Search Results

Search found 28760 results on 1151 pages for 'search folder'.

Page 195/1151 | < Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Copied App.config to (Assembly).exe.config but from folder debug application doesn't run

    - by uugan
    Gives error: "The specified named connection is either not found in the configuration, not intended to be used with the EntityClient provider, or not valid" App.config looks like and it's same as (Assembly.exe.config) config file for output: <?xml version="1.0" encoding="utf-8"?> <configuration> <connectionStrings> <add name="Entities1" connectionString="metadata=res://*/;provider=System.Data.SqlClient;provider connection string='data source=localhost;initial catalog=DatabaseName;integrated security=True;multipleactiveresultsets=True;App=EntityFramework'" providerName="System.Data.EntityClient" /> </connectionStrings> </configuration> How to run exe with it's configuration file? I tried to change '' to quot but nothing has changed.

    Read the article

  • bypass IIS xml file settings at file/folder level

    - by Matt Thrower
    Hi, Our site is currently set to pass all files with the xml file extension through the asp.net worker process because all the xml files on the site at the moment are generated dynamically on being hit, by writing the output directly into the response stream. However we now have a requirement to add a file which is much larger and takes several minutes to generate in this way. I wrote a console app to generate the file and set it to run nightly, but because of the global IIS setting directing xml files to run through asp_wp, it's not being served properly. I can't seem to find a way to make an exemption for the treatment of a single file in the IIS settings. Is there any other way we can do it? Cheers, Matt

    Read the article

  • Explaining verity index and document search limits

    - by Ahmad
    As present, we currently have a CF8 standard edition server which have some limitations around verity indexing. According to Adobe Verity Server has the following document search limits (limits are for all collections registered to Verity Server): - 10,000 documents for ColdFusion Developer Edition - 125,000 documents for ColdFusion Standard Edition - 250,000 documents for ColdFusion Enterprise Edition We have now reached a stage where the server wide number of documents indexed exceed 125k. However, the largest verity collection consists of about 25k documents(and this is expected to grow). Only one collection is ever searched at a time. In my understanding, this means that I can still search an entire collection with no restrictions. Is this correct? Or does it mean that only documents that were indexed across all collection prior to reaching the limit are actually searchable? We are considering moving to CF9 standard as a solution to this and to use the Solr solution which has no restrictions. The coldfusionjedi highlights some differences between Verity and Solr. However, before we upgrade I am trying to gain a clearer understanding of this before we commit to an upgrade. Can someone provide me a clear explanation as to what this means and how it actually affects verity searching and indexing?

    Read the article

  • Scribe-LinkedIn Search API

    - by Rupeshit
    Hi folks, I want to fetch data from the LinkedIn API for that I am using the Scribe library.All requests are giving me data as expected but when I tried two facet in the url then scribe is not able to get data from LinkedIn API. If I gave this URL : http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0 then it gives me proper result but if I entered this URL: http://api.linkedin.com/v1/people-search?facets=location,network&facet=location,in:0&facet=network,F i.e. URL containing multiple facets then it gives me this output: <?xml version="1.0" encoding="UTF-8" standalone="yes"?> <error> <status>401</status> <timestamp>1292487039516</timestamp> <error-code>0</error-code> <message> [unauthorized].OAU:CiEgwWDkA5BFpNrc0RfGyVuSlOh4tig5kOTZ9q97qcXNrFl7zqk- Ts7DqRGaKDCV|94f13544-9844-41eb-9d53-8fe36535bbc3|*01|*01:1292487039:VseHXaJXM2gerxJyn6kHhIka7zw=</message> </error> Any kind of help to solve this will be appreciated.Thanks.

    Read the article

  • Creating stored procedure having different WHERE clause on different search criteria without putting

    - by Muhammad Kashif Nadeem
    Is there any alternate way to create stored procedure without putting all query in one long string if criteria of WWHERE clause can be different. Suppose I have Orders table I want to create stored procedure on this table and there are three column on which I wnat to filter records. 1- CustomerId, 2- SupplierId, 3- ProductId. If user only give CustomerId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.CustomerId = @customerId And if user only give ProductId in search criteria then query should be like following SELECT * FROM Orders WHERE Orders.ProductId = @productId And if user only all three CustomerId, ProductId, and SupplierId is given then all three Ids will be used in WHERE to filter. There is also chance that user don't want to filter record then query should be like following SELCT * FROM Orders Whenever I have to create this kind of procedure I put all this in string and use IF conditions to check if arguments (@customeId or @supplierId etc) has values. I use following method to create procedure DECLARE @query VARCHAR(MAX) DECLARE @queryWhere VARCHAR(MAX) SET @query = @query + 'SELECT * FROM Orders ' IF (@originationNumber IS NOT NULL) BEGIN BEGIN SET @queryWhere =@queryWhere + ' Orders.CustomerId = ' + CONVERT(VARCHAR(100),@customerId) END END IF(@queryWhere <> '') BEGIN SET @query = @query+' WHERE ' + @queryWhere END EXEC (@query) Thanks.

