Search Results

Search found 8258 results on 331 pages for 'sequence points'.

Page 198/331 | < Previous Page | 194 195 196 197 198 199 200 201 202 203 204 205  | Next Page >

  • fsck on LVM snapshots

    - by Alpha01
    I'm trying to do some file system checks using LVM snapshots of our Logical Volumes to see if any of them have dirty file systems. The problem that I have is that our LVM only has one Volume Group with no available space. I was able to do fsck's on some of the logical volumes using a loopback file system. However my question is, is it possible to create a 200GB loopback file system, and saved it on the same partition/logical volume that I'll be taking a snapshot of? Is LVM smart enough to not take a snapshot copy of the actual snapshot? [root@server z]# vgdisplay --- Volume group --- VG Name Web2-Vol System ID Format lvm2 Metadata Areas 1 Metadata Sequence No 29 VG Access read/write VG Status resizable MAX LV 0 Cur LV 6 Open LV 6 Max PV 0 Cur PV 1 Act PV 1 VG Size 544.73 GB PE Size 4.00 MB Total PE 139450 Alloc PE / Size 139450 / 544.73 GB Free PE / Size 0 / 0 VG UUID BrVwNz-h1IO-ZETA-MeIf-1yq7-fHpn-fwMTcV [root@server z]# df -h Filesystem Size Used Avail Use% Mounted on /dev/sda2 9.7G 3.6G 5.6G 40% / /dev/sda1 251M 29M 210M 12% /boot /dev/mapper/Web2--Vol-var 12G 1.1G 11G 10% /var /dev/mapper/Web2--Vol-var--spool 12G 184M 12G 2% /var/spool /dev/mapper/Web2--Vol-var--lib--mysql 30G 15G 14G 52% /var/lib/mysql /dev/mapper/Web2--Vol-usr 13G 3.3G 8.9G 27% /usr /dev/mapper/Web2--Vol-z 468G 197G 267G 43% /z /dev/mapper/Web2--Vol-tmp 3.0G 76M 2.8G 3% /tmp tmpfs 7.9G 92K 7.9G 1% /dev/shm The logical volume in question is /dev/mapper/Web2--Vol-z. I'm afraid if I created the loopback file system in /dev/mapper/Web2--Vol-z and take a snapshot of it, the disk size will be trippled in size, thus running out of disk space available.

    Read the article

  • Error when trying to deploy Windows XP SP3 with WDS

    - by Nic Young
    I have created a WDS server running Windows Server 2008 R2. I have built my custom images of Windows 7 using WAIK and MDT 2010 that are installed on the server. I used this guide to help me through the process. The Windows 7 images that I have created capture and deploy properly. I am attempting to follow the same steps from the guide I linked to capture and deploy a Windows XP SP3 image. I am able to sysprep and capture the reference machine with no errors. I am then able to import the custom .wim that I just captured in to MDT 2010 with no issues either. However when I try to deploy this image to a test virtual machine I get the following error: Deployment Error: I have made sure that the .iso that I am importing the source files from originally to create the sysprep and capture sequence is indeed a Windows XP SP3 iso. When I first select a PE boot environment before I deploy I select the x86 PE boot image that I created originally when making this for my Windows 7 deployments. Could this be the issue? If so how do I make a boot image specific for Windows XP SP3 deployments? I have Googled around for this error and some places point to the deployment image not being able to find setup.exe and other important system files for installing the operating system. If so, how do I add these to the image? Any ideas?

    Read the article

  • Open Office crashes, recovers, crashes again

    - by Daniel R Hicks
    After completely reinstalling my laptop due to apparent registry corruption, I've encountered a problem with Open Office: I open a simple Calc spreadsheet, it comes up normally, but then after anywhere from 5 seconds to several minutes (without even touching the Calc window) OO crashes, then comes up through recovery. If I let it "recover" it will do so and bring the spreadsheet up again, only to repeat the crash scenario again. If I kept clicking "OK" it would apparently do this all day. I reinstalled OO once and the problem went away for awhile, but it came back. I then attempted to "reset" my profile (ie, rename the OO user directory in App Data), but OO crashed during the first startup after that, then resumed the original behavior. If I open the same file using Excel it complains of errors in the file, and "recovers" them, but the "error report" it generates contains no details. If I save the "recovered" file then OO Calc will open it, but the problem returns after saving again. Any ideas? (The system is Vista SP2, running OO 3.4.1) How to reproduce: Start Open Office Calc. Save workspace as "CrashTest.ods" From Task Manager kill Open Office (soffice.exe/bin -- one of each) Double click on the saved "CrashTest.ods" in Explorer. OO puts up a message that recovery will occur -- allow it. When the Calc window comes up, don't touch it -- just wait about 10 seconds. Calc window closes and OO puts up a message that recovery will occur -- from now on the sequence will repeat. I suspect this behavior is limited to a few (recent) versions of OO, and very possibly only Calc. Reported as Open Office Bug 1211094. Sigh!! As much as it irritates me, I'm having to switch over to Excel for several things I used to do with Calc. Excel has a miserable UI, but at least it says up for longer than 10 seconds.

    Read the article

  • Recursive move utility on Unix?

    - by Thomas Vander Stichele
    Sometimes I have two trees that used to have the same content, but have grown out of sync (because I moved disks around or whatever). A good example is a tree where I mirror upstream packages from Fedora. I want to merge those two trees again by moving all of the files from tree1 into tree2. Usually I do this with: rsync -arv tree1/* tree2 Then delete tree1. However, this takes an awful lot of time and disk space, and it would be much easier to be able to do: mv -r tree1/* tree2 In other words, a recursive move. It would be faster because first of all it would not even copy, just move the inodes, and second I wouldn't need a delete at the end. Does this exist ? As a test case, consider the following sequence of commands: $ mkdir -p a/b $ touch a/b/c1 $ rsync -arv a/ a2 sending incremental file list created directory ./ b/ b/c1 b/c2 sent 173 bytes received 57 bytes 460.00 bytes/sec total size is 0 speedup is 0.00 $ touch a/b/c2 What command would now have the effect of moving a/b/c2 to a2/b/c2 and then deleting the a subtree (since everything in it is already in the destination tree) ?

    Read the article

  • Sparc v440 unable 2 boot after recommended patch install

    - by user100660
    After installing the October 2011 recommended patch bundle on a Solaris 10 the host fails to boot. The output is {0} ok boot SC Alert: Host System has Reset screen not found. keyboard not found. Keyboard not present. Using ttya for input and output. Sun Fire V440, No Keyboard Copyright 1998-2003 Sun Microsystems, Inc. All rights reserved. OpenBoot 4.10.10, 8192 MB memory installed, Serial #54744555. Ethernet address 0:3:ba:43:55:eb, Host ID: 834355eb. Rebooting with command: boot Boot device: /pci@1f,700000/scsi@2/disk@0,0:a File and args: \ Evaluating: Out of memory Warning: Fcode sequence resulted in a net stack depth change of 1 Evaluating: Evaluating: The file just loaded does not appear to be executable. {3} ok If I do a boot -F failsafe the host come up and I'm able to mount the root device (ufs on /dev/dsk/c1t0d0s0) and nothing appears broken, i.e I can see the logfiles from the patch install etc. Root device still have 1GB+ free. Only 2 kernel patches was installed from the patch bundle: 144500-19 & 147440-02. Any hints how to debug it further, etc.

