Search Results

Search found 5287 results on 212 pages for 'physical computing'.

Page 191/212 | < Previous Page | 187 188 189 190 191 192 193 194 195 196 197 198  | Next Page >

  • SDL (And Others) Virtual Key Input

    - by David C
    Today I set up the input in my application for all the different keys. This works fine except for virtual keys, for example, caret or ampersand. Keys that normally need shift to be got at. Using SDL these virtual keys don't work. As in they do not register an event. if (event.type == SDL_KEYDOWN) { switch (event.key.keysym.sym) { case SDLK_CARET: Keys[KeyCodes::Caret] = KeyState::Down; break; case SDLK_UP: Keys[KeyCodes::Up] = KeyState::Down; break; default: break; } I am absolutely sure my system works with physical keys like Up. The program queries a keystate like so: if (Keys[KeyCode] == KeyState::Down) { lua_pushboolean(L, true); } else { lua_pushboolean(L, false); } KeyCode is passed in as an argument. So why are virtual keys, or keys that need shift to get at not working using SDL's KeyDown event type? Is more code needed to get to them? Or am I being stupid?

    Read the article

  • Computer science undergraduate project ideas

    - by Mehrdad Afshari
    Hopefully, I'm going to finish my undergraduate studies next semester and I'm thinking about the topic of my final project. And yes, I've read the questions with duplicate title. I'm asking this from a bit different viewpoint, so it's not an exact dupe. I've spent at least half of my life coding stuff in different languages and frameworks so I'm not looking at this project as a way to learn much about coding and preparing for real world apps or such. I've done lots of those already. But since I have to do it to complete my degree, I felt I should spend my time doing something useful instead of throwing the whole thing out. I'm planning to make it an open source project or a hosted Web app (depending on the type) if I can make a high quality thing out of it, so I decided to ask StackOverflow what could make a useful project. Situation I've plenty of freedom about the topic. They also require 30-40 pages of text describing the project. I have the following points in mind (the more satisfied, the better): Something useful for software development Something that benefits the community Having academic value is great Shouldn't take more than a month of development (I know I'm lazy). Shouldn't be related to advanced theoretical stuff (soft computing, fuzzy logic, neural networks, ...). I've been a business-oriented software developer. It should be software oriented. While I love hacking microcontrollers and other fun embedded electronic things, I'm not really good at soldering and things like that. I'm leaning toward a Web application (think StackOverflow, PasteBin, NerdDinner, things like those). Technology It's probably going to be done in .NET (C#, F#) and Windows platform. If I really like the project (cool low level hacking), I might actually slip to C/C++. But really, C# is what I'm efficient at. Ideas Programming language, parsing and compiler related stuff: Designing a domain specific programming language and compiler Templating language compiled to C# or IL Database tools and related code generation stuff Web related technologies: ASP.NET MVC View engine doing something cool (don't know what exactly...) Specific-purpose, small, fast ASP.NET-based Web framework Applications: Visual Studio plugin to integrate with Bazaar (it's too much work, I think). ASP.NET based, jQuery-powered issue tracker (and possibly, project lifecycle management as a whole - poor man's TFS) Others: Something related to GPGPU Looking forward for great ideas! Unfortunately, I can't help on a currently existing project. I need to start my own to prevent further problems (as it's an undergrad project, nevertheless).