    Read the article

  • Java - copy Jar Folder

    - by Ripei
    Hey Java - Developers Actually I am confronted with a Problem. I've got a ".apk-File" in one Package of my Application. apk is a kind of a jar File (apk = Android Package). I now want to copy this jar-file out of my Programm onto any other Location at the PC. Normally I would do this by using: FileInputStream is = new FileInputStream(this.getClass().getResource("/resources/myApp.apk").getFile()); And then write it on the disk with using a FileOutputStream. ... but since an .apk is a kind of a .jar it doesn't work. It just copies the .apk file. but without the containing other files. any help would be appreciated

    Read the article

  • Search for index.php and index.html and replace string

    - by Jonas
    Hello. I recently had some sort of Malware on my computer that added to all index.php and index.html ON THE WEBSERVER! the following string(s): echo "<iframe src=\"http://fabujob.com/?click=AD4A4\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; echo "<iframe src=\"http://fabujob.com/?click=AC785\" width=1 height=1 style=\"visibility:hidden;position:absolute\"></iframe>"; So the parameter after "click=" always changes. These two were only examples. Is there a way to do that quick and fast? . . EDIT: It is on my webserver, so no use of find...

    Read the article

  • Content search through source code in finder

    - by gf
    I am using OSX 10.6 and want to have content searches in finder for the source code types i use. This suggests a (10.4 only?) solution, but although i have the developer tools installed i don't have /Library/Spotlight/SourceCode.mdimporter. Is there a different procedure for Snow Leopard or did i miss something?

    Read the article

  • Cleaning up temp folder after long-running subprocess exits

    - by dbr
    I have a Python script (running inside another application) which generates a bunch of temporary images. I then use subprocess to launch an application to view these. When the image-viewing process exists, I want to remove the temporary images. I can't do this from Python, as the Python process may have exited before the subprocess completes. I.e I cannot do the following: p = subprocess.Popen(["imgviewer", "/example/image1.jpg", "/example/image1.jpg"]) p.communicate() os.unlink("/example/image1.jpg") os.unlink("/example/image2.jpg") ..as this blocks the main thread, nor could I check for the pid exiting in a thread etc The only solution I can think of means I have to use shell=True, which I would rather avoid: cmd = ['imgviewer'] cmd.append("/example/image2.jpg") for x in cleanup: cmd.extend(["&&", "rm", x]) cmdstr = " ".join(cmd) subprocess.Popen(cmdstr, shell = True) This works, but is hardly elegant, and will fail with filenames containing spaces etc.. Basically, I have a background subprocess, and want to remove the temp files when it exits, even if the Python process no longer exists.

    Read the article

  • eclipse adt 17 and the libs folder

    - by max4ever
    Ok so i update to eclipse adt to version 17 and I get this error 04-05 12:28:55.810: E/AndroidRuntime(5470): FATAL EXCEPTION: main 04-05 12:28:55.810: E/AndroidRuntime(5470): java.lang.RuntimeException: Unable to instantiate activity ComponentInfo{com.galeola.agentis/com.galeola.agentis.activity.GestionaleActivity}: java.lang.ClassNotFoundException: com.galeola.agentis.activity.GestionaleActivity in loader dalvik.system.PathClassLoader[/system/framework/com.google.android.maps.jar:/data/app/com.galeola.agentis-1.apk] 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1742) 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1834) 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.app.ActivityThread.access$500(ActivityThread.java:122) 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1027) 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.os.Handler.dispatchMessage(Handler.java:99) 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.os.Looper.loop(Looper.java:132) 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.app.ActivityThread.main(ActivityThread.java:4126) 04-05 12:28:55.810: E/AndroidRuntime(5470): at java.lang.reflect.Method.invokeNative(Native Method) 04-05 12:28:55.810: E/AndroidRuntime(5470): at java.lang.reflect.Method.invoke(Method.java:491) 04-05 12:28:55.810: E/AndroidRuntime(5470): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:844) 04-05 12:28:55.810: E/AndroidRuntime(5470): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:602) 04-05 12:28:55.810: E/AndroidRuntime(5470): at dalvik.system.NativeStart.main(Native Method) 04-05 12:28:55.810: E/AndroidRuntime(5470): Caused by: java.lang.ClassNotFoundException: com.galeola.agentis.activity.GestionaleActivity in loader dalvik.system.PathClassLoader[/system/framework/com.google.android.maps.jar:/data/app/com.galeola.agentis-1.apk] 04-05 12:28:55.810: E/AndroidRuntime(5470): at dalvik.system.PathClassLoader.findClass(PathClassLoader.java:251) 04-05 12:28:55.810: E/AndroidRuntime(5470): at java.lang.ClassLoader.loadClass(ClassLoader.java:540) 04-05 12:28:55.810: E/AndroidRuntime(5470): at java.lang.ClassLoader.loadClass(ClassLoader.java:500) 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.app.Instrumentation.newActivity(Instrumentation.java:1022) 04-05 12:28:55.810: E/AndroidRuntime(5470): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1733) 04-05 12:28:55.810: E/AndroidRuntime(5470): ... 11 more however if i move my libraries to /libs i can start the applications, but with the libraries in /libs javadoc and javasources stops working, while if they are not in /libs javadoc and javasource works, so I don't understand why.