    Read the article

  • BES Express - configure MDS to push messages from 3rd party web application

    - by Max Gontar
    Hi! I have developed IIS web service to send PAP messages using Blackberry Push API over MDS. And there is an application installed on device, configured to receive push messages on appropriate port. Everything works well on MDS simulator. But it's not working well in real environment: I have installed BES Express and register several devices. I can browse MDS url with appropriate port, so url is correct. Also port enabled for reliable pushes is used in push message and in device application. Here is MDS simulator log: <2011-01-12 14:00:03.456 EET>:[272]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = PapServlet: request from 0:0:0:0:0:0:0:1 564 bytes...> <2011-01-12 14:00:03.476 EET>:[273]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Mapping PAP request to push request for pushID:pushID:asdas> <2011-01-12 14:00:03.479 EET>:[274]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = PushServlet: POST request from [UNKNOWN @ 0:0:0:0:0:0:0:1] to [PAPDEST=WAPPUSH%3D2100000A%253A100%2FTYPE%3DUSER%40rim.net&PORT=100&REQUESTURI=/] : -1 bytes...> <2011-01-12 14:00:03.480 EET>:[275]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = submitting push message with id:pushID:asdas> <2011-01-12 14:00:03.482 EET>:[276]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Executing push submit command for pushID:pushID:asdas> <2011-01-12 14:00:03.483 EET>:[278]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Pushing message to: 2100000a> <2011-01-12 14:00:03.484 EET>:[279]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Number of active push connections:1> <2011-01-12 14:00:03.489 EET>:[280]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = added server-initiated connection = -872546301, push id = pushID:asdas> <2011-01-12 14:00:03.491 EET>:[281]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Available threads in DefaultJobPool = 9 running JobRunner: DefaultJobRunner-7> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION => <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Transmission Line Section]:> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = POST / HTTP/1.1> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Headers Section]: 8 headers> <2011-01-12 14:00:03.494 EET>:[282]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = ReceivedFromServer, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Parameters Section]: 3 parameters> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION => <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Transmission Line Section]:> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = POST / HTTP/1.1> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Headers Section]: 9 headers> <2011-01-12 14:00:03.499 EET>:[283]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, HANDLER = HTTP, EVENT = SentToDevice, DEVICEPIN = 2100000a, CONNECTIONID = -872546301, HTTPTRANSMISSION = [Parameters Section]: 3 parameters> <2011-01-12 14:00:03.501 EET>:[284]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Finished JobRunner: DefaultJobRunner-7, available threads in DefaultJobPool = 10, time spent = 8ms> <2011-01-12 14:00:03.521 EET>:[287]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = CreatedSendingQueue, DEVICEPIN = 2100000a> <2011-01-12 14:00:03.526 EET>:[290]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = Sending, TAG = 1288699908, DEVICEPIN = 2100000a, VERSION = 16, CONNECTIONID = -872546301, SEQUENCE = 0, TYPE = NOTIFY-REQUEST, CONNECTIONHANDLER = http, PROTOCOL = TCP, PARAMETERS = [MGONTAR/10.10.0.35:100], SIZE = 339> <2011-01-12 14:00:03.531 EET>:[291]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Number of active push connections:0> <2011-01-12 14:00:03.591 EET>:[292]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = Notification, TAG = 1288699908, STATE = DELIVERED> <2011-01-12 14:00:03.600 EET>:[296]:<MDS-CS_MDS>:<DEBUG>:<LAYER = SCM, EVENT = Device connections: AVG latency (msecs)79> <2011-01-12 14:00:03.600 EET>:[297]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, Removed push connection:-872546301> <2011-01-12 14:00:07.015 EET>:[298]:<MDS-CS_MDS>:<DEBUG>:<LAYER = IPPP, EVENT = RemovedSendingQueue, DEVICEPIN = 2100000a> And here is real MDS log: <2011-01-12 11:35:02.763 GMT>:[3932]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, PapServlet: request from 192.168.1.241 583 bytes...> <2011-01-12 11:35:02.897 GMT>:[3933]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Mapping PAP request to push request for pushID:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.909 GMT>:[3934]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, PushServlet: POST request from [UNKNOWN @ 192.168.1.241] to [PAPDEST=WAPPUSH%3D22D7F6BD%253A7874%2FTYPE%3DUSER%40rim.net&PORT=7874&REQUESTURI=/]> <2011-01-12 11:35:02.909 GMT>:[3934]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<push id: pushID:sdfsdfwerwer> <2011-01-12 11:35:02.910 GMT>:[3935]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, submitting push message with id:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.910 GMT>:[3936]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Executing push submit command for pushID:pushID:sdfsdfwerwer> <2011-01-12 11:35:02.911 GMT>:[3937]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Pushing message to: 22d7f6bd> <2011-01-12 11:35:02.912 GMT>:[3938]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Number of active push connections:1> <2011-01-12 11:35:02.931 GMT>:[3939]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, added server-initiated connection = -1848311806, push id = pushID:sdfsdfwerwer> <2011-01-12 11:35:03.240 GMT>:[3940]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = CreatedSendingQueue, DEVICEPIN = 22d7f6bd, USERID = u3> <2011-01-12 11:35:03.241 GMT>:[3941]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = Sending, TAG = 536543251, DEVICEPIN = 22d7f6bd, USERID = u3, VERSION = 16, CONNECTIONID = -1848311806, SEQUENCE = 0, TYPE = NOTIFY-REQUEST, CONNECTIONHANDLER = http, PROTOCOL = TCP, PARAMETERS = [LDN-Server1/192.168.1.240:7874], SIZE = 383> <2011-01-12 11:35:03.241 GMT>:[3942]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Number of active push connections:0> <2011-01-12 11:35:03.253 GMT>:[3943]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Sending, VERSION = 1, COMMAND = SEND, TAG = 536543251, SIZE = 570> <2011-01-12 11:35:03.838 GMT>:[3944]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Receiving, VERSION = 1, COMMAND = STATUS, TAG = 536543251, SIZE = 10, STATE = DELIVERED> <2011-01-12 11:35:04.104 GMT>:[3945]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = Notification, TAG = 536543251, STATE = DELIVERED> <2011-01-12 11:35:04.121 GMT>:[3946]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Device connections: AVG latency (msecs)893> <2011-01-12 11:35:04.135 GMT>:[3947]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<INFO >:<LAYER = IPPP, DEVICEPIN = 22d7f6bd, DOMAINNAME = LDN-Server1/192.168.1.240, CONNECTION_TYPE = PUSH_CONN, ConnectionId = -1848311806, DURATION(ms) = 1151, MFH_KBytes = 0, MTH_KBytes = 0.374, MFH_PACKET_COUNT = 0, MTH_PACKET_COUNT = 1> <2011-01-12 11:35:04.144 GMT>:[3948]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, Removed push connection:-1848311806> <2011-01-12 11:35:09.264 GMT>:[3949]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = IPPP, EVENT = RemovedSendingQueue, DEVICEPIN = 22d7f6bd, USERID = u3> <2011-01-12 11:35:58.187 GMT>:[3950]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SRP, SRPID = S27700165[LDN-SERVER1:3200], EVENT = Sending, VERSION = 1, COMMAND = INFO, SIZE = 46> <2011-01-12 11:35:58.187 GMT>:[3951]:<MDS-CS_LDN-SERVER1_MDS-CS_1>:<DEBUG>:<LAYER = SCM, Sent health to S27700165[LDN-SERVER1:3200] Health=[0x 0000 0007 0000 0000],Mask=[0x 0000 0007 0000 0000],Load=[60]> As you can see, logs not really differs, message is marked as delivered. But my app on device not really gets this message (as it works in mds simulator) Please advice me, what may be wrong? Is there some certificate to install or security settings I should configure to make this push message came to device application? Thank you! same question on bbforums