    Read the article

  • Problem with AquaTerm on Snow Leopard

    - by cheetah
    When i try to install AquaTerm on Snow leopard from MacPorts i got this: ---> Computing dependencies for aquaterm ---> Building aquaterm Error: Target org.macports.build returned: shell command "cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm" && /usr/bin/xcodebuild -target "AquaTerm" -configuration Deployment build OBJROOT=build/ SYMROOT=build/ MACOSX_DEPLOYMENT_TARGET=10.6 ARCHS=x86_64 SDKROOT= USER_APPS_DIR=/Applications/MacPorts FRAMEWORKS_DIR=/opt/local/Library/Frameworks" returned error 1 Command output: [WARN]Warning: The Copy Bundle Resources build phase contains this target's Info.plist file 'AquaTerm.framework-Info.plist'. CopyPlistFile build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist AquaTerm.framework-Info.plist --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copyplist failed with exit code 71 === BUILD NATIVE TARGET AquaTerm OF PROJECT AquaTerm WITH CONFIGURATION Deployment === Check dependencies Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html [WARN]Warning: Multiple build commands for output file /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/help.html CopyTiffFile build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff cd /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff English.lproj/Cross.tiff --outdir /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources error: can't exec '/Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff' (No such file or directory) Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 Command /Developer/Library/Xcode/Plug-ins/CoreBuildTasks.xcplugin/Contents/Resources/copytiff failed with exit code 71 ** BUILD FAILED ** The following build commands failed: AQTFwk: CopyPlistFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.framework/Versions/A/Resources/AquaTerm.framework-Info.plist AquaTerm.framework-Info.plist AquaTerm: CopyTiffFile /opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_aqua_aquaterm/work/aquaterm/build/Deployment/AquaTerm.app/Contents/Resources/Cross.tiff English.lproj/Cross.tiff (2 failures) Error: Status 1 encountered during processing. Before reporting a bug, first run the command again with the -d flag to get complete output. How i can solve this problem?

    Read the article

  • Resizing QT's QTextEdit to Match Text Height: maximumViewportSize()

    - by Aaron
    I am trying to use a QTextEdit widget inside of a form containing several QT widgets. The form itself sits inside a QScrollArea that is the central widget for a window. My intent is that any necessary scrolling will take place in the main QScrollArea (rather than inside any widgets), and any widgets inside will automatically resize their height to hold their contents. I have tried to implement the automatic resizing of height with a QTextEdit, but have run into an odd issue. I created a sub-class of QTextEdit and reimplemented sizeHint() like this: QSize OperationEditor::sizeHint() const { QSize sizehint = QTextBrowser::sizeHint(); sizehint.setHeight(this->fitted_height); return sizehint; } this-fitted_height is kept up-to-date via this slot that is wired to the QTextEdit's "contentsChanged()" signal: void OperationEditor::fitHeightToDocument() { this->document()->setTextWidth(this->viewport()->width()); QSize document_size(this->document()->size().toSize()); this->fitted_height = document_size.height(); this->updateGeometry(); } The size policy of the QTextEdit sub-class is: this->setSizePolicy(QSizePolicy::MinimumExpanding, QSizePolicy::Preferred); I took this approach after reading this post. Here is my problem: As the QTextEdit gradually resizes to fill the window, it stops getting larger and starts scrolling within the QTextEdit, no matter what height is returned from sizeHint(). If I initially have sizeHint() return some large constant number, then the QTextEdit is very big and is contained nicely within the outer QScrollArea, as one would expect. However, if sizeHint gradually adjusts the size of the QTextEdit rather than just making it really big to start, then it tops out when it fills the current window and starts scrolling instead of growing. I have traced this problem to be that, no matter what my sizeHint() returns, it will never resize the QTextEdit larger than the value returned from maximumViewportSize(), which is inherited from QAbstractScrollArea. Note that this is not the same number as viewport()-maximumSize(). I am unable to figure out how to set that value. Looking at QT's source code, maximumViewportSize() is returning "the size of the viewport as if the scroll bars had no valid scrolling range." This value is basically computed as the current size of the widget minus (2 * frameWidth + margins) plus any scrollbar widths/heights. This does not make a lot of sense to me, and it's not clear to me why that number would be used anywhere in a way that supercede's the sub-class's sizeHint() implementation. Also, it does seem odd that the single "frameWidth" integer is used in computing both the width and the height. Can anyone please shed some light on this? I suspect that my poor understanding of QT's layout engine is to blame here.

    Read the article

  • How do I verify a DKIM signature in PHP?

