyone know how I can solve this? MY menu code is like so: <ul id="leftnav"> Item1 SubItem1 SubItem2 SubItem3 Item2 SubItem1 SubItem2 SubItem3 The menu should be a left sided menu which shows it's subitems only on hover, so I used css to achieve this with the following code: #leftnav, #leftnav ul { padding: 0; margin: 0; } #leftnav ul li { margin-left: 102px; position: relative; top: -19px; /*sets the childitems on the same height as the parent item*/ } #leftnav li { float: left; width: 100px; } #leftnav ul { position: absolute; width: 100px; left: -1000px; /*makes it disappear*/ } #leftnav li:hover ul, #leftnav li.ie_does_hover ul { left: auto; } #leftnav a { display: block; height: 15px; margin-top: 2px; margin-bottom: 2px; } Since this only works with firefox I also had to insert a javascript to get this to work in IE using code: <script language="JavaScript"> sfHover = function() { var sfElsE = document.getElementById("leftnav").getElementsByTagName("LI"); for (var i=0; i<sfElsE.length; i++) { sfElsE[i].onmouseover=function() { this.className+=" ie_does_hover"; } sfElsE[i].onmouseout=function() { this.className=this.className.replace(new RegExp(" ie_does_hover\\b"), ""); } } } if (window.attachEvent) window.attachEvent("onload", sfHover); </script> Many many many thanks for replies

  Read the article

• Inflated ImageView to put in GalleryView isn't the right size

  - by Richard

  I am trying to inflate an ImageView that scales a Drawable that I can display in a GalleryView. My code to inflate the view seems to work fine, except that the attributes of the ImageView are not applied. Specifically, the inflated ImageView does not have the width/height that I set for it via the android:layout params in XML. Can someone show me what I'm doing wrong? I want to set the width/height of the image in dp, so that it is the correct size across multiple screen dpis and support Android 1.5+. As a result I cannot use something like: i.setLayoutParams(new Gallery.LayoutParams(150, 116) My layout definition is: <?xml version="1.0" encoding="utf-8"?> <ImageView xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="150dp" android:layout_height="116dp" android:background="@drawable/gallery_item_background" android:scaleType="fitXY" /> </ImageView> And the snippet I am using to inflate the ImageView is: public View getView(int position, View convertView, ViewGroup parent) { LayoutInflater inflater = getLayoutInflater(); ImageView i = (ImageView) inflater.inflate(R.layout.gallery_item, null); i.setImageResource(mImageIds.get(position)); i.setScaleType(ImageView.ScaleType.FIT_XY); return i; }

  Read the article

• Android Custom Adapter with Bar Progress

  - by xger86x

  Hi, i have a custom adapter for an arraylist. <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="wrap_content" android:layout_height="wrap_content" android:orientation="horizontal"> <ProgressBar android:id="@+id/downloadprogress" style="?android:attr/progressBarStyleHorizontal" android:layout_width="200dip" android:layout_height="wrap_content" android:max="100" android:progress="50" android:secondaryProgress="75" /> <TextView android:id="@+id/tripsname" android:layout_width="wrap_content" android:layout_height="wrap_content"/> </LinearLayout> but when i try to access to the progress bar in the adapter private class MyAdapter extends ArrayAdapter<Trip> { int resource; public MyAdapter(Context context, int resource, ArrayList<Trip> items) { super(context, resource,items); this.resource=resource; } @Override public View getView(int position, View convertView, ViewGroup parent) { LinearLayout tripListItemView; final Trip t = getItem(position); String name = t.getName(); boolean offline = t.isOffline() ; if(convertView==null) { tripListItemView = new LinearLayout(getContext()); String inflater = Context.LAYOUT_INFLATER_SERVICE; LayoutInflater vi; vi = (LayoutInflater)getContext().getSystemService(inflater); vi.inflate(resource, tripListItemView, true); } else { tripListItemView = (LinearLayout) convertView; } setProgressBarVisibility(true); View v = findViewById(R.id.downloadprogress); ProgressBar progressHorizontal = (ProgressBar) findViewById(R.id.downloadprogress); it always return null, like it doesn't find the progress bar. However, the progress bar is shown in the list, but i need to access to it inside the adapter. Anybody knows the solution? Thanks