    Read the article

  • How to bypass resume from hibernate

    - by Daniel Trebbien
    I am attempting to resume a Windows Vista laptop from hibernate, but the resume process seems to be stuck in an endless loop in which Windows is repeatedly trying to read from the optical drive. When I press the Power On button on the laptop, the screen is black (not even the backlight turns on) and the following occurs in a loop: Five seconds pass and I hear the optical drive being accessed. (There's no disk in the drive, so it sounds like a short buzzing noise.) Two seconds pass and I hear the optical drive being accessed. Two seconds pass and I hear the optical drive being accessed. So it's three short buzzing noises in a row, over and over again. Eventually I have to abruptly power off the machine. I have tried inserting a data CD into the drive as well as a bootable CD (a live Linux distro boot disk). For both, the optical drive spins up for a bit, but stops after Windows decides that the disk is not what it is looking for. I have since lost the Windows Vista recovery DVD, but I don't know if inserting the recovery disk into the optical drive would have a different effect than the bootable CD. I have tried pressing F8 immediately after pressing the Power On button (hoping to enter System Restore), but that did not have an effect. Is there a special key sequence that will cause Windows to bypass resuming from hibernate, effectively ignoring hiberfil.sys?

    Read the article

  • General logging won't work in MySQL

    - by leonstr
    I saw on SF that there's an option in MySQL to log all queries. So, in my version (mysql-server-5.0.45-7.el5 on CentOS 5.2) this appears to be a case of enabling the 'log' option, so I edited /etc/my.cnf to add this: [mysqld] datadir=/var/lib/mysql socket=/var/lib/mysql/mysql.sock user=mysql old_passwords= log=/var/log/mysql-general.log [mysqld_safe] log-error=/var/log/mysqld.log pid-file=/var/run/mysqld/mysqld.pid I then created the file and set permissions: # touch /var/log/mysql-general.log # chown mysql. /var/log/mysql-general.log # ls -l /var/log/mysql-general.log -rw-r--r-- 1 mysql mysql 0 Jan 18 15:22 /var/log/mysql-general.log But when I start mysqld I get: 120118 15:24:18 mysqld started ^G/usr/libexec/mysqld: File '/var/log/mysql-general.log' not found (Errcode: 13) 120118 15:24:18 [ERROR] Could not use /var/log/mysql-general.log for logging (error 13). Turning logging off for the whole duration of the MySQL server process. To turn it on again: fix the cause, shutdown the MySQL server and restart it. 120118 15:24:18 InnoDB: Started; log sequence number 0 182917764 120118 15:24:18 [Note] /usr/libexec/mysqld: ready for connections. Can anyone suggest why this isn't working?

    Read the article

  • Are web service handler chains possible under IIS / ASP.NET

    - by Mike
    I'm working with a client who wants me to implement a particular design in an IIS/ASP.NET environment. This design was already implemented in Java, but I am not sure it is possible using Microsoft technologies. In a Tomcat/Java environment one can create so call Handler Chains. In essence a handler runs on the server on which the web service is running and it intercepts the SOAP message coming to the web service. The handler can perform a number of tasks before passing control to the web service. Some of these tasks may refer to authentication and authorization. Moreover, one can create handler chains, such that the handlers can run in a particular sequence before passing control to the web service. This is a very elegant solution, as certain aspects of authentication and authorization can be automatically performed, without the developer of the client application and of the web service having to invest anything in it. The code for the client application and the web service is not affected. You may find a number of articles on internet on this subject by searching on Google for "web service handler chain". I performed searches for web service handlers in IIS or ASP.NET. I get some hits, but apparently handlers in IIS have another meaning than that described above. My question therefor is: Can handler chains (as available in Java and Tomcat) be created in IIS? If so, how (any article, book, forum...)? Either a negative or a positive answer will be greatly appreciated. Mike

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Boot loop that I cannot bypass

    - by lonewaft
    Recently, on a laptop that I've used for a while, I had a strange issue where OS files were corrupted (device manager) and Windows 8 was hung after the login screen, so I reinstalled Windows 7 over the existing Windows 8 installation, and it worked for a couple days. Today, when I tried to use my laptop, it was stuck on a boot loop. Right after the BIOS screen, it would show a flashing underscore, then restart the computer, again and again until I removed the battery. I tried booting to a windows 7 install CD, but the same flashing underscore - reboot sequence happened when I tried. I tried moving the boot priority around (HDD first, CD/DVD first, even USB first) but nothing changed. After about an hour of tinkering with it, I listened to the HDD sounds, and it sounded like the HDD was trying to spin up, but failing (whining noise increasing in frequency that stopped and started in sync with the system restarting). I am planning to replace the HDD, but I'm still confused as to why a faulty HDD would stop the laptop from booting to my install DVD (tried it on a different computer, it booted from that CD fine). Anybody here have any idea why this might be happening?

    Read the article

  • How do I fix a corrupt calendar cache?

    - by Blacklight Shining
    I was tailing /var/log/system.log and noticed a sudden wall of text. Looking closer, I saw it was an error CalendarAgent got while trying to save something: Nov 18 11:42:45 rainbow-dash.local CalendarAgent[12321]: CoreData: error: (11) Fatal error. The database at /Users/blackl/Library/Calendars/Calendar Cache is corrupted. SQLite error code:11, 'database disk image is malformed' Nov 18 11:42:45 rainbow-dash.local CalendarAgent[12321]: Core Data: annotation: -executeRequest: encountered exception = Fatal error. The database at /Users/blackl/Library/Calendars/Calendar Cache is corrupted. SQLite error code:11, 'database disk image is malformed' with userInfo = { NSFilePath = "/Users/blackl/Library/Calendars/Calendar Cache"; NSSQLiteErrorDomain = 11; } 2 messages repeated several times Nov 18 11:42:49 rainbow-dash.local CalendarAgent[12321]: [com.apple.calendar.store.log.subscription] [WARNING: CalSubscriptionSession :: persistError :: save failed] This entire sequence is repeated many times throughout the log. file said the file in question was a SQLite 3.x database, so I did a bit of searching and came up with a way to check those. blackl% cp -i ~/Library/Calendars/Calendar\ Cache /tmp blackl% sqlite3 /tmp/Calendar\ Cache SQLite version 3.7.12 2012-04-03 19:43:07 Enter ".help" for instructions Enter SQL statements terminated with a ";" sqlite> pragma integrity_check ; *** in database main *** Main freelist: Bad ptr map entry key=863 expected=(2,0) got=(5,21) On page 21 at right child: 2nd reference to page 863 This is followed by a few dozen lines like these: rowid <number> missing from index <name> and then: wrong # of entries in index <name> I'm at a bit of a loss as to what to do now—I couldn't find anything on how to fix the errors that I found. Also, it would probably be a good idea to disable Calendar Agent so it doesn't try to use the database while it's being fixed (that's why I copied it to /tmp before running sqlite3 on it.) How do I disable CalendarAgent and fix its cache?