    - by angrychimp
    I'll admit I'm not very adept at key verification. What I have is a script that downloads messages from a POP3 server, and I'm attempting to verify the DKIM signatures in PHP. I've already figured out the body hash (bh) validation check, but I can't figure out the header validation. http://www.dkim.org/specs/rfc4871-dkimbase.html#rfc.section.6.1.3 Below is an example of my message headers. I've been able to use the Mail::DKIM package to validate the signature in Perl, so I know it's good. I just can't seem to figure out the instructions in the RFC and translate them into PHP code. DomainKey-Signature: q=dns; a=rsa-sha1; c=nofws; s=angrychimp-1.bh; d=angrychimp.net; h=From:X-Outgoing; b=RVkenibHQ7GwO5Y3tun2CNn5wSnooBSXPHA1Kmxsw6miJDnVp4XKmA9cUELwftf9 nGiRCd3rLc6eswAcVyNhQ6mRSsF55OkGJgDNHiwte/pP5Z47Lo/fd6m7rfCnYxq3 DKIM-Signature: v=1; a=rsa-sha1; d=angrychimp.net; s=angrychimp-1.bh; c=relaxed/simple; q=dns/txt; [email protected]; t=1268436255; h=From:Subject:X-Outgoing:Date; bh=gqhC2GEWbg1t7T3IfGMUKzt1NCc=; b=ZmeavryIfp5jNDIwbpifsy1UcavMnMwRL6Fy6axocQFDOBd2KjnjXpCkHxs6yBZn Wu+UCFeAP+1xwN80JW+4yOdAiK5+6IS8fiVa7TxdkFDKa0AhmJ1DTHXIlPjGE4n5; To: [email protected] Message-ID: From: DKIM Tester Reply-To: [email protected] Subject: Automated DKIM Testing (angrychimp.net) X-Outgoing: dhaka Date: Fri, 12 Mar 2010 15:24:15 -0800 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: quoted-printable Content-Disposition: inline MIME-Version: 1.0 Return-Path: [email protected] X-OriginalArrivalTime: 12 Mar 2010 23:25:50.0326 (UTC) FILETIME=[5A0ED160:01CAC23B] I can extract the public key from my DNS just fine, and I believe I'm canonicalizing the headers correctly, but I just can't get the signature validated. I don't think I'm preparing my key or computing the signature validation correctly. Is this something that's possible (do I need pear extensions or something?) or is manually validating a DKIM signature in PHP just not feasible?

    Read the article

  • Resultant of a polynomial with x^n–1

    - by devin.omalley
    Resultant of a polynomial with x^n–1 (mod p) I am implementing the NTRUSign algorithm as described in http://grouper.ieee.org/groups/1363/lattPK/submissions/EESS1v2.pdf , section 2.2.7.1 which involves computing the resultant of a polynomial. I keep getting a zero vector for the resultant which is obviously incorrect. private static CompResResult compResMod(IntegerPolynomial f, int p) { int N = f.coeffs.length; IntegerPolynomial a = new IntegerPolynomial(N); a.coeffs[0] = -1; a.coeffs[N-1] = 1; IntegerPolynomial b = new IntegerPolynomial(f.coeffs); IntegerPolynomial v1 = new IntegerPolynomial(N); IntegerPolynomial v2 = new IntegerPolynomial(N); v2.coeffs[0] = 1; int da = a.degree(); int db = b.degree(); int ta = da; int c = 0; int r = 1; while (db > 0) { c = invert(b.coeffs[db], p); c = (c * a.coeffs[da]) % p; IntegerPolynomial cb = b.clone(); cb.mult(c); cb.shift(da - db); a.sub(cb, p); IntegerPolynomial v2c = v2.clone(); v2c.mult(c); v2c.shift(da - db); v1.sub(v2c, p); if (a.degree() < db) { r *= (int)Math.pow(b.coeffs[db], ta-a.degree()); r %= p; if (ta%2==1 && db%2==1) r = (-r) % p; IntegerPolynomial temp = a; a = b; b = temp; temp = v1; v1 = v2; v2 = temp; ta = db; } da = a.degree(); db = b.degree(); } r *= (int)Math.pow(b.coeffs[0], da); r %= p; c = invert(b.coeffs[0], p); v2.mult(c); v2.mult(r); v2.mod(p); return new CompResResult(v2, r); } There is pseudocode in http://www.crypto.rub.de/imperia/md/content/texte/theses/da_driessen.pdf which looks very similar. Why is my code not working? Are there any intermediate results I can check? I am not posting the IntegerPolynomial code because it isn't too interesting and I have unit tests for it that pass. CompResResult is just a simple "Java struct".