  Read the article

• using jquery in asp.net to hide div tag

  - by Eyla

  Greetings, I have asp.net check box control and asp.net dropdownlist control inside div tag. I want to hid the div when I check the box and unhide it when I unchecked the box. I tried few ways with jquery but I could not do it. Here is my code please look at it and tell me what is wrong with it. <%@ Page Language="C#" MasterPageFile="~/Master.Master" AutoEventWireup="true" CodeBehind="WebForm1.aspx.cs" Inherits="IMAM_APPLICATION.WebForm1" Title="Untitled Page" %> <asp:Content ID="Content1" ContentPlaceHolderID="head" runat="server"> </asp:Content> <asp:Content ID="Content2" ContentPlaceHolderID="ContentPlaceHolder1" runat="server"> <script src="js/jquery-1.4.1-vsdoc.js" type="text/javascript"></script> <script type="text/javascript"> function ModifyOccup() { $('myOccup').removeClass('display1'); $('myOccup').removeClass('display1'); $('myOccup').removeClass('display'); $('myOccup').removeClass('display'); if ($('#<%=chkOccup.ClientID %>').is(':checked')) { $('myOccup').addClass('display1'); } else { $('myOccup').addClass('display'); } } </script> <asp:CheckBox ID="chkOccup" runat="server" Style="top: 1055px; left: 355px; position: absolute; height: 22px; width: 126px" Text="Check to modify" onclick=" ModifyOccup()"/> <div id ="myOccup" > <asp:DropDownList ID="cmbWorkField" runat="server" Style="top: 1090px; left: 350px; position: absolute; height: 22px; width: 126px"> </asp:DropDownList> </div> </asp:Content> ...................... Style.css File .......................... .display { display: none; } .display1 { display: inherit; }

  Read the article

• Cannot find symbol - variable

  - by Ben Garside

  I'm new to Java, and I'm trying to get user input, store each line of input as a variable and then return each value so that it can be passed on somewhere else. When I try and compile it is telling me that it can't find the variable magnitude. I'm assuming it won't find the others either. I'm guessing that this is because I've declare the variables inside of the "try" but don't know how to get it so that the return statement accepts them. Code is as follows: public Earthquake userAddEarthquake() { Scanner scanner = new Scanner(System.in); try{ // convert the string read from the scanner into Integer type System.out.println("Please Enter An Earthquake Magnitude: "); Double magnitude = Double.parseDouble(scanner.nextLine()); System.out.println("Please Enter The Earthquakes Latitude Position: "); scanner = new Scanner(System.in); Double positionLatitude = Double.parseDouble(scanner.nextLine()); System.out.print("Please Enter The Earthquakes Longitude Position: "); scanner = new Scanner(System.in); Double positionLongitude = Double.parseDouble(scanner.nextLine()); System.out.print("Please Enter The Year That The Earthquake Occured: "); scanner = new Scanner(System.in); int year = Integer.parseInt(scanner.nextLine()); System.out.println("Magnitude = " + magnitude); } catch(NumberFormatException ne){ System.out.println("Invalid Input"); } finally{ scanner.close(); } return new Earthquake(magnitude, positionLatitude, positionLongitude, year); }

  Read the article

• Changing Positions of the Chart When Creating Multiple Charts Automatically via Vbasic in Excel 2007

  - by McVey

  I am creating a new chart for each row of data in an Excel spreadsheet. I have the Vbasic working properly, but I want to change the position of the chart on the sheet that is added for each row. Below is my code, what do I need to do to change the position of the chart on the page automatically? Ideally, I would like it to be in the upper left hand corner of each sheet. Sub DrawCharts() Dim Ws As Worksheet Dim NewWs As Worksheet Dim cht As Chart Dim LastRow As Long Dim CurrRow As Long Set Ws = ThisWorkbook.Worksheets("Sheet1") LastRow = Ws.Range("A65536").End(xlUp).Row For CurrRow = 2 To LastRow Set NewWs = ThisWorkbook.Worksheets.Add NewWs.Name = Ws.Range("A" & CurrRow).Value Set cht = ThisWorkbook.Charts.Add With cht .ChartType = xl3DColumnClustered .SeriesCollection.NewSeries .SeriesCollection(1).Values = "=" & Ws.Name & "!R" & CurrRow & "C3:R" & CurrRow & "C8" .SeriesCollection(1).Name = "=" & Ws.Name & "!R" & CurrRow & "C2" .SeriesCollection(1).XValues = "Sheet1!R1C3:R1C8" .Axes(xlValue).MinimumScale = 0 .Axes(xlValue).MaximumScale = 1 .Axes(xlValue).MajorUnit = 0.2 .SetElement (msoElementDataLabelShow) .SetElement (msoElementLegendNone) .Location Where:=xlLocationAsObject, Name:=NewWs.Name End With Next CurrRow End Sub Any help is appreciated.