    Read the article

  • F5 Networks iRule/Tcl - Escaping UNICODE 6-character escape sequences so they are processed as and r

    - by openid.malcolmgin.com
    We are trying to get an F5 BIG-IP LTM iRule working properly with SharePoint 2007 in an SSL termination role. This architecture offloads all of the SSL processing to the F5 and the F5 forwards interactive requests/responses to the SharePoint front end servers via HTTP only (over a secure network). For the purposes of this discussion, iRules are parsed by a Tcl interpretation engine on the F5 Networks BIG-IP device. As such, the F5 does two things to traffic passing through it: Redirects any request to port 80 (HTTP) to port 443 (HTTPS) through HTTP 302 redirects and URL rewriting. Rewrites any response to the browser to selectively rewrite URLs embedded within the HTML so that they go to port 443 (HTTPS). This prevents the 302 redirects from breaking DHTML generated by SharePoint. We've got part 1 working fine. The main problem with part 2 is that in the response rewrite because of XML namespaces and other similar issues, not ALL matches for "http:" can be changed to "https:". Some have to remain "http:". Additionally, some of the "http:" URLs are difficult in that they live in SharePoint-generated JavaScript and their slashes (i.e. "/") are actually represented in the HTML by the UNICODE 6-character string, "\u002f". For example, in the case of these tricky ones, the literal string in the outgoing HTML is: http:\u002f\u002fservername.company.com\u002f And should be changed to: https:\u002f\u002fservername.company.com\u002f Currently we can't even figure out how to get a match in a search/replace expression on these UNICODE sequence string literals. It seems that no matter how we slice it, the Tcl interpreter is interpreting the "\u002f" string into the "/" translation before it does anything else. We've tried various combinations of Tcl escaping methods we know about (mainly double-quotes and using an extra "\" to escape the "\" in the UNICODE string) but are looking for more methods, preferably ones that work. Does anyone have any ideas or any pointers to where we can effectively self-educate about this? Thanks very much in advance.

    Read the article

  • New monitor connected to HDMI adaptor doesn't show output after booting

    - by Paul
    Hello out there in the multiple monitors’ world. I am a very old newbie in your world and need help. I just purchased a new Asus VH236H monitor and hooked it up the HDMI port of an ATI Radeon HD4300 / 4500 Series display adaptor. I left the old Princeton LCD19 (TMDS) hooked up to the DVI port of the same display adaptor. Both monitors displayed the boot sequence, after I fired good old Sarastro2 (Asus P5Q Pro Turbo – Dual Core E5300 – 2.60 GHz) up. The Asus lacked one half of a second behind the Princeton until the Windows 7 Ultimate SP 1 boot up was complete. Then the Asus displayed “HDMI NO SIGNAL” and went into hibernation. The Princeton stayed lit up as before. Both monitors are displayed on the “Screen Resolution Setup Display” and I plaid around with them for a while. The only thing I accomplished was to shove the desktop icons from the Princeton to the still hibernating Asus. The “Multiple displays:” is set to “Extend these displays”, the Orientation is “Landscape” and the Resolutions are set on both to the “recommended” one. Both monitors show that they work properly in the advanced Properties display. What am I doing wrong, what am I missing? Never mind the opinions about the different resolutions of the two monitors. I always can unhook the Princeton and give it to a Goodwill Store if I do not like the setup. I just would like to make it work. Any constructive help is very much appreciated, Thank you.

    Read the article

  • SSD, AHCI and write performance

    - by Dan
    We've started to deploy SSD drives to our developers workstations. At this moment we're having the unpleasant surprise that the systems using the new SSDs often freeze, with the HDD activity led blinking or being continuously on. Benchmarks shows read speeds around 180 MB/s, but write speeds around 5 MB/s. All developers are using Windows 7 Enterprise, 64 bit, SP1. One of our developers suggested (based on his experience) the following sequence: backup the workstation use a tool to completely erase the SSD make sure AHCI is enabled in BIOS install Windows restore from backup So far, this procedure seems to work (we're still testing, but write speed seems to be 120 MB/s). There are some questions in this context: why do we have to completely reinstall Windows? Is it possible to clean the SSD without reinstalling Windows? Is there a reliable tool? If AHCI was disabled when Windows was installed and we enable it, shouldn't this be enough to correct the write performance issue? If we have to completely erase the SSDs, does this mean the SSDs we've received were used before (SH)? I'm wondering this because the package I've got was open (I didn't think about it at that time, as I considered one of my coworkers simply took a peek inside the package). Has anyone seen a similar problem before?

    Read the article

  • What's the difference between Host and HostName in SSH Config?

    - by Bill Jobs
    The man page says this: Host Host Restricts the following declarations (up to the next Host keyword) to be only for those hosts that match one of the patterns given after the keyword. If more than one pattern is provided, they should be separated by whitespace. A single `*' as a pattern can be used to provide global defaults for all hosts. The host is the hostname argument given on the command line (i.e. the name is not converted to a canonicalized host name before matching). A pattern entry may be negated by prefixing it with an exclamation mark (`!'). If a negated entry is matched, then the Host entry is ignored, regardless of whether any other patterns on the line match. Negated matches are therefore useful to provide exceptions for wildcard matches. See PATTERNS for more information on patterns. HostName HostName Specifies the real host name to log into. This can be used to specify nicknames or abbreviations for hosts. If the hostname contains the character sequence `%h', then this will be replaced with the host name specified on the command line (this is useful for manipulating unqualified names). The default is the name given on the com- mand line. Numeric IP addresses are also permitted (both on the command line and in HostName specifications). For example, when I want to create an SSH Config for GitHub, what should Host and HostName be respectively?