    Read the article

  • Unable to verify body hash for DKIM

    - by Joshua
    I'm writing a C# DKIM validator and have come across a problem that I cannot solve. Right now I am working on calculating the body hash, as described in Section 3.7 Computing the Message Hashes. I am working with emails that I have dumped using a modified version of EdgeTransportAsyncLogging sample in the Exchange 2010 Transport Agent SDK. Instead of converting the emails when saving, it just opens a file based on the MessageID and dumps the raw data to disk. I am able to successfully compute the body hash of the sample email provided in Section A.2 using the following code: SHA256Managed hasher = new SHA256Managed(); ASCIIEncoding asciiEncoding = new ASCIIEncoding(); string rawFullMessage = File.ReadAllText(@"C:\Repositories\Sample-A.2.txt"); string headerDelimiter = "\r\n\r\n"; int headerEnd = rawFullMessage.IndexOf(headerDelimiter); string header = rawFullMessage.Substring(0, headerEnd); string body = rawFullMessage.Substring(headerEnd + headerDelimiter.Length); byte[] bodyBytes = asciiEncoding.GetBytes(body); byte[] bodyHash = hasher.ComputeHash(bodyBytes); string bodyBase64 = Convert.ToBase64String(bodyHash); string expectedBase64 = "2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8="; Console.WriteLine("Expected hash: {1}{0}Computed hash: {2}{0}Are equal: {3}", Environment.NewLine, expectedBase64, bodyBase64, expectedBase64 == bodyBase64); The output from the above code is: Expected hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Computed hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Are equal: True Now, most emails come across with the c=relaxed/relaxed setting, which requires you to do some work on the body and header before hashing and verifying. And while I was working on it (failing to get it to work) I finally came across a message with c=simple/simple which means that you process the whole body as is minus any empty CRLF at the end of the body. (Really, the rules for Body Canonicalization are quite ... simple.) Here is the real DKIM email with a signature using the simple algorithm (with only unneeded headers cleaned up). Now, using the above code and updating the expectedBase64 hash I get the following results: Expected hash: VnGg12/s7xH3BraeN5LiiN+I2Ul/db5/jZYYgt4wEIw= Computed hash: ISNNtgnFZxmW6iuey/3Qql5u6nflKPTke4sMXWMxNUw= Are equal: False The expected hash is the value from the bh= field of the DKIM-Signature header. Now, the file used in the second test is a direct raw output from the Exchange 2010 Transport Agent. If so inclined, you can view the modified EdgeTransportLogging.txt. At this point, no matter how I modify the second email, changing the start position or number of CRLF at the end of the file I cannot get the files to match. What worries me is that I have been unable to validate any body hash so far (simple or relaxed) and that it may not be feasible to process DKIM through Exchange 2010.

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to work?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • Which mobile operating system should I code for?

    - by samgoody
    It seems as though mobile computing has fully arrived. I would like to rewrite two of our programs for mobile devices, but am a bit lost as to which platform to target. Complicating this decision: I would need to learn the relevant languages and IDEs - my coding to date has been almost all web based (PHP, JS, Actionscript, etc. Some ASPX). Most users seem to be religious about their mobile decision, so oral conversations leave me more confused then enlightened. I do not yet own a smartphone - will have to buy one once I know which platform to be aiming for. Both of my programs are more for business users, (one is only useful for C.P.A.s). I am a single developer, and cannot develop for more than one platform at a time. Getting it right is important. Based on what I've found on the web, I would've expected RIM to be a shoo-in, and the general order to be as follows: RIM Blackberry - More of them than any other brand. Despite naysayers, they've had double the sales (or perhaps 5X the sales) of any other smartphone, and have continued to grow. And, they have business users. Android - According to Schmidt, they have outsold everyone else except RIM (though I can't find where I read that now), and they are just getting started. According to Comscore, they are already at 8% of the market and expected to hit Shcmidt's claims within six months. Nokia - The largest worldwide. If they would just make up between Maemo or Symbian, I would be far less confused. iPhone - Much more competition by other apps, fewer sales to be had, and a overlord that can delay or cancel my app at any time. Is Cocoa hard to learn? Windows Mobile - Word is that version 7 will not be backwards compatible and losing market share. Palm WebOS - Perhaps this should go first, as it is the only one that offers tools to make my life easy as a web application developer. No competition in marketplace. But not very many users either. However, a search on StackOverflow shows a hugely disproportionate number of iPhone questions versus Blackberry. Likewise, there are clearly more apps on iPhone, so it must be getting developer love. What is the one platform I should develop for? Please back up your answer with the logic.

