Search Results

Search found 49435 results on 1978 pages for 'query string'.

Page 205/1978 | < Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >

  • Covert uiiamge into string

    - by Warrior
    I am new iphone development.Is there any possibility to covert the uiimage into string and then once again back to image. - (void)imagePickerController:(UIImagePickerController *)picker didFinishPickingImage:(UIImage *)img1 editingInfo:(NSDictionary *)editInfo { [[picker parentViewController] dismissModalViewControllerAnimated:YES]; NSData *data = UIImagePNGRepresentation(img1); NSString *str1; str1 = [[NSString alloc] initWithData:data encoding:NSASCIIStringEncoding]; MyAppAppDelegate *appDelegate = (MyAppAppDelegate *) [[UIApplication sharedApplication] delegate]; [appDelegate setCurrentLink:str1]; EmailPictureViewController *email = [[EmailPictureViewController alloc] initWithNibName:@"EmailPictureViewController" bundle:nil]; [self.navigationController pushViewController:email animated:YES]; } so i can use delegate methods to tranfer the image from one view to another view. so i should convert the string once again to image and display it in another view. In Another view - (void)viewDidLoad { MyAppAppDelegate *appDelegate =(MyAppAppDelegate *) [[UIApplication sharedApplication] delegate]; str1 = [appDelegate getCurrentLink]; NSLog(@"The String %@",str1); NSData *aData; aData = [str1 dataUsingEncoding: NSASCIIStringEncoding]; NSLog(@"The String Data %@",aData); NSLog(@"Inside Didload3"); [imgview setImage:[UIImage imageWithData:aData]]; } But this doesn't work for me.Where do i go wrong.Is there any way to solve it?.Please help me out.Thanks.

    Read the article

  • C# custom control to get internal text as string

    - by Ed Woodcock
    ok, I'm working on a custom control that can contain some javascript, and read this out of the page into a string field. This is a workaround for dynamic javascript inside an updatepanel. At the moment, I've got it working, but if I try to put a server tag inside the block: <custom:control ID="Custom" runat="server"> <%= ControlName.ClientID %> </custom:control> The compiler does not like it. I know these are generated at runtime, and so might not be compatible with what I'm doing, but does anyone have any idea how I can get that working? EDIT Error message is: Code blocks are not supported in this context EDIT 2 The control: [DataBindingHandler("System.Web.UI.Design.TextDataBindingHandler, System.Design, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b03f5f7f11d50a3a"), ControlValueProperty("Text"), DefaultProperty("Text"), ParseChildren(true, "Text"), AspNetHostingPermission(SecurityAction.LinkDemand, Level = AspNetHostingPermissionLevel.Minimal), AspNetHostingPermission(SecurityAction.InheritanceDemand, Level = AspNetHostingPermissionLevel.Minimal)] public class CustomControl : Control, ITextControl { [DefaultValue(""), Bindable(true), Localizable(true)] public string Text { get { return (string)(ViewState["Text"] ?? string.Empty); } set { ViewState["Text"] = value; } } }

    Read the article

  • Serializing and deserializing a map with key as string

    - by Grace K
    Hi! I am intending to serialize and deserialize a hashmap whose key is a string. From Josh Bloch's Effective Java, I understand the following. P.222 "For example, consider the case of a harsh table. The physical representation is a sequence of hash buckets containing key-value entries. Which bucket an entry is placed in is a function of the hash code of the key, which is not, in general guaranteed to be the same from JVM implementation to JVM implementation. In fact, it isn't even guranteed to be the same from run to run on the same JVM implementation. Therefore accepting the default serialized form for a hash table would constitute a serious bug. Serializing and deserializing the hash table could yield an object whose invariants were seriously corrupt." My questions are: 1) In general, would overriding the equals and hashcode of the key class of the map resolve this issue and the map can be correctly restored? 2) If my key is a String and the String class is already overriding the hashCode() method, would I still have problem described above. (I am seeing a bug which makes me think this is probably still a problem even though the key is String with overriding hashCode.) 3)Previously, I get around this issue by serializing an array of entries (key, value) and when deserializing I would reconstruct the map. I am wondering if there is a better approach. 4) If the answers to question 1 and 2 are that I still can't be guaranteed. Could someone explain why? If the hashCodes are the same would they go to the same buckets across JVMs? Thanks, Grace

    Read the article

  • Setting String as Image Source in C#

    - by Dan
    UPDATE: Okay I've changed my code to this: if (appSettings.Contains("image")) { Uri uri = new Uri( (string)appSettings["image"] + ".jpg", UriKind.Absolute); ImageSource imgSource = new BitmapImage(uri); myImage.Source = imgSource; } else { Uri uriDefault = new Uri("default.jpg", UriKind.Absolute); ImageSource imgSourceDefault = new BitmapImage(uriDefault); myImage.Source = imgSourceDefault; } But now I get "Invalid URI: The format of the URI could not be determined". Well I've looked up several methods to fix this in my Windows Phone 7 app but I can't seem to find anything that works. What confuses me is that I've done something just like this before with no problem, so I'm not sure why it's not working. The code causing me the problem is this: if (appSettings.Contains("image")) { myImage.Source = (string)appSettings["image"]; } else { myImage.Source = "default.jpg"; } The error I get is this "Cannot implicitly convert type 'string' to 'System.Windows.Media.ImageSource". The reason this confuses me is because I did this Twitter app tutorial: http://weblogs.asp.net/scottgu/archive/2010/03/18/building-a-windows-phone-7-twitter-application-using-silverlight.aspx , in which you bind the image source directly to a string. So what can I do to remedy this?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Cross-platform iteration of Unicode string