    Read the article

  • SOLVED Install MythTV & 11.10 on Lenovo S12 (Intel atom) with wireless

    - by keepitsimpleengineer
    This is how I installed Ubuntu 11.10 and MythTV client on my Lenovo S12 (Intel Atom) laptop and use it using WiFi (see additional notes at end). I did this because the upgrade from 11.04 bricked the laptop. Note that the partitions on the Lenovo standard disk were already in place for this installation. Also note that my LAN is setup for fixed IP addresses. Downloaded and burned 11.10 x86 Desktop Ubuntu CD Connected the power supply cord, LAN wire and the external DVD USB drive. Ran Windows XP and made sure performance level "Performance" was set and "Wireless" was enabled. Booted S12 from CD Disabled Networking from icon on upper left panel icon Edited Connections… "Wired connection 1" ? Set IP address, accepted default netmask and set gateway. Also set DNS server. Good idea to check "Connection Information" here to verify everything's O.K. Selected Install Ubuntu from the initial "Install" window Verified the three items were checked (required disk space available, plugged into a power source, & connected to the Internet) Selected Download updates while installing and third party software. Hit Continue… At wireless selected don't want to connect…WiFi…now. Continue… At Installation type, selected Something else. Continue… At partition tale, selected the ext4 Linux partition, set the mount point as "/", and marked for formatting. Here I selected the main disk (/sda) for installing the boot manager. Continue… Selected or verified my Time zone. Continue… Selected my keyboard layout. Continue… Filled in the who are you fields. Make sure password is required to sign in is checked. Continue… Chose a picture. Continue… I selected import no accounts. Continue… Wait as the Install creeps along. If your screen goes blank, tap the space bar ? apparently the screen saver/power plan does this. There are several progress bars. The longest was "Installing system", and it was the next to the last one. Installation Complete window appears, Restart Now… Wait as it stops, The screen blanks then the message "…remove…media…close tray…press enter" I just unplugged the USB DVD and hit enter… It was disheartening but the screen turned Ubuntu Purple-beige and nothing happened, so I help down the power key until it shut down, the pressed it again and the Grub Boot screen appeared. Select Ubuntu… 25.The screen went blank with the little flashing underscore cursor on it and the disk light would occasionally flash. I hit the enter key and eventuality Ubuntu started. After a somewhat long time the unity desktop appeared. 11.10, unlike earlier versions, retains the connection information. Check this by checking the network icon on the upper left applet panel. Here the touch-pad·mouse quit working and I had to reboot. It takes and extremely long time to boot, sometimes requiring several power off/ power on (cold boot). You can try to get the default network manager to work, but it might not, it didn't on mine for WiFi. Thanks to: Chris at URL here's what to do… disconnect your wired Internet connection. input your wireless information into network manager open a terminal (unity dash, top of icon totem, open, and make sure the ruler&pen icon on the bottom is selected, 2nd from left) type in "terminal". Might be a good idea to drag and drop the terminal icon to the terminal, it's easy to get rid of later. click to open a terminal, and type in: sudo rmmod acer_wmi && echo "blacklist acer_wmi" >> /etc/modprobe.d/blacklist.conf and hit enter. type in your password as asked. if you have correctly entered your WiFi information and you are near your AP, you should connect immediately if not, see the URL above ? you might need to replace "network manager" with "wicd" ? I did with 11.04. Update the new 11.10, in the upper left panel applet weird·gear icon is menu with a line about updating. It's the new way to invoke Update Manager. Your lenovo S12 (intel atom) should now run the new unity Ubuntu. Point your elbow at the ceiling and pat yourself on the back. Installing Mythbuntu Client 24.1 Open mythbuntu.org/repos (I urge you not to directly use Ubuntu Software Center for this) Install Mythbuntu Repos Save the file (in ~/Downloads, the default) Run the file ? it will update your repositories so that you will get the proper installation sources ? it will start Ubuntu Software Center to do this ? Click Install… You will need your password. Debconf window will open, select by making sure check mark is in the little box "Would you like to activate…". Forward… Which version? At the time of writing the current "Stable" version was 24.1, select 0.24.x… Forward… Read the message, then forward… Delete the downloaded file. Install synaptic (unity dash, top of icon totem, open, and make sure the ruler&pen icon on the bottom is selected, 2nd from left) type in "synaptic". Click on the synaptic icon. Ubuntu Software Center will open and allow you to install synaptic package manager. Open Synaptic (unity dash, top of icon totem, open, and make sure the ruler&pen icon on the bottom is selected, 2nd from left) type in "Synaptic". Might be a good idea to drag and drop the terminal icon to the terminal, it's easy to get rid of later. Run synaptic, read the intro, and close the intro window. Type in mythbuntu-control-centre in the Quick filter text box, and then select it "Mark for installation" by clicking on the box next to it's name. Marvel at the additional to be installed items, then select "?Mark"… At the top of the synaptic window click on the "? Apply" button. Marvel at the amount of stuff to be installed, the click on "Apply". When finished, close finished window and synaptic. Open mythbuntu-control-centre (unity dash, top of icon totem, open, and make sure the ruler&pen icon on the bottom is selected, 2nd from left) type in "mythbuntu". Might be a good idea to drag and drop the mythbuntu-control-centre icon to the terminal, it's easy to get rid of later. You can now configure and install the frontend. Go down the icon totem on the right side of the window and click as needed… System roles. ? No Backend, Desktop Frontend, and Ubuntu Desktop. Apply… & Apply changes… & Password… MySQL Configuration ? from backend ? Setup General Alt-N(ext) Alt-N(ext) Stetting Access Setup PIN code: ~~~~ Input Security key and click "Test Connection", if ?, then Apply… & Apply… {note: for some inexplicable reason, control centre hung on this, but when I restarted it, it was set properly} Graphics drivers, When I did this, only the Broadcom wireless driver showed up. I closed without doing anything. Services. I enabled SSH & Samba. Apply… & Apply… Repositories. Asked & Answered. MythExport. Pass, I believe it requires backend on the same system. Proprietary Codec Support. Check to enable, Apply… & Apply… System Updates. No action necessary, will be a part of the Ubuntu update mechanism. Themes and Artwork. For themes, I selected Enable/Update all. Apply… & Apply… Infrared & Startup behavior and Plugins. Defer until you know more. Close software centre. Open mythTV (unity dash, top of icon totem, open, and make sure the ruler&pen icon on the bottom is selected, 2nd from left) type in "mythTV". Might be a good idea to drag and drop the mythTV icon to the terminal, it's easy to get rid of later. Incorrect Group Membership. Fix this by clicking "Yes"… Log out/end. Do this by clicking "Yes"… For my Lenovo S12, I had to manually restart Ubuntu - and still with the very long restart…/no start/cold boot/reboot/pressing the shift key required Open mythTV (unity dash, top of icon totem, open, and make sure the ruler&pen icon on the bottom is selected, 2nd from left) type in "mythTV". Might be a good idea to drag and drop the mythTV icon to the terminal, it's easy to get rid of later. Will open with Select country & language. Do so. then get message with "No", hit "Ok" and arrive at the data base Configuration 1/2 screen. You will need your brackend password, from backend ? Setup General Database Configuration 1/2 Password:~? Enter this Hit Alt-n to go to the next page. Select "Use custom id…", then enter a custom ID, I use the machine's name. Hit finish, and MythTV should start up with all default settings. For the lenovo S12, the first thing you want to do is to set Playback profiles to "Normal". From Setup TV Settings Playback Alt-N(ext) Alt-N(ext) Playback Profiles (3/8) : Change Current Video Playback Profile to "Normal". You can fiddle with this setting later. For the lenovo S12, the second thing is to get the sound going. From Setup General Alt-N(ext) Alt-N(ext) Alt-N(ext) Audio System: The top of the screen is a button title "Scan for audio devices", move the highlight there and press the Space bar. Then Tab down to Audio Output Device: and left-right arrow until "ALSA:hw:Card=Intel,DEV=0" is selected. Then Alt-N(ext) until "Finish". Now you should have sound. You should now have MythTV working nicely on the Lenovo S12 Notes about wireless: Running Lenovo S12 on wireless is demanding on both power and WiFi connection. Best results will be obtained when running on power and wired connection. I run my S12 on wireless, actually two serial connections with two access points, something that is not easy to achieve. Here Mythbuntu client-server (in den) <? wireless link 1 <?office LAN? wireless link 2 <? Lenovo S12 Ubuntu 11.10 The office LAN is fixed IP behind an Untangle firewall router. There is another MythTV client on Ubuntu 10.10 computer in the office (which has always worked well). ProblemMythbuntu\Win7 client hangs with frozen frames, short segment of audio repeating. Hardware Rosewill RNX-G300EX IEEE 802.11b/g PCI Wireless Card on client-server 2 Linksys WRT54GL wireless broadband routers on LAN for link1 and link 2 WRT54GL FirmwareDD-WRT v24-sp2(07/22/09) voip set up to act as an access point. Note? many people advised this was an unworkable scheme, and in probably most cases it will be. Solution? Set up DD-WRT with the following Wireless settings… Basic Channel: Different fixed channels at least 4 difference, I use 6 & 11 Basic Sensitivity Range (ACK timing): 50 MAC filter use filter: Enable, Selected Permit only clients listed to access… Requires adding MAC addresses in "Edit MAC Filter List" This causes the 54GL's to ignore any but the listed MAC address, down side, no "guest" capability. Advanced Basic rate: All Advanced CTS Protection Mode: Off Advanced Frame Burst: Enable Advanced Max associate clients: 4 for client link 2, 1 for client-server link 1 Advanced AP isolation: Enable Advanced Preamble: Short Advanced Afterburner: On Advanced Wireless GUI access: Off Advanced WMM support: Off Other settings: default for supplied firmware. Why I suspect this worked? The 54GL Access Points's with the firmware's setting are set to handle a multiple client, wide area situation. With these mods I reconfigured them for a small area, few client situation, disabling Advanced WMM probably the most important. In addition, the client mythtv when used all other users of its access point are turned off except for a Skype phone. Also, the client-server is set up to allow other connections though it's LAN connection, and these are used to connect the TV and disc players, not used when client is being used.