    Read the article

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • Advice for Architecture Design Logic for software application

    - by Prasad
    Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

    Read the article

  • How to split HTML code with javascript or JQuery

    - by Dean
    Hi I'm making a website using JSP and servlets and I have to now break up a list of radio buttons to insert a textarea and a button. I have got the button and textarea to hide and show when you click on the radio button it shows the text area and button. But this only appears at the top and when there are hundreds on the page this will become awkward so i need a way for it to appear underneath. Here is what my HTML looks like when complied: <form action="addSpotlight" method="POST"> <table> <tr><td><input type="radio" value="29" name="publicationIDs" ></td><td>A System For Dynamic Server Allocation in Application Server Clusters, IEEE International Symposium on Parallel and Distributed Processsing with Applications, 2008</td> </tr> <tr><td><input type="radio" value="30" name="publicationIDs" ></td><td>Analysing BitTorrent's Seeding Strategies, 7th IEEE/IFIP International Conference on Embedded and Ubiquitous Computing (EUC-09), 2009</td> </tr> <tr><td><input type="radio" value="31" name="publicationIDs" ></td><td>The Effect of Server Reallocation Time in Dynamic Resource Allocation, UK Performance Engineering Workshop 2009, 2009</td> </tr> <tr><td><input type="radio" value="32" name="publicationIDs" ></td><td>idk, hello, 1992</td> </tr> <tr><td><input type="radio" value="33" name="publicationIDs" ></td><td>sad, safg, 1992</td> </tr> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Now here is what my JSP looks like: <form action="addSpotlight" method="POST"> <table> <%int i = 0; while(i<ids.size()){%> <tr><td><input type="radio" value="<%=ids.get(i)%>" name="publicationIDs" ></td><td><%=info.get(i)%></td> </tr> <%i++; }%> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Thanks in Advance Dean

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • SMB2 traffic crashes network?

    - by Phil Cross
    We've been having significant network slowdown issues over the past few weeks, primarily on a Friday morning. We run Windows 7 client machines, with Windows Server 2008 R2 servers. What generally happens is the network starts to slow down massively at 08:55 and resumes normal speeds at around 09:20 This affects everything on the network from logging on, resetting passwords, opening programs and files etc. On my client machine, Physical Memory usage remains at around 40% (normal) and CPU usage hovers around 0-10% idle. The servers show memory usage spikes massively and remains quite intense during the times mentioned above. I have taken several wireshark captures, both during the slowdown and when the network operates fine. One of the main things I noticed is the increase in SMB2 entries in the wireshark log during the slowdown. Record Time Source Destination Protocol Length Info 382 3.976460000 10.47.35.11 10.47.32.3 SMB2 362 Create Request File: pcross\My Documents 413 4.525047000 10.47.35.11 10.47.32.3 SMB2 146 Close Request File: pcross\My Documents 441 5.235927000 10.47.32.3 10.47.35.11 SMB2 298 Create Response File: pcross\My Documents\Downloads 442 5.236199000 10.47.35.11 10.47.32.3 SMB2 260 Find Request File: pcross\My Documents\Downloads SMB2_FIND_ID_BOTH_DIRECTORY_INFO Pattern: *;Find Request File: pcross\My Documents\Downloads SMB2_FIND_ID_BOTH_DIRECTORY_INFO Pattern: * 573 6.327634000 10.47.35.11 10.47.32.3 SMB2 146 Close Request File: pcross\My Documents\Downloads 703 7.664186000 10.47.35.11 10.47.32.3 SMB2 394 Create Request File: pcross\My Documents\Downloads\WestlandsProspectus\P24 __ P21.pdf These are some of the SMB2 records from a list of a couple of hundred which original from my computer with a destination of the fileserver. One of the interesting things to note is the last entry in the examples above is for a PDF file. That file was not open anywhere on my computer, or on anyone elses. No folders with the files in were open either. When I took another capture when the network was running fine, there were hardly any SMB2 entries, and the ones that were displayed were mainly from Wireshark. We currently have around 800 computers, 90 Macs and 200 Laptops and Netbooks. Our concern is if this traffic is happening on my computer, is it happening on other computers, and if so, would those computers be adding to the slow network issues? Again, this only happens during certain times. We're pretty sure its not the our antivirus. Is there anything to narrow down whats initializing this SMB traffic during the particular times? Or if anyone has any extra advice, or links to resources it would be appreciate.