    - by kizzx2
    I want to iterate each character of a Unicode string, treating each surrogate pair and combining character sequence as a single unit (one grapheme). Example The text "??????" is comprised of the code points: U+0928, U+092E, U+0938, U+094D, U+0924, U+0947, of which, U+0938 and U+0947 are combining marks. static void Main(string[] args) { const string s = "??????"; Console.WriteLine(s.Length); // Ouptuts "6" var l = 0; var e = System.Globalization.StringInfo.GetTextElementEnumerator(s); while(e.MoveNext()) l++; Console.WriteLine(l); // Outputs "4" } So there we have it in .NET. We also have Win32's CharNextW() #include <Windows.h> #include <iostream> #include <string> int main() { const wchar_t * s = L"??????"; std::cout << std::wstring(s).length() << std::endl; // Gives "6" int l = 0; while(CharNextW(s) != s) { s = CharNextW(s); ++l; } std::cout << l << std::endl; // Gives "4" return 0; } Question Both ways I know of are specific to Microsoft. Are there portable ways to do it? I heard about ICU but I couldn't find something related quickly (UnicodeString(s).length() still gives 6). Would be an acceptable answer to point to the related function/module in ICU. C++ doesn't have a notion of Unicode, so a lightweight cross-platform library for dealing with these issues would make an acceptable answer.

    Read the article

  • Setting Nullable Integer to String Containing Nothing yields 0

    - by Brian MacKay
    I've been pulling my hair out over some unexpected behavior from nullable integers. If I set an Integer to Nothing, it becomes Nothing as expected. If I set an Integer? to a String that is Nothing, it becomes 0! Of course I get this whether I explicitly cast the String to Integer? or not. I realize I could work around this pretty easily but I want to know what I'm missing. Dim NullString As String = Nothing Dim NullableInt As Integer? = CType(NullString, Integer?) 'Expected NullableInt to be Nothing, but it's 0! NullableInt = Nothing 'This works -- NullableInt now contains Nothing. How is this EDIT: Previously I had my code up here so without the explicit conversion to 'Integer?' and everyone seemed to be fixated on that. I want to be clear that this is not an issue that would have been caught by Option Strict On -- check out the accepted answer. This is a quirk of the string-to-integer conversion rules which predate nullable types, but still impact them.

    Read the article

  • Instrumenting a string

    - by George Polevoy
    Somewhere in C++ era i have crafted a library, which enabled string representation of the computation history. Having a math expression like: TScalar Compute(TScalar a, TScalar b, TScalar c) { return ( a + b ) * c; } I could render it's string representation: r = Compute(VerbalScalar("a", 1), VerbalScalar("b", 2), VerbalScalar("c", 3)); Assert.AreEqual(9, r.Value); Assert.AreEqual("(a+b)*c==(1+2)*3", r.History ); C++ operator overloading allowed for substitution of a simple type with a complex self-tracking entity with an internal tree representation of everything happening with the objects. Now i would like to have the same possibility for NET strings, only instead of variable names i would like to see a stack traces of all the places in code which affected a string. And i want it to work with existing code, and existing compiled assemblies. Also i want all this to hook into visual studio debugger, so i could set a breakpoint, and see everything that happened with a string. Which technology would allow this kind of things? I know it sound like an utopia, but I think visual studio code coverage tools actually do the same kind of job while instrumenting the assemblies.

    Read the article

  • "Function object is unsubscriptable" in basic integer to string mapping function

    - by IanWhalen
    I'm trying to write a function to return the word string of any number less than 1000. Everytime I run my code at the interactive prompt it appears to work without issue but when I try to import wordify and run it with a test number higher than 20 it fails as "TypeError: 'function' object is unsubscriptable". Based on the error message, it seems the issue is when it tries to index numString (for example trying to extract the number 4 out of the test case of n = 24) and the compiler thinks numString is a function instead of a string. since the first line of the function is me defining numString as a string of the variable n, I'm not really sure why that is. Any help in getting around this error, or even just help in explaining why I'm seeing it, would be awesome. def wordify(n): # Convert n to a string to parse out ones, tens and hundreds later. numString = str(n) # N less than 20 is hard-coded. if n < 21: return numToWordMap(n) # N between 21 and 99 parses ones and tens then concatenates. elif n < 100: onesNum = numString[-1] ones = numToWordMap(int(onesNum)) tensNum = numString[-2] tens = numToWordMap(int(tensNum)*10) return tens+ones else: # TODO pass def numToWordMap(num): mapping = { 0:"", 1:"one", 2:"two", 3:"three", 4:"four", 5:"five", 6:"six", 7:"seven", 8:"eight", 9:"nine", 10:"ten", 11:"eleven", 12:"twelve", 13:"thirteen", 14:"fourteen", 15:"fifteen", 16:"sixteen", 17:"seventeen", 18:"eighteen", 19:"nineteen", 20:"twenty", 30:"thirty", 40:"fourty", 50:"fifty", 60:"sixty", 70:"seventy", 80:"eighty", 90:"ninety", 100:"onehundred", 200:"twohundred", 300:"threehundred", 400:"fourhundred", 500:"fivehundred", 600:"sixhundred", 700:"sevenhundred", 800:"eighthundred", 900:"ninehundred", } return mapping[num] if __name__ == '__main__': pass