  Read the article

• Flash gets XML but the values are wrong, as3

  - by VideoDnd

  Flash receives the XML, but the values are wrong. How do I fix this? Problem I can see the XML loaded with no errors, but my output is way off. It's as though it's not receiving any values. Numbers in the output window and animation move rapidly. The Flash file runs as if it's variables where set to zero. I changed the order of my code, but that didn't help with this. Please explain how I can correct this. SWF //load xml var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("xml.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //parse XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML); //receive values from XML delay = parseInt(myXML.DELAY.text()); trace(delay); repeat = parseInt(myXML.REPEAT.text()); trace(repeat); } //variables var delay:uint = 0; var repeat:uint = 0; //timer and event var timer:Timer = new Timer(uint(delay),uint(repeat)); timer.addEventListener(TimerEvent.TIMER, countdown); //counter function countdown(event:TimerEvent) { myText.text = String(0 + timer.currentCount); trace(0 + timer.currentCount); } timer.start(); XML <?xml version="1.0" encoding="utf-8"?> <SESSION> <DELAY TITLE="starting position">1000</DELAY> <REPEAT TITLE="starting position">60</REPEAT> </SESSION>

  Read the article

• How to get list of files which are currently being diffed in vim

  - by Yogesh Arora

  I am writing a vim plugin in which i need to determine all those files which are currently being diffed. That is the ones for which diff is set. I have been going through the manual but could not find much. Is it possible to do this. This question is actually related to question how-to-detect-the-position-of-window-in-vim. In that question i was trying to get the position of window, so as to detect which one of the diffs is the right one and which is left one. The solution i got was to use winnr() That solution can work only if there are only 2 windows(the ones being diffed). I want to make it generic so that even if multiple windows are open in vim, i can determine which one is on left and which one is right. This is what i was thinking to solve the problem Get a list of all listed buffers For each of this buffers determine if diff is 1 for that If diff is 1 use bufwinnr() to gets it window number. From the window numbers determine which one is left and which one is right. left one will have smaller window number And then determine if current buffer(in which alt-left`alt-right` is pressed) is left or right using winnr of current buffer. Now the pieces that are missing are 1 and 2. For 1 ls can be used but i need to parse its output. Is there a straightfwd way to get list of all listed buffers. And then is there a way to check if for that buffer diff is 1 or not. Any suggestions for a simpler solution are also appreciated.

  Read the article

• Database design grouping contacts by lists and companies

  - by Serge

  Hi, I'm wondering what would be the best way to group contacts by their company. Right now a user can group their contacts by custom created lists but I'd like to be able to group contacts by their company as well as store the contact's position (i.e. Project Manager of XYZ company). Database wise this is what I have for grouping contacts into lists contact [id_contact] [int] PK NOT NULL, [lastName] [varchar] (128) NULL, [firstName] [varchar] (128) NULL, ...... contact_list [id_contact] [int] FK, [id_list] [int] FK, list [id_list] [int] PK [id_user] [int] FK [list_name] [varchar] (128) NOT NULL, [description] [TEXT] NULL Should I implement something similar for grouping contacts by company? If so how would I store the contact's position in that company and how can I prevent data corruption if a user modifies a contact's company name. For instance John Doe changed companies but the other co-workers are still in the old company. I doubt that will happen often (might not even happen at all) but better be safe than sorry. I'm also keeping an audit trail so in a way the contact would still need to be linked to the old company as well as the new one but without confusing what company he's actually working at the moment. I hope that made sense... Has anyone encountered such a problem? UPDATE Would something like this make sense contact_company [id_contact_company] [int] PK [id_contact] [int] FK [id_company] [int] FK [contact_title] [varchar] (128) company [id_company] [int] PK NOT NULL, [company_name] [varchar] (128) NULL, [company_description] [varchar] (300) NULL, [created_date] [datetime] NOT NULL This way a contact can work for more than one company and contacts can be grouped by companies

