Search Results

Search found 14125 results on 565 pages for 'apache commons io'.

Page 204/565 | < Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >

  • Search a string in a file and write the matched lines to another file in Java

    - by Geeta
    For searching a string in a file and writing the lines with matched string to another file it takes 15 - 20 mins for a single zip file of 70MB(compressed state). Is there any ways to minimise it. my source code: getting Zip file entries zipFile = new ZipFile(source_file_name); entries = zipFile.entries(); while (entries.hasMoreElements()) { ZipEntry entry = (ZipEntry)entries.nextElement(); if (entry.isDirectory()) { continue; } searchString(Thread.currentThread(),entry.getName(), new BufferedInputStream (zipFile.getInputStream(entry)), Out_File, search_string, stats); } zipFile.close(); Searching String public void searchString(Thread CThread, String Source_File, BufferedInputStream in, File outfile, String search, String stats) throws IOException { int count = 0; int countw = 0; int countl = 0; String s; String[] str; BufferedReader br2 = new BufferedReader(new InputStreamReader(in)); System.out.println(CThread.currentThread()); while ((s = br2.readLine()) != null) { str = s.split(search); count = str.length - 1; countw += count; //word count if (s.contains(search)) { countl++; //line count WriteFile(CThread,s, outfile.toString(), search); } } br2.close(); in.close(); } -------------------------------------------------------------------------------- public void WriteFile(Thread CThread,String line, String out, String search) throws IOException { BufferedWriter bufferedWriter = null; System.out.println("writre thread"+CThread.currentThread()); bufferedWriter = new BufferedWriter(new FileWriter(out, true)); bufferedWriter.write(line); bufferedWriter.newLine(); bufferedWriter.flush(); } Please help me. Its really taking 40 mins for 10 files using threads and 15 - 20 mins for a single file of 70MB after being compressed. Any ways to minimise the time.

    Read the article

  • How to store a scaleable sized extensible event log?

    - by firoso
    Hello everyone! I've been contemplating writing a simple "event log" that takes a paramater list and stores event messages in a log file, trouble is, I forsee this file growing to be rather large (assume 1M entries or more) the question is, how can I implement this system without pulling teeth, I know that SQL would be a possible way to go. XML would be ideal but not really practical for scaleability if i'm not going nuts. Example Log Entry -----Time Date-------- ---------Sender----------------------- ---------Tags---------- --Message---------- 12/24/2008 24:00:00 $DOMAIN\SYSTEM\Application$ :Trivial: :Notification: It's Christmas in 1s

    Read the article

  • implementing a Intelligent File Transfer Software in java over TCP/IP

    - by whyjava
    Hello I am working on a proposal where we have to implement a software which can move files between one source to destination.The overall goal of this project is to create intelligent file transfer.This software will have three components :- 1) Broker : Broker is the module that communicates with other brokers, monitors files, moves files, retrieves configurations from the Configuration Manager, supplies process information for the monitor, archives files, writes all process data to log files and escalates issues if necessary 2) Configuration Manager :Configuration Manager is a web-based application used to configure and deploy the configuration to all brokers. 3) Monitor : Monitor is a web-based application used to monitor each Broker in the environment. This project has to be built up in java and protocol for file transfer in tcp/ip. Client does not want to use FTP. File Transfer seems very easy, until there are several processes who are waiting to pick the file up automatically. Several problems arise: How can we guarantee the file is received at the destination? If a file isn’t received the first time, we should try it again (even after a restart or power breakdown) ? How does the receiver knows the file that is received is complete? How can we transfer multiple files synchronously? How can we protect the bandwidth, so file transfer isn’t blocking other processes? How does one interoperate between multiple OS platforms? What about authentication? How can we monitor het workflow? Auditing / logging Archiving Can you please provide answer to some of these? Thanks