    Read the article

  • Hyper-V + RRAS NAT + Port Forwarding + RDP, can I get it all working together?

    - by Tom Bull
    I am running a Windows 2008 R2 server with various services running natively and two virtualised servers running on Hyper-V. The hardware server, I'm going to call it REAL1, has one external NIC, to which I can assign any of the following IP addresses: 1.2.3.4, 1.2.3.5, 1.2.3.6, etc... I need to achieve the following: I would like to be able to connect to REAL1 via remote desktop (RDP / port 3389) on one IP address (say 1.2.3.4), but also to the virtualised servers (I'm going to call them VIRTUAL1 and VIRTUAL2) on the other available IP addresses (say 1.2.3.5 and 1.2.3.6). The easiest way of doing this is to connect the virtual servers directly to the external interface and assign them each their own IP address. REAL1 will have 1.2.3.4, VIRTUAL1 will have 1.2.3.5 and VIRTUAL2 will have 1.2.3.6. Unfortunately, although I don't directly manage the two virtual servers, I have responsibility for their security. I would like to have some kind of firewall between the virtual servers an the internet. I have tried running a virtual machine firewall, but have found the performance on Hyper-V pretty terrible. The alternative I am now trying is Routing and Remote Access (RRAS): I have set up a virtual network called 'Internal' and REAL1 has a virtual network adapter connected to this virtual network I have connected each of the virtual servers to this network too I have assigned each server static IP addresses on this virtual network (REAL1 has 10.1.1.1, VIRTUAL1 has 10.1.1.2 and VIRTUAL2 has 10.1.1.3) I have installed RRAS and set up a NAT. The external interface is the external NIC, the internal interface is the virtual NIC connected to the internal network I have assigned all the available external IP addresses to the external NIC on REAL1. The virtual servers have been set up appropriately such that their default gateway is pointing to 10.1.1.1 and they can both access externally. Success! The RRAS is routing packets. The problem I have is that when I try to port forward services from the external IP address on REAL1, it only works if there is not already a service bound to the port. Remote desktop 'greedily' binds to every available IP address on port 3389 on REAL1 so I can't selectively forward incoming traffic for 1.2.3.5:3389 to 10.1.1.2:3389. RRAS will allow me to set up this port forwarding, and no errors come up. It just doesn't work. So the question I have is: Is there a better way of doing this? Or at least is there a way of resolving the apparant conflict between RRAS and everything else on the physical server?