  Read the article

• c# Deserializing an element based on it's parent node's name

  - by daveharnett

  The XML I'm working with has the following structure: <fixture_statistics> <home_player_1 id="2306143" teamid="2"> <element_1>Some Data</element_1> <element_2>Some Data</element_2> </home_player_1> <home_player_2 id="2306144" teamid="2"> <element_1>Some Data</element_1> <element_2>Some Data</element_2> </home_player_2> </fixture_statistics> Now the code to deserialize it would normally look like this: [XmlRootAttribute("fixture_statistics", Namespace = "", IsNullable = false)] public class FixtureRoot { [XmlElement("home_player_1")] [XmlElement("home_player_2")] public List<FixtureStats> fixtures { get; set; } } public class FixtureStats { public string element_1; [XMLElement("element_2")] public string elementTwo; } Here's the question: I'd like the FixtureStats class to have a 'position' property which corrosponds to it's parent's element name (so the FixtureStat object corrosponding to home_player_1 would have position=1). Can this be done with the built-in serialization atrributes? If it's not possible, what's the cleanest workaround? Bear in mind that each document will have about 50 player elements, each with about 50 'child' data elements.

  Read the article

• Positioning one div to the right of another

  - by Jonno_FTW

  Hi I have the following html and css. But what I can't figure out is how to have the tabs div at the right of the main div. So that they stick out the right like bookmarks. .main { -moz-border-radius:10px; height: 75%; width: 60%; position: absolute; top: 15%; left: 20%; right: auto; } .tabs { width: 50px; height: 1.3em; position: absolute; float: right; } #tab { margin: 10px 10px 10px 0px;} And the html: <div class="main"> <div id="content"> Some main content </div> </div> <div class="tabs"> <div class="tabs" id="tab"> <a href="#" alt="Home"> Home </a> </div> <div class="tabs" id="tab"> <a href="#" alt="About"> About </a> </div>

  Read the article

• CSS / jQuery Vertically and Horizontally Center DIV

  - by aherrick

  I'm trying to vertically and horizontally center this div even when there is content to scroll and the user is scrolling down the page. The following test works fine in IE, but in Firefox I get a weird flickering affect when hovering over the thumbnail image. Any thoughts? <html> <head> <title>aj</title> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js"></script> <script type="text/javascript"> $(function() { // img preview $('.img').hover(function() { if (!$('#overlay').length) { $('<div id="overlay"/>').css({ position: 'fixed', top: 0, left: 0, width: '100%', zIndex: 100, height: $(window).height() + 'px' }).appendTo('body'); $('<div id="item" />').css({ border: '7px solid #999', height: '500px', width: '500px', top: '50%', left: '50%', position: 'absolute', marginTop: '-250px', marginLeft: '-250px' }).append('<img src="' + $(this).attr('rel') + '" alt="img" />').appendTo('#overlay'); } }, function() { $('#overlay').remove(); }); }); </script> </head> <body> <img class="img" src="http://ajondeck.net/temp/paperboy_thumb.gif" rel="http://ajondeck.net/temp/paperboy.gif" alt="image" /> </body> </html>

  Read the article

• External XML and AS3

  - by VideoDnd

  I want to pass external XML a variable. How do I do this? WHAT I'M AFTER - update my variable with COUNT XML WHAT I'M NOT GETTING - The integer to String values - How to pass XML to a variable link http://videodnd.weebly.com/ time.xml <?xml version="1.0" encoding="utf-8"?> <SESSION> <COUNT TITLE="starting position">-77777</COUNT> </SESSION> xml.fla //VARIABLES /*CHANGE TO COUNT MyString or count, I don't know if it was necessary to go from int to String */ var myString:String = ""; var count:int = int(myString); trace(count); //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.COUNT.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.COUNT.*; addChild(text); } output window 'traces to the output window correctly' //zero should read -77777 if tracing correctly 0 -77777 <SESSION> <COUNT TITLE="starting position">-77777</COUNT> </SESSION> errors coercion errors and null references with anything I attempt.