    Read the article

  • Point subdirectory to another domain is IIS 6

    - by Liviu
    Is it possible to rewrite somehow www.mysite.com/Pictures to point to test.mysite.com/Pictures or even more broadly www.someothersite.com/Pictures ? Note: www.mysite.com and test.mysite.com are on separate machines and built with different technologies (one is ASP.NET and the other is PHP) but I have access to both of them. I want that when I reference a picture like www.mysite.com/Pictures/pic12345.png the picture to display correctly, even though there is not /Pictures folder on that server and the pictures has to be retrieved by going to test.mysite.com/Picture/pic12345.png Ideally I want to do this in IIS6 to test it. However I am interested if it possible to do in any webserver (Apache, IIS7)

    Read the article

  • c++ File input/output

    - by Myx
    Hi: I am trying to read from a file using fgets and sscanf. In my file, I have characters on each line of the while which I wish to put into a vector. So far, I have the following: FILE *fp; fp = fopen(filename, "r"); if(!fp) { fprintf(stderr, "Unable to open file %s\n", filename); return 0; } // Read file int line_count = 0; char buffer[1024]; while(fgets(buffer, 1023, fp)) { // Increment line counter line_count++; char *bufferp = buffer; ... while(*bufferp != '\n') { char *tmp; if(sscanf(bufferp, "%c", tmp) != 1) { fprintf(stderr, "Syntax error reading axiom on " "line %d in file %s\n", line_count, filename); return 0; } axiom.push_back(tmp); printf("put %s in axiom vector\n", axiom[axiom.size()-1]); // increment buffer pointer bufferp++; } } my axiom vector is defined as vector<char *> axiom;. When I run my program, I get a seg fault. It happens when I do the sscanf. Any suggestions on what I'm doing wrong?

    Read the article

  • Unable to open a file for writing

    - by asdasdas
    I am trying to write to a file. I do a file_exists check on it before I do fopen and it returns true (the file does exist). However, the file fails this code and gives me the error every time: $handle = fopen($filename, 'w'); if($handle) { flock($handle, LOCK_EX); fwrite($handle, $contents); } else { echo 'ERROR: Unable to open the file for writing.',PHP_EOL; exit(); } flock($handle, LOCK_UN); fclose($handle); Is there a way I can get more specific error details as to why this file does not let me open it for writing? I know that the filename is legit, but for some reason it just wont let me write to it. I do have write permissions, I was able to write and write over another file.

    Read the article

  • Do we need seperate file path for window and linux in java

    - by Kishor Sharma
    I have a file on linux ubuntu server hosted with path name /home/kishor/project/detail/. When I made a web app in window to upload and download file from specified location i used path "c:\kishor\projects\detail\" for saving in window. For my surprise when i used window file path name in my server i am still able to get files and upload them, i.e, "c:\kishor\projects\detail\". Can anyone explain why it is working (as window and linux both use different file path pattern).

    Read the article

  • Extract some data from a lot of xml files

    - by LifeH2O
    I have cricket player profiles saved in the form of .xml files in a folder. each file has these tags in it <playerid>547</playerid> <majorteam>England</majorteam> <playername>Don</playername> the playerid is same as in .xml (each file is of different size,1kb to 5kb). These are about 500 files. What i need is to extract the playername, majorteam, and playerid from all these files to a list. I will convert that list to XML later. If you know how can i do it directly to XML i will be very thankful.

    Read the article

  • problem when migrating from development into live server

    - by justjoe
    I'm facing problem when migrate my web app project from development server to live server. the reason is because i just realize that the live server has different PHP version and available memory lower then mine. i found this after client give me their ftp and cpanel access of their server, which is a shared host. so, how do we handle this situation ? and avoid similar problem in the future ? What is the most suitable configuration of a development server ? btw, i use xampp in windows. it's has apache and mysql.

    Read the article

  • How can I tell Phusion Passenger which python to use?

    - by Mike
    I'm using Phusion Passenger with a ruby app and I'd also like to set it up to work with an django appengine app I'm working on. Googling for "passenger_wsgi.py" I was able to get the following very simple non-django app working on passenger: passenger_wsgi.py: def application(environ, start_response): response_headers = [('Content-type','text/plain')] start_response('200 OK', response_headers) return ['Hello World!\n'] However, if I add the line import django.core.handlers.wsgi into the mix, I get 'An error occurred importing your passenger_wsgi.py'. By printing out the sys.path I've discovered that at least part of the reason is because Passenger is using the wrong python installation on my machine. How can I configure Passenger (on apache) to use /opt/local/bin/python2.5 instead of the system default python?