    Read the article

  • How can I disable the CTRL-ALT-DEL key combination completely on XP/Vista/7?

    - by Travesty3
    I have been googling extensively to figure this out, and nobody seems to be able to give a direct answer. Let me start by saying that I'm NOT talking about requiring CTRL-ALT-DEL to enter logon information. I'm working on a golf simulator program which is used at golf centers. I need the ability to completely disable the CTRL-ALT-DEL key sequence so that the golf center customers can't get out of the program and access the computer at all. I realize there are other key combinations that need to be handled as well, we already have this entire feature working in XP, but we're going to be switching to Windows 7 soon, and CTRL-ALT-DEL is the only one that doesn't seem to work in Win7. I'd really like an all-around solution if at all possible. This same program may also be installed on a client's personal computer for an in-home golf simulator, but the computers that really need this feature (golf center computers) are provided to the golf center by us, so would the best option be to write a new shell? I don't know anything about that at all, other than others that suggest writing a new shell for kiosk mode. I'd really like a simpler option, like modifying the registry in some way. I have heard that you can remove some buttons from the menu screen that pops up, but unless I can remove pretty much all of them (including the shutdown/restart button in the bottom-right corner), this won't be enough of a solution for me. Thanks for taking the time to read this and thanks again for any help you could provide! -Travis

    Read the article

  • Why my hard disk can't boot from the BIOS?

    - by Mario
    I installed a new sata DVD burner. When I turned on the machine (windows 7) it didn't boot. It can boot from a lubuntu CD. There is an option on lubuntu to boot form the first hard disk. If I select it, the machine boots normally to windows 7. So from the CD I can boot but not from the BIOS. I checked all the options more than once: boot from HD, not boot from removable, boot from USB, boot from optical. The order of the boot sequence is HD then DVD. I tried booting only with the HD; I disconnected both DVDs. I even tried recovery of the MBR: bootsect, bootrec, fixmbr, buildbcd, nt60, etc. So, the question is, does this have a reason, what's the difference between booting from the BIOS (as I think) to from the DVD?. The BIOS is intel, it has BIOS codes on the right bottom corner, it stays at 5A for a while. 5A is "Resetting PATA/SATA bus and all devices".

    Read the article

  • How to bypass resume from hibernate [closed]

    - by Daniel Trebbien
    I am attempting to resume a Windows Vista laptop from hibernate, but the resume process seems to be stuck in an endless loop in which Windows is repeatedly trying to read from the optical drive. When I press the Power On button on the laptop, the screen is black (not even the backlight turns on) and the following occurs in a loop: Five seconds pass and I hear the optical drive being accessed. (There's no disk in the drive, so it sounds like a short buzzing noise.) Two seconds pass and I hear the optical drive being accessed. Two seconds pass and I hear the optical drive being accessed. So it's three short buzzing noises in a row, over and over again. Eventually I have to abruptly power off the machine. I have tried inserting a data CD into the drive as well as a bootable CD (a live Linux distro boot disk). For both, the optical drive spins up for a bit, but stops after Windows decides that the disk is not what it is looking for. I have since lost the Windows Vista recovery DVD, but I don't know if inserting the recovery disk into the optical drive would have a different effect than the bootable CD. I have tried pressing F8 immediately after pressing the Power On button (hoping to enter System Restore), but that did not have an effect. Is there a special key sequence that will cause Windows to bypass resuming from hibernate, effectively ignoring hiberfil.sys?

    Read the article

  • Speeding up Outlook Express on Windows XP over satellite

    - by John
    My brother is in the field with Doctors Without Borders. I'm posting this question on his behalf. We use outlook express (on a pc running windows XP) and a 9600 baud dial up satellite phone modem to get our email direct from the server in Paris. As this is a very expensive way to communicate (our satellite bill is $50K a year, no joke), it seems like trying to streamline is a good idea. Here's the question- when we connect, the sequence goes: Send outbox mails. This goes pretty quickly, probably 10-15 seconds for each email, up to maybe a couple minutes for an email of 150k or so). The status bar moves pretty quickly, according to the emails sent. The system then says "Checking for new messages on (our account name), and "Receiving list of messages from server". This takes a long time. Like 10-15 minutes. The status bar crawls along. Then it receives the messages. "Receiving messages from server". Again, each message takes 10-15 seconds, and this part moves along reasonably fast. I'm curious as to what is going on in the second part. It takes forever, and doesn't seem to be part of the sending or receiving messages themselves. Is there a way to speed up the process by changing a preference with communicating with the server or something? Does anyone have any advice for him speeding up what Outlooks Express is doing? Obviously his software is ancient and adding more software is not realistic based on the connection speed. Thanks!

    Read the article

  • Give back full control to a user on a disk from another computer

    - by Foghorn
    I have my friend's hard drive mounted externally. After messing with the permissions with TAKEOWN so I could fix some viruses, I have full control over their drive. The problem is, now it's stuck in a "autochk not found" reboot sequence. I think the problem is that the boot sector is invisible to the drive now. So my question is, How can I use icacls to give back the full ownership, when the user I am giving it to is not on my machine? I ran the TAKEOWN command from my windows 7 laptop, their machine is a windows xp Professional with three partitions, I only altered the one that has the boot sector. Here is the permissions that icacls shows: (Where my computer is %System% my username is ME, and the drive is E:\ C:\Users\ME icacls E:\* E:\$RECYCLE.BIN %System%\ME:(OI)(CI)(F) Mandatory Label\Low Mandatory Level:(OI)(CI)(IO)(NW) E:\ALLDATAW %System%\ME:(I)(OI)(CI)(F) E:\alrt_200.data %System%\ME:(OI)(CI)(F) E:\AUTOEXEC.BAT %System%\ME:(OI)(CI)(F) E:\AZ Commercial %System%\ME:(I)(OI)(CI)(F) E:\boot.ini %System%\ME:(OI)(CI)(F) E:\Config.Msi %System%\ME:(I)(OI)(CI)(F) E:\CONFIG.SYS %System%\ME:(OI)(CI)(F) E:\Documents and Settings %System%\ME:(I)(OI)(CI)(F) E:\IO.SYS %System%\ME:(OI)(CI)(F) E:\Mitchell1 %System%\ME:(I)(OI)(CI)(F) E:\MSDOS.SYS %System%\ME:(OI)(CI)(F) E:\MSOCache %System%\ME:(I)(OI)(CI)(F) E:\NTDClient.log %System%\ME:(OI)(CI)(F) E:\NTDETECT.COM %System%\ME:(OI)(CI)(F) E:\ntldr %System%\ME:(OI)(CI)(F) E:\pagefile.sys %System%\ME:(OI)(CI)(F) E:\Program Files %System%\ME:(I)(OI)(CI)(F) E:\RECYCLER %System%\ME:(I)(OI)(CI)(F) E:\RHDSetup.log %System%\ME:(OI)(CI)(F) E:\System Volume Information %System%\ME:(I)(OI)(CI)(F) E:\WINDOWS %System%\ME:(I)(OI)(CI)(F) Successfully processed 22 files; Failed processing 0 files C:\Users\ME