    Read the article

  • How to read MAC address with sed vs python

    - by getjoefree
    Earlier, I could read MAC address with awk tools in Windows or Windows PE 4.0, but now it don't support Windows PE 4.0 64-bit. I want to get this result "set mac=A4BADB9D1E8E" with python 2.6, who could help to me. As follows: ipconfig -all|sed -nrf getmac.sed | sed -e "s/-//g" > D:\LOG\WINMAC.BAT ----------------------------------------------------------------------- getmac.sed: /Realtek/ { n; s/.*: ([-0-9A-F]+)/set winmac=\1/p; } and "ipconfig -all" command log as bellows: ipconfig -all >mac.log ---------------------- Ethernet adapter Ethernet: -------------------------- Media State . . . . . . . . . . . : Media disconnected ------------------------------------------------------ Connection-specific DNS Suffix . : WKSCN.WISTRON ------------------------------------------------ Description . . . . . . . . . . . : Realtek PCIe FE Family Controller --------------------------------------------------------------------- Physical Address. . . . . . . . . : 24-B6-FD-1F-41-E7 ----------------------------------------------------- DHCP Enabled. . . . . . . . . . . : Yes --------------------------------------- Autoconfiguration Enabled . . . . : Yes ---------------------------------------

    Read the article

  • Too many Tunnel Adapter Interfaces

    - by Tomas Lycken
    If I open a command prompt on my machine and type ipconfig /all, I see lots of Tunnel adapter Local Area Connection* 9: Media state . . . . . . . . . . . . . : Media disconnected Connection-specific DNS Sufficx . . . : Description . . . . . . . . . . . . . : Microsoft 6to4 Adapter #5 Physical address. . . . . . . . . . . : 00-00-00-00-00-00-00-E0 DHCP Enabled. . . . . . . . . . . . . : No Autoconfiguration Enabled . . . . . . : Yes In fact, they're so many that my "real" adapters are pushed out of the stack, and can't be seen anymore. Is there any flag I can use on ipconfig to hide all virtual interfaces? Or is there some other way around this problem? Since they always say "Media disconnected" I suppose disabling could be an option, but if possible I'd rather not turn any functionality off. I just want to control what output I get from ipconfig. Also, I know these are related to IPv6 stuff. However, most of what I find on google merely states what these are, and that they're harmless - nothing about hiding/removing them.

    Read the article

  • Disk is spinning down each minute, unable to disable it

    - by lzap
    I played with spindown and APM settings of my Samsung discs and now they spin down every minute. I want to disable it, but it seems it does not accept any of the spindown time or APM values. Nothing works, it's all the same. Please help what values should be proper for it. I do not want it to spin down at all. /dev/sda: ATA device, with non-removable media Model Number: SAMSUNG HD154UI Serial Number: S1Y6J1KZ206527 Firmware Revision: 1AG01118 Standards: Used: ATA-8-ACS revision 3b Supported: 7 6 5 4 Configuration: Logical max current cylinders 16383 16383 heads 16 16 sectors/track 63 63 -- CHS current addressable sectors: 16514064 LBA user addressable sectors: 268435455 LBA48 user addressable sectors: 2930277168 Logical/Physical Sector size: 512 bytes device size with M = 1024*1024: 1430799 MBytes device size with M = 1000*1000: 1500301 MBytes (1500 GB) cache/buffer size = unknown Capabilities: LBA, IORDY(can be disabled) Queue depth: 32 Standby timer values: spec'd by Standard, no device specific minimum R/W multiple sector transfer: Max = 16 Current = 16 Advanced power management level: 60 Recommended acoustic management value: 254, current value: 0 DMA: mdma0 mdma1 mdma2 udma0 udma1 udma2 udma3 udma4 udma5 *udma6 udma7 Cycle time: min=120ns recommended=120ns PIO: pio0 pio1 pio2 pio3 pio4 Cycle time: no flow control=120ns IORDY flow control=120ns Commands/features: Enabled Supported: * SMART feature set Security Mode feature set * Power Management feature set * Write cache * Look-ahead * Host Protected Area feature set * WRITE_BUFFER command * READ_BUFFER command * NOP cmd * DOWNLOAD_MICROCODE * Advanced Power Management feature set Power-Up In Standby feature set * SET_FEATURES required to spinup after power up SET_MAX security extension Automatic Acoustic Management feature set * 48-bit Address feature set * Device Configuration Overlay feature set * Mandatory FLUSH_CACHE * FLUSH_CACHE_EXT * SMART error logging * SMART self-test Media Card Pass-Through * General Purpose Logging feature set * 64-bit World wide name * WRITE_UNCORRECTABLE_EXT command * {READ,WRITE}_DMA_EXT_GPL commands * Segmented DOWNLOAD_MICROCODE * Gen1 signaling speed (1.5Gb/s) * Gen2 signaling speed (3.0Gb/s) * Native Command Queueing (NCQ) * Host-initiated interface power management * Phy event counters * NCQ priority information DMA Setup Auto-Activate optimization Device-initiated interface power management * Software settings preservation * SMART Command Transport (SCT) feature set * SCT Long Sector Access (AC1) * SCT LBA Segment Access (AC2) * SCT Error Recovery Control (AC3) * SCT Features Control (AC4) * SCT Data Tables (AC5) Security: Master password revision code = 65534 supported not enabled not locked frozen not expired: security count supported: enhanced erase 326min for SECURITY ERASE UNIT. 326min for ENHANCED SECURITY ERASE UNIT. Logical Unit WWN Device Identifier: 50024e900300cca3 NAA : 5 IEEE OUI : 0024e9 Unique ID : 00300cca3 Checksum: correct I have the very same disc which I did not "tuned" and it does not spin. But I do not know where to read the settings from. The hdparm only shows this: Advanced power management level: 60 Recommended acoustic management value: 254, current value: 0 Edit: It seems the issue was tuned daemon in RHEL6. It was too aggressive, I turned off disc tuning and it seems they are no longer spinning down.