    Read the article

  • Spring Integration 1.0 RC2: Streaming file content?

    - by gdm
    I've been trying to find information on this, but due to the immaturity of the Spring Integration framework I haven't had much luck. Here is my desired work flow: New files are placed in an 'Incoming' directory Files are picked up using a file:inbound-channel-adapter The file content is streamed, N lines at a time, to a 'Stage 1' channel, which parses the line into an intermediary (shared) representation. This parsed line is routed to multiple 'Stage 2' channels. Each 'Stage 2' channel does its own processing on the N available lines to convert them to a final representation. This channel must have a queue which ensures no Stage 2 channel is overwhelmed in the event that one channel processes significantly slower than the others. The final representation of the N lines is written to a file. There will be as many output files as there were routing destinations in step 4. *'N' above stands for any reasonable number of lines to read at a time, from [1, whatever I can fit into memory reasonably], but is guaranteed to always be less than the number of lines in the full file. How can I accomplish streaming (steps 3, 4, 5) in Spring Integration? It's fairly easy to do without streaming the files, but my files are large enough that I cannot read the entire file into memory. As a side note, I have a working implementation of this work flow without Spring Integration, but since we're using Spring Integration in other places in our project, I'd like to try it here to see how it performs and how the resulting code compares for length and clarity.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Add up values from a text file

    - by Stanley
    Hi Guys I have a text file that contains Amounts at Substring (34, 47) of each line. I need to sum Up all the Values to the End of the File. I have this code that I had started to build but I do not know how to proceed from here: public class Addup { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException, IOException { // TODO code application logic here FileInputStream fs = new FileInputStream("C:/Analysis/RL004.TXT"); BufferedReader br = new BufferedReader(new InputStreamReader(fs)); String line; while((line = br.readLine()) != null){ String num = line.substring(34, 47); double i = Double.parseDouble(num); System.out.println(i); } } } The output is like this: 1.44576457E4 2.33434354E6 4.56875685E3 The Amount is in two decimal Places and I need the result also in the Two decimal Places. What Is the Best way to achieve this?

    Read the article

  • Write problem - lossing the original data

    - by John
    Every time I write to the text file I will lose the original data, how can I read the file and enter the data in the empty line or the next line which is empty? public void writeToFile() { try { output = new Formatter(myFile); } catch(SecurityException securityException) { System.err.println("Error creating file"); System.exit(1); } catch(FileNotFoundException fileNotFoundException) { System.err.println("Error creating file"); System.exit(1); } Scanner scanner = new Scanner (System.in); String number = ""; String name = ""; System.out.println("Please enter number:"); number = scanner.next(); System.out.println("Please enter name:"); name = scanner.next(); output.format("%s,%s \r\n", number, name); output.close(); }

    Read the article

  • How to run a set of SQL queries from a file, in PHP?

    - by Harish Kurup
    I have some set of SQL queries which is in a file(i.e query.sql), and i want to run those queries in files using PHP, the code that i have wrote is not working, //database config's... $file_name="query.sql"; $query==file($file_name); $array_length=count($query); for($i=0;$i<$array_length;$i++) { $data .= $query[$i]; } echo $data; mysql_query($data); it echos the SQL Query from the file but throws an error at mysql_query() function...

    Read the article

  • How to read from database and write into text file with C#?

    - by user147685
    How to read from database and write into text file? I want to write/copy (not sure what to call) the record inside my database into a text file. One row record in database is equal to one line in the text file. I'm having no problem in database. For creating text file, it mentions FileStream and StreamWriter. Which one should I use?

    Read the article

  • Store data in file system rather than SQL or Oracle database.