    Read the article

  • SVN best practice - checking out root folder

    - by Stephen Dolier
    Hi all, quick question about svn checkout best practice. Once the structure of a repository is set up, ie trunk, branches, tags, is it normal to have the root checked out to our local machines. Or should you only check out the trunk if that's what you are working on or a branch if we so choose to create one. The reason i ask is that every time someone creates a branch or tag we all get a copy when we do an update. btw, we're recently migrated from vss.

    Read the article

  • php scandir --> search for files/directories

    - by Peter
    Hi! I searched before I ask, without lucky.. I looking for a simple script for myself, which I can search for files/folders. Found this code snippet in the php manual (I think I need this), but it is not work for me. "Was looking for a simple way to search for a file/directory using a mask. Here is such a function. By default, this function will keep in memory the scandir() result, to avoid scaning multiple time for the same directory." <?php function sdir( $path='.', $mask='*', $nocache=0 ){ static $dir = array(); // cache result in memory if ( !isset($dir[$path]) || $nocache) { $dir[$path] = scandir($path); } foreach ($dir[$path] as $i=>$entry) { if ($entry!='.' && $entry!='..' && fnmatch($mask, $entry) ) { $sdir[] = $entry; } } return ($sdir); } ?> Thank you for any help, Peter

    Read the article

  • Ubuntu One Folder Sync Filter

    - by Andy Barlow
    Hi, I am trying to modify the Ubuntu One File syncing python scripts to not including things like .iso's. I have got as far as finding this file: /usr/share/pyshared/ubuntuone/u1sync/constants.py Inside is this piece of code: import re # the name of the directory u1sync uses to keep metadata about a mirror METADATA_DIR_NAME = u".ubuntuone-sync" # filenames to ignore SPECIAL_FILE_RE = re.compile(".*\\.(" "(u1)?partial|part|" "(u1)?conflict(\\.[0-9]+)?)$") How can I edit this last section (regex?) and make it ignore .iso files??? I'm fairly sure this is the place to put it! Pretty sure this is standard python action :) Any help would be appreciated. Thanks kindly. Andy

    Read the article

  • Open Folder and Select multiple files

    - by Vytas999
    In C# I want to open explorer and in this explorer window must be selected some files. I do this like that: string fPath = newShabonFilePath; string arg = @"/select, "; int cnt = filePathes.Count; foreach (string s in filePathes) { if(cnt == 1) arg = arg + s; else { arg = arg + s + ","; } cnt--; } System.Diagnostics.Process.Start("explorer.exe", arg); But only the last file of "arg" is selected. How to make that all files of arg would be selected, when explorer window is opened..?

    Read the article

  • Remove undesired indexed keywords from Sql Server FTS Index

    - by Scott
    Could anyone tell me if SQL Server 2008 has a way to prevent keywords from being indexed that aren't really relevant to the types of searches that will be performed? For example, we have the IFilters for PDF and Word hooked in and our documents are being indexed properly as far as I can tell. These documents, however, have lots of numeric values in them that people won't really be searching for or bring back meaningful results. These are still being indexed and creating lots of entries in the full text catalog. Basically we are trying to optimize our search engine in any way we can and assumed all these unnecessary entries couldn't be helping performance. I want my catalog to consist of alphabetic keywords only. The current iFilters work better than I would be able to write in the time I have but it just has more than I need. This is an example of some of the terms from sys.dm_fts_index_keywords_by_document that I want out: $1,000, $100, $250, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 129, 13.1, 14, 14.12, 145, 15, 16.2, 16.4, 18, 18.1, 18.2, 18.3, 18.4, 18.5 These are some examples from the same management view that I think are desirable for keeping and searching on: above, accordingly, accounts, add, addition, additional, additive Any help would be greatly appreciated!