    Read the article

  • Firefox 3.5.6 causes entire computer to freeze

    - by Anthony Aziz
    Here's the situation: Environment: Just installed a fresh copy of Win7 Pro 32-bit to NTFS partition on 750GB SATA drive Hardware: E8400 3GHz ASUS P5QL Pro 4GB DDR2 1066 RAM EVGA 9800 GTX+ Plenty of cooling, no problems with hardware before Data is stored on a separate partition, including My Documents No security software is yet installed No extensions installed yet Problem: While using Firefox, sometimes the entire computer will freeze/hang. I get no mouse or keyboard input, can't CTRL+ALT+DEL, no "not responding" indication, just a static image on my display. My drivers are all up to date as far as I'm aware (I just installed this copy of Windows last week). I first noticed this when trying to install Xmarks. I went to the Xmarks site and tried to install and it would freeze. I managed to get it installed (Safe mode and the Mozilla addon site worked), but when I go to configure it (log in, etc), the computer freezes. I don't think it's a matter of usage time or memory issues, because while testing, I browsed wallpaper galleries for about 30 minutes, sometimes as many as 12-15 tabs open at a time, without issue. Sometimes I won't even try to install Xmarks at it will hang. I can install (some) other extensions, the only one I've tried is download status bar (which works). What I've done to try to fix: Restarted (duh) Windows safe mode Completely remove Firefox and install it to a new directory, according to Mozilla's KB (I haven't tried the profile manager, though I assume this does the same thing, except perhaps more thoroughly) Some BIOS changes, including Power options, disabling oveclocking (it was a modest overclock on the CPU, which has run Win7 beta and RC for almost a year now) Memtest Used another Windows user profile, same tragic results I'm STUCK now, with no idea what to do. I'm using Chrome as my main browser at the moment, but that's not something I want to be stuck with. I like Firefox and want to use it. I'm going to try creating a new profile first. One thing I did notice: I started leaving task manager and performance monitor open when anticipating (but dreading) a freeze. firefox.exe had low CPU and low memory, but it looked like overall disk usage was seeing some spikes on the small graph Performance Monitor gives you. I saw on one blog post a fellow using XP moved his Local Settings directory from a separate drive to his main drive, and that solved it, but I don't think my AppData directory is on my D: drive, and that's on the same physical device anyways. Still, something that might be worth trying. I'd extremely appreciate any help. Thanks very much. I really don't want to reinstall Windows from scratch again :( Anthony Aziz

    Read the article

< Previous Page | 187 188 189 190 191 192 193 194 195 196 197 198  | Next Page >