    - by nunu
    Hi All, As I am working on Employee Management system, I have two table (for example) in database as given below. EmployeeMaster (DB table structure) EmployeeID (PK) | EmployeeName | City MonthMaster (DB table structure) Month | Year | EmployeeID (FK) | PrenentDays | BasicSalary Now my question is, I want to store data in file system rather than storing data in SQL or ORACLE. I want my data in file system storage for Insert, Edit and Delete opration with keeping relation with objects too. I am a C# developer, Could anybody have thoughts or idea on it. (To store data in file system with keeping relations between them) Thanks in advance. Any ideas on it?

    Read the article

  • How can I redirect all traffic from one domain to another with an .htaccess file?

    - by George Edison
    Say I have a subdomain xxx.yyy.com running Apache. The files are stored in /home/someone/public_html/xxx. What I want to do is redirect all requests to a domain name zzz.com which is using the same location for its files. (In other words, xxx.yyy.com and zzz.com are aliases for each other) I just want people accessing zzz.com, so if someone goes to xxx.yyy.com they should be redirected to zzz.com. Can this easily be done with a rewrite rule in an .htaccess file?

    Read the article

  • Modifying File while in use using Java

    - by Marquinio
    Hi all, I have this recurrent Java JAR program tasks that tries to modify a file every 60seconds. Problem is that if user is viewing the file than Java program will not be able to modify the file. I get the typical IOException. Anyone knows if there is a way in Java to modify a file currently in use? Or anyone knows what would be the best way to solve this problem? I was thinking of using the File canRead(), canWrite() methods to check if file is in use. If file is in use then I'm thinking of making a backup copy of data that could not be written. Then after 60 seconds add some logic to check if backup file is empty or not. If backup file is not empty then add its contents to main file. If empty then just add new data to main file. Of course, the first thing I will always do is check if file is in use. Thanks for all your ideas.

    Read the article

  • Efficient way to delete a line from a text file (C#)

    - by Valentin Vasilyev
    Hello. I need to delete a certain line from a text file. What is the most efficient way of doing this? File can be potentially large(over million records). Thank you. UPDATE: below is the code I'm currently using, but I'm not sure if it is good. internal void DeleteMarkedEntries() { string tempPath=Path.GetTempFileName(); using (var reader = new StreamReader(logPath)) { using (var writer = new StreamWriter(File.OpenWrite(tempPath))) { int counter = 0; while (!reader.EndOfStream) { if (!_deletedLines.Contains(counter)) { writer.WriteLine(reader.ReadLine()); } ++counter; } } } if (File.Exists(tempPath)) { File.Delete(logPath); File.Move(tempPath, logPath); } }

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • unix shell, redirect output but keep on stdin

    - by Mike
    I'd like to have a shell script redirect stdout of a child process in the following manner Redirect stdout to a file Display the output of the process in real time I know I could do something like #!/bin/sh ./child > file cat file But that would not display stdout in real time. For instance, if the child was #!/bin/sh echo 1 sleep 1 echo 2 The user would see "1" and "2" printed at the same time

    Read the article

  • VirtualHost problem with passenger (mod_rails)

    - by Jake
    Hi all, I'm at my wit's end here with virtual hosting. I'm trying to install redmine and it works with the webrick test server, but when I tried to use passenger (mod_rails) to host and go to the address I specified when in the virtualhost part of my apache config file nothing happens. Here is the relavent section of /etc/httpd/conf/httpd.conf where I try to set up the virtual host: <VirtualHost *:80> SetEnv RAILS_ENV production ServerName redmine.MYSITE.com:80 DocumentRoot /opt/redmine-1.0.5/public/ <Directory /opt/redmine-1.0.5/public/> Options -MultiViews Allow from all AllowOverride none </Directory> However, when I got to redmine.MYSITE.com:80 nothing happens, I just get our normal home page. I have no idea what the problem is, any help our guidance would be greatly appreciated. If you need any other information, please tell me and I'll provide it.

    Read the article

< Previous Page | 200 201 202 203 204 205 206 207 208 209 210 211  | Next Page >