    Read the article

  • Match entities fulfilling filter (strict superset of search)

    - by Jon
    I have an entity (let's say Person) with a set of arbitrary attributes with a known subset of values. I need to search for all of these entities that match all my filter conditions. That is, given a set of Attributes A, I need to find all people that have a set of Attributes that are a superset of A. For example, my table structures look like this: Person: id | name 1 | John Doe 2 | Jane Roe 3 | John Smith Attribute: id | attr_name 1 | Sex 2 | Eye Color ValidValue: id | attr_id | value_name 1 | 1 | Male 2 | 1 | Female 3 | 2 | Blue 4 | 2 | Green 5 | 2 | Brown PersonAttributes id | person_id | attr_id | value_id 1 | 1 | 1 | 1 2 | 1 | 2 | 3 3 | 2 | 1 | 2 4 | 2 | 2 | 4 5 | 3 | 1 | 1 6 | 3 | 2 | 4 In JPA, I have entities built for all of these tables. What I'd like to do is perform a search for all entities matching a given set of attribute-value pairs. For instance, I'd like to be able to find all males (John Doe and John Smith), all people with green eyes (Jane Roe or John Smith), or all females with green eyes (Jane Roe). I see that I can already take advantage of the fact that I only really need to match on value_id, since that's already unique and tied to the attr_id. But where can I go from there? I've been trying to do something like the following, given that the ValidValue is unique in all cases: select distinct p from Person p join p.personAttributes a where a.value IN (:values) Then I've tried putting my set of required values in as "values", but that gives me errors no matter how I try to structure that. I also have to get a little more complicated, as follows, but at this point I'd be happy with solving the first problem cleanly. However, if it's possible, the Attribute table actually has a field for default value: id | attr_name | default_value 1 | Sex | 1 2 | Eye Color | 5 If the value you're searching on happens to be the default value, I want it to return any people that have no explicit value set for that attribute, because in the application logic, that means they inherit the default value. Again, I'm more concerned about the primary question, but if someone who can help with that also has some idea of how to do this one, I'd be extremely grateful.

    Read the article

  • Prevent command "del /s" from entering a folder

    - by jzuniga
    I need to recursively remove unnecessary files from a svn repository and i have the following batch file to do this: @echo on del /s ~*.* del /s *.~* del /s Thumbs.db However, this is also deleting the entries under the .svn/ subfolders. Is there any way to prevent this commands from being executed under the .svn/ folders so that it doesn't mess things up? Thanks in advance! EDIT: A solution using Bash (cygwin) would also work for me since i just need to do this once.

    Read the article

  • Linux - Create ftp account with read/write access to only 1 folder

    - by Gublooo
    Hey guys.... I have never worked on linux and dont plan on working on it either - The only command I probably know is "ls" :) I am hosting my website on Eapps and use their cpanel to setup everything so never worked with linux. Now I have this one time case - where I need to provide access to a contractor to fix the CSS issues on my website. He basically needs FTP (read/write) access to certain folders. At a high level - this is my code structure /home/webadmin/example.com/html/images /css /js /login.php /facebook.php /home/webadmin/example.com/application/library /views /models /controllers /config /bootstrap.php /home/webadmin/example.com/cgi-bin I want the new user to be able to have access to only these folders /home/webadmin/example.com/html/js /home/webadmin/example.com/html/css /home/webadmin/example.com/application/views He should not be able to view even the content of other folders including files like bootstrap.php or login.php etc If any sys admins can help me set this account up - will really appreciate it. Thanks

    Read the article

  • Program for remove exact duplicate files while caching search results

    - by John Thomas
    We need a Windows 7 program to remove/check the duplicates but our situation is somewhat different than the standard one for which there are enough programs. We have a fairly large static archive (collection) of photos spread on several disks. Let's call them Disk A..M. We have also some disks (let's call them Disk 1..9) which contain some duplicates which are to be found on disks A..M. We want to add to our collection new disks (N, O, P... aso.) which will contain the photos from disks 1..9 but, of course, we don't want to have any photos two (or more) times. Of course, theoretically, the task can be solved with a regular file duplicate remover but the time needed will be very big. Ideally, AFAIS now, the real solution would be a program which will scan the disks A..M, store the file sizes/hashes of the photos in an indexed database/file(s) and will check the new disks (1..9) against this database. However I have hard time to find such a program (if exists). Other things to note: we consider that the Disks A..M (the collection) doesn't have any duplicates on them the file names might be changed we aren't interested in approximated (fuzzy) comparison which can be found in some photo comparing programs. We hunt for exact duplicate files. we aren't afraid of command line. :-) we need to work on Win7/XP we prefer (of course) to be freeware TIA for any suggestions, John Th.

    Read the article

< Previous Page | 191 192 193 194 195 196 197 198 199 200 201 202  | Next Page >