    Read the article

  • Moving MySQL directory on an Amazon EC2 machine

    - by Traveling Tech Guy
    I'm trying to have MySQL point to a directory on an EBS volume I mounted on my EC2 machine. I took th following steps: Stopped MySQL (/etc/init.d/mysqld stop) - successful Created a MySQL directory on my volume, mounted on /vol (mkdir /vol/mysql) Copied the contents of /var/lib/mysql to /vol/mysql (cp -R /var/lib/mysql /vol/mysql) Chanded the owner and group of that directory to match the original (chown -R mysql:mysql /vol/mysql) - after this step, the 2 directories are identical. Edited the /etc/my.cnf file (commented 2 original lines): [mysqld] #datadir=/var/lib/mysql #socket=/var/lib/mysql/mysql.sock datadir=/vol/mysql socket=/vol/mysql/mysql.sock` Started MySQL (/etc/init.d/mysqld start) - FAILED The error file /var/log/mysqld.log contains the following lines: 100205 20:52:54 mysqld started 100205 20:52:54 InnoDB: Started; log sequence number 0 43665 100205 20:52:54 [Note] /usr/libexec/mysqld: ready for connections. Version: '5.0.45' socket: '/vol/mysql/mysql.sock' port: 3306 Source distribution No other errors are available. What am I doing wrong? Where can I find the error/s encountered by MySql? If I restore the original lines, MySQL starts, leading me to believe it may be a permissions issue - but permissions are the same for both directories? Thanks!

    Read the article

  • Cisco ASA5505 won't sync with NTP

    - by Martijn Heemels
    Today I noticed that the clock my Cisco ASA 5505 firewall was running about 15 minutes late, which surprised me since I've set up the NTP client. My two NTP servers 10.10.0.1 and 10.10.0.2 are virtualized Windows Server 2008 R2 domain controllers, and both have the correct time. As shown below, the ASA knows about the two servers, can ping them and seems to poll them periodically, so I suppose it can reach them both. The ASA claims its time source is NTP, however the clock is unsynchronized. Neither host is marked as synced. Result of the command: "ping 10.10.0.1" Type escape sequence to abort. Sending 5, 100-byte ICMP Echos to 10.10.0.1, timeout is 2 seconds: !!!!! Success rate is 100 percent (5/5), round-trip min/avg/max = 1/1/1 ms Result of the command: "sh ntp ass" address ref clock st when poll reach delay offset disp ~10.10.0.1 .LOCL. 1 78 1024 377 0.5 643.69 17.0 ~10.10.0.2 10.10.0.1 2 190 1024 377 0.9 655.91 58.4 * master (synced), # master (unsynced), + selected, - candidate, ~ configured Result of the command: "sh ntp stat" Clock is unsynchronized, stratum 16, no reference clock nominal freq is 99.9984 Hz, actual freq is 99.9984 Hz, precision is 2**6 reference time is 00000000.00000000 (07:28:16.000 CEST Thu Feb 7 2036) clock offset is 0.0000 msec, root delay is 0.00 msec root dispersion is 0.00 msec, peer dispersion is 0.00 msec Result of the command: "sh clock detail" 10:33:23.769 CEDT Tue Jun 26 2012 Time source is NTP UTC time is: 08:33:23 UTC Tue Jun 26 2012 Summer time starts 02:00:00 CEST Sun Mar 25 2012 Summer time ends 03:00:00 CEDT Sun Oct 28 2012 I've tried the basic steps of manually setting the time and removing and adding the timeservers, to no avail. My ASA's ntp config is simply: ntp server 10.10.0.1 ntp server 10.10.0.2 Do I need to enable authentication to use a Windows NTP server? Any thoughts?