  Read the article

• Android: Change the source of ImageView present in ListView

  - by Vivek

  Hi All, I have a ListView specified by list_item.xml Now I need to change the Image in my list inside onListItemClick. How to achieve this? //list_item.xml <?xml version="1.0" encoding="UTF-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="fill_parent" android:layout_height="wrap_content"> <ImageView android:layout_width="wrap_content" android:layout_height="wrap_content" android:src="@drawable/play" android:id="@+id/img" /> <TextView android:layout_width="wrap_content" android:layout_height="wrap_content" android:gravity="center_vertical" android:id="@+id/txt" /> </LinearLayout> I have a Custom Adapter to populate my list. Code below is the adapter. public class MyCustomAdapter extends ArrayAdapter<String> { public MyCustomAdapter(Context context, int textViewResourceId, String[] objects) { super(context, textViewResourceId, objects); // TODO Auto-generated constructor stub } @Override public View getView(int position, View convertView, ViewGroup parent) { // TODO Auto-generated method stub LayoutInflater inflater=getLayoutInflater(); View row=inflater.inflate(R.layout.list_item, parent, false); TextView label=(TextView)row.findViewById(R.id.txt); label.setText(Sounds[position]); ImageView icon=(ImageView)row.findViewById(R.id.img); icon.setMaxHeight(32); icon.setMaxWidth(32); icon.setPadding(2, 1, 5, 1); icon.setImageResource(R.drawable.play); return row; } } And in onCreate I do the following @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); try { setListAdapter(new MyCustomAdapter(this, R.layout.list_item, Sounds)); //Sounds --> String array } catch(Exception e) { e.printStackTrace(); } } Now when any row is selected, I need to change the image associated with the selected view. Your help is appreciated. Thanks.

  Read the article

• XSLT Global count of grouped items

  - by Chris

  Hi there, I have a set of items which i am grouping using the muenchian method using keys. This is working great however when i try to do things with the first x number of items it is doing it on the x number of items in each group rather than across the whole set of results. How would i get the individual position of each item accross the whole collection? <xsl:key name="pictures-by-productid" match="/dsQueryResponse/Rows/Row" use="@ProductId" /> <xsl:template match="/"> <div style="border:1px solid red; float:left;"> <xsl:apply-templates select="/" mode="sub"> </xsl:apply-templates> </div> </xsl:template> and the second template <xsl:template match="/" mode="sub"> <xsl:for-each select="/dsQueryResponse/Rows/Row[count(. | key('pictures-by-productid', @ProductId)[1]) = 1]"> <xsl:for-each select="key('pictures-by-productid', @ProductId)"> <xsl:sort select="@PictureType" /> <div style="float:left; margin:2px;"> <img src="{@ThumbNailUrl}" width="58" /> <br /> Download <xsl:number value="position()" format="1. " /> <xsl:value-of select="." /> </div> </xsl:for-each> </xsl:for-each> </xsl:template> Thanks Chris

  Read the article

• Jquery UI Datepicker not displaying

  - by scott

  UPDATE I have reverted back to Jquery 1.3.2 and everything is working, not sure what the problem is/was as I have not changed anything else apart of the jquery and ui library versions. UPDATE END I having an issue with the JQuery UI datepicker. The datepicker is being attached to a class and that part is working but the datepicker is not being displayed. Here is the datepicker code I am using and the inline style that is being generated when I click in the input box that has the class ".datepicker". $('.datepicker').datepicker({dateFormat:'dd/mm/yy'}); display:none; left:418px; position:absolute; top:296px; z-index:1; If I change the display:none to display:block the datepicker works fine except it dosen't close when I select a date. Jquery libraries in use: jQuery JavaScript Library v1.4.2 jQuery UI 1.8 jQuery UI Widget 1.8 jQuery UI Mouse 1.8 jQuery UI Position 1.8 jQuery UI Draggable 1.8 jQuery UI Droppable 1.8 jQuery UI Datepicker 1.8

  Read the article

• How to make transition effect on css sprite hover

  - by MonsterMMORPG

  Here part of my css sprite code #IconSet a { width: 36px; height: 36px; display: inline-block; } #DeviantArtIcon { border-width: 0px; border-style: none; background-image: url(http://static.monstermmorpg.com/images/csssprites/SocialIcons.png); background-color: transparent; background-repeat: repeat-x; background-position: -144px -0px; width: 36px; height: 36px; } #DeviantArtIcon:hover { border-width: 0px; border-style: none; background-image: url(http://static.monstermmorpg.com/images/csssprites/SocialIcons.png); background-color: transparent; background-repeat: repeat-x; background-position: -144px -36px; width: 36px; height: 36px; } <a id="DeviantArtIcon" href="http://monstermmorpg.deviantart.com" rel="nofollow" target="_blank" title="Monster MMORPG On Deviant Art - Please Watch Our Channel"></a> Now when this icon hovered i want to have transition effect. How can i do that ? I tried here but no luck CSS Fade Between Background Images on Hover

  Read the article

< Previous Page | 184 185 186 187 188 189 190 191 192 193 194 195  | Next Page >