    Read the article

  • AIX Checklist for stable obiee deployment

    - by user554629
    Common AIX configuration issues     ( last updated 27 Aug 2012 ) OBIEE is a complicated system with many moving parts and connection points.The purpose of this article is to provide a checklist to discuss OBIEE deployment with your systems administrators. The information in this article is time sensitive, and updated as I discover new  issues or details. What makes OBIEE different? When Tech Support suggests AIX component upgrades to a stable, locked-down production AIX environment, it is common to get "push back".  "Why is this necessary?  We aren't we seeing issues with other software?"It's a fair question that I have often struggled to answer; here are the talking points: OBIEE is memory intensive.  It is the entire purpose of the software to trade memory for repetitive, more expensive database requests across a network. OBIEE is implemented in C++ and is very dependent on the C++ runtime to behave correctly. OBIEE is aggressively thread efficient;  if atomic operations on a particular architecture do not work correctly, the software crashes. OBIEE dynamically loads third-party database client libraries directly into the nqsserver process.  If the library is not thread-safe, or corrupts process memory the OBIEE crash happens in an unrelated part of the code.  These are extremely difficult bugs to find. OBIEE software uses 99% common source across multiple platforms:  Windows, Linux, AIX, Solaris and HPUX.  If a crash happens on only one platform, we begin to suspect other factors.  load intensity, system differences, configuration choices, hardware failures.  It is rare to have a single product require so many diverse technical skills.   My role in support is to understand system configurations, performance issues, and crashes.   An analyst trained in Business Analytics can't be expected to know AIX internals in the depth required to make configuration choices.  Here are some guidelines. AIX C++ Runtime must be at  version 11.1.0.4$ lslpp -L | grep xlC.aixobiee software will crash if xlC.aix.rte is downlevel;  this is not a "try it" suggestion.Nov 2011 11.1.0.4 version  is appropriate for all AIX versions ( 5, 6, 7 )Download from here:https://www-304.ibm.com/support/docview.wss?uid=swg24031426 No reboot is necessary to install, it can even be installed while applications are using the current version.Restart the apps, and they will pick up the latest version. AIX 5.3 Technology Level 12 is required when running on Power5,6,7 processorsAIX 6.1 was introduced with the newer Power chips, and we have seen no issues with 6.1 or 7.1 versions.Customers with an unstable deployment, dozens of unexplained crashes, became stable after the upgrade.If your AIX system is 5.3, the minimum TL level should be at or higher than this:$ oslevel -s  5300-12-03-1107IBM typically supports only the two latest versions of AIX ( 6.1 and 7.1, for example).  AIX 5.3 is still supported and popular running in an LPAR. obiee userid limits$ ulimit -Ha  ( hard limits )$ ulimit -a   ( default limits )core file size (blocks)     unlimiteddata seg size (kbytes)      unlimitedfile size (blocks)          unlimitedmax memory size (kbytes)    unlimitedopen files                  10240 cpu time (seconds)          unlimitedvirtual memory (kbytes)     unlimitedIt is best to establish the values in /etc/security/limitsroot user is needed to observe and modify this file.If you modify a limit, you will need to relog in to change it again.  For example,$ ulimit -c 0$ ulimit -c 2097151cannot modify limit: Operation not permitted$ ulimit -c unlimited$ ulimit -c0There are only two meaningful values for ulimit -c ; zero or unlimited.Anything else is likely to produce a truncated core file that cannot be analyzed. Deploy 32-bit or 64-bit ?Early versions of OBIEE offered 32-bit or 64-bit choice to AIX customers.The 32-bit choice was needed if a database vendor did not supply a 64-bit client library.That's no longer an issue and beginning with OBIEE 11, 32-bit code is no longer shipped.A common error that leads to "out of memory" conditions to to accept the 32-bit memory configuration choices on 64-bit deployments.  The significant configuration choices are: Maximum process data (heap) size is in an AIX environment variableLDR_CNTRL=IGNOREUNLOAD@LOADPUBLIC@PREREAD_SHLIB@MAXDATA=0x... Two thread stack sizes are made in obiee NQSConfig.INI[ SERVER ]SERVER_THREAD_STACK_SIZE = 0;DB_GATEWAY_THREAD_STACK_SIZE = 0; Sort memory in NQSConfig.INI[ GENERAL ]SORT_MEMORY_SIZE = 4 MB ;SORT_BUFFER_INCREMENT_SIZE = 256 KB ; Choosing a value for MAXDATA:0x080000000  2GB Default maximum 32-bit heap size ( 8 with 7 zeros )0x100000000  4GB 64-bit breaking even with 32-bit ( 1 with 8 zeros )0x200000000  8GB 64-bit double 32-bit max0x400000000 16GB 64-bit safetyUsing 2GB heap size for a 64-bit process will almost certainly lead to an out-of-memory situation.Registers are twice as big ... consume twice as much memory in the heap.Upgrading to a 4GB heap for a 64-bit process is just "breaking even" with 32-bit.A 32-bit process is constrained by the 32-bit virtual addressing limits.  Heap memory is used for dynamic requirements of obiee software, thread stacks for each of the configured threads, and sometimes for shared libraries. 64-bit processes are not constrained in this way;  extra heap space can be configured for safety against a query that might create a sudden requirement for excessive storage.  If the storage is not available, this query might crash the whole server and disrupt existing users.There is no performance penalty on AIX for configuring more memory than required;  extra memory can be configured for safety.  If there are no other considerations, start with 8GB.Choosing a value for Thread Stack size:zero is the value documented to select an appropriate default for thread stack size.  My preference is to change this to an absolute value, even if you intend to use the documented default;  it provides better documentation and removes the "surprise" factor.There are two thread types that can be configured. GATEWAY is used by a thread pool to call a database client library to establish a DB connection.The default size is 256KB;  many customers raise this to 512KB ( no performance penalty for over-configuring ). This value must be set to 1 MB if Teradata connections are used. SERVER threads are used to run queries.  OBIEE uses recursive algorithms during the analysis of query structures which can consume significant thread stack storage.  It's difficult to provide guidance on a value that depends on data and complexity.  The general notion is to provide more space than you think you need,  "double down" and increase the value if you run out, otherwise inspect the query to understand why it is too complex for the thread stack.  There are protections built into the software to abort a single user query that is too complex, but the algorithms don't cover all situations.256 KB  The default 32-bit stack size.  Many customers increased this to 512KB on 32-bit.  A 64-bit server is very likely to crash with this value;  the stack contains mostly register values, which are twice as big.512 KB  The documented 64-bit default.  Some early releases of obiee didn't set this correctly, resulting in 256KB stacks.1 MB  The recommended 64-bit setting.  If your system only ever uses 512KB of stack space, there is no performance penalty for using 1MB stack size.2 MB  Many large customers use this value for safety.  No performance penalty.nqscheduler does not use the NQSConfig.INI file to set thread stack size.If this process crashes because the thread stack is too small, use this to set 2MB:export OBI_BACKGROUND_STACK_SIZE=2048 Shared libraries are not (shared) When application libraries are loaded at run-time, AIX makes a decision on whether to load the libraries in a "public" memory segment.  If the filesystem library permissions do not have the "Read-Other" permission bit, AIX loads the library into private process memory with two significant side-effects:* The libraries reduce the heap storage available.      Might be significant in 32-bit processes;  irrelevant in 64-bit processes.* Library code is loaded into multiple real pages for execution;  one copy for each process.Multiple execution images is a significant issue for both 32- and 64-bit processes.The "real memory pages" saved by using public memory segments is a minor concern.  Today's machines typically have plenty of real memory.The real problem with private copies of libraries is that they consume processor cache blocks, which are limited.   The same library instructions executing in different real pages will cause memory delays as the i-cache ( instruction cache 128KB blocks) are refreshed from real memory.   Performance loss because instructions are delayed is something that is difficult to measure without access to low-level cache fault data.   The machine just appears to be running slowly for no observable reason.This is an easy problem to detect, and an easy problem to correct.Detection:  "genld -l" AIX command produces a list of the libraries used by each process and the AIX memory address where they are loaded.32-bit public segment is 13 ( "dxxxxxxx" ).   private segments are 2-a.64-bit public segment is 9 ( "9xxxxxxxxxxxxxxx") ; private segment is 8.genld -l | grep -v ' d| 9' | sort +2provides a list of privately loaded libraries. Repair: chmod o+r <libname>AIX shared libraries will have a suffix of ".so" or ".a".Another technique is to change all libraries in a selected directory to repair those that might not be currently loaded.   The usual directories that need repair are obiee code, httpd code and plugins, database client libraries and java.chmod o+r /shr/dir/*.a /shr/dir/*.so Configure your system for diagnosticsProduction systems shouldn't crash, and yet bad things happen to good software.If obiee software crashes and produces a core, you should configure your system for reliable transfer of the failing conditions to Oracle Tech Support.  Here's what we need to be able to diagnose a core file from your system.* fullcore enabled. chdev -lsys0 -a fullcore=true* core naming enabled. chcore -n on -d* ulimit must not truncate core. see item 3.* pstack.sh is used to capture core documentation.* obidoc is used to capture current AIX configuration.* snapcore  AIX utility captures core and libraries. Use the proper syntax. $ snapcore -r corename executable-fullpath   /tmp/snapcore will contain the .pax.Z output file.  It is compressed.* If cores are directed to a common directory, ensure obiee userid can write to the directory.  ( chcore -p /cores -d ; chmod 777 /cores )The filesystem must have sufficient space to hold a crashing obiee application.Use:  df -k  Check the "Free" column ( not "% Used" )  8388608 is 8GB. Disable Oracle Client Library signal handlingThe Oracle DB Client Library is frequently distributed with the sqlplus development kit.By default, the library enables a signal handler, which will document a call stack if the application crashes.   The signal handler is not needed, and definitely disruptive to obiee diagnostics.   It needs to be disabled.   sqlnet.ora is typically located at:   $ORACLE_HOME/network/admin/sqlnet.oraAdd this line at the top of the file:   DIAG_SIGHANDLER_ENABLED=FALSE Disable async query in the RPD connection pool.This might be an obiee 10.1.3.4 issue only ( still checking  )."async query" must be disabled in the connection pools.It was designed to enable query cancellation to a database, and turned out to have too many edge conditions in normal communication that produced random corruption of data and crashes.  Please ensure it is turned off in the RPD. Check AIX error report (errpt).Errors external to obiee applications can trigger crashes.  $ /bin/errpt -aHardware errors ( firmware, adapters, disks ) should be reported to IBM support.All application core files are recorded by AIX;  the most recent ones are listed first. Reserved for something important to say.

    Read the article

< Previous Page | 194 195 196 197 198 199 200 201 202 203 204 205  | Next Page >