    Read the article

  • Java - Counting how many characters show up in another string

    - by Vu Châu
    I am comparing two strings, in Java, to see how many characters from the first string show up in the second string. The following is some expectations: matchingChars("AC", "BA") ? 1 matchingChars("ABBA", "B") ? 2 matchingChars("B", "ABBA") ? 1 My approach is as follows: public int matchingChars(String str1, String str2) { int count = 0; for (int a = 0; a < str1.length(); a++) { for (int b = 0; b < str2.length(); b++) { char str1Char = str1.charAt(a); char str2Char = str2.charAt(b); if (str1Char == str2Char) { count++; str1 = str1.replace(str1Char, '0'); } } } return count; } I know my approach is not the best, but I think it should do it. However, for matchingChars("ABBA", "B") ? 2 My code yields "1" instead of "2". Does anyone have any suggestion or advice? Thank you very much.

    Read the article

  • Getting the full-name of the current user, returns an empty string (C#/C++)

    - by Nir
    I try to get the full-name of the current log-in user (Fullname, not username). The following code C#, C++ works fine but on XP computers not connected to the Net, I get empty string as result if I run it ~20 minutes after login (It runs OK whithin the first ~20 minutes after login) A Win32 API (GetUserNameEx) is used rather that PrincipalContext since it PrincipalContext may takes up to 15 seconds when working offline. Any Help why am I getting an empty string as result though a user full name is specified??? - C# Code public static string CurrentUserFullName { get { const int EXTENDED_NAME_FORMAT_NAME_DISPLAY = 3; StringBuilder userName = new StringBuilder(256); uint length = (uint) userName.Capacity; string ret; if (GetUserNameEx(EXTENDED_NAME_FORMAT_NAME_DISPLAY, userName, ref length)) { ret = userName.ToString(); } else { int errorCode = Marshal.GetLastWin32Error(); throw new Win32Exception("GetUserNameEx Failed. Error code - " + errorCode); } return ret; } } [DllImport("Secur32.dll", CharSet = CharSet.Auto, SetLastError = true)] private static extern bool GetUserNameEx(int nameFormat, StringBuilder lpNameBuffer, ref uint lpnSize); - Code in C++ #include "stdafx.h" #include <windows.h> #define SECURITY_WIN32 #include <Security.h> #pragma comment( lib, "Secur32.lib" ) int _tmain(int argc, _TCHAR* argv[]) { char szName[100]; ULONG nChars = sizeof( szName ); if ( GetUserNameEx( NameDisplay, szName, &nChars ) ) { printf( "Name: %s\n", szName); } else { printf( "Failed to GetUserNameEx\n" ); printf( "%d\n", GetLastError() ); } return 0; }

    Read the article

  • How to update a string property of an sqlite database item

    - by Thomas Joos
    hi all, I'm trying to write an application that checks if there is an active internet connection. If so it reads an xml and checks every 'lastupdated' item ( php generated string ). It compares it to the database items and if there is a new value, this particular item needs to be updated. My code seems to work ( compiles, no error messages, no failures, .. ) but I notice that the particular property does not change, it becomese (null). When I output the binded string value it returns the correct string value I want to update into the db.. Any idea what I'm doing wrong? const char *sql = "update myTable Set last_updated=? Where node_id =?"; sqlite3_stmt *statement; // Preparing a statement compiles the SQL query into a byte-code program in the SQLite library. // The third parameter is either the length of the SQL string or -1 to read up to the first null terminator. if (sqlite3_prepare_v2(database, sql, -1, &statement, NULL) == SQLITE_OK){ NSLog(@"last updated item: %@", [d lastupdated]); sqlite3_bind_text(statement, 1, [d lastupdated],-1,SQLITE_TRANSIENT); sqlite3_bind_int (statement, 2, [d node_id]); }else { NSLog(@"SQLite statement error!"); } if(SQLITE_DONE != sqlite3_step(statement)){ NSAssert1(0, @"Error while updating. '%s'", sqlite3_errmsg(database)); }else { NSLog(@"SQLite Update done!"); }

    Read the article

  • SQL Server 2008 Prior String Extract

    - by Saidur Rahman
    I have strings like the ones below in a SQL column. I want to extract them as a Gigabyte amount in aggregate. Example: Original Column ---------> Expected Output from a TSQL function ------------------------------------------- $15 / 1GB 24m + Intern 120MB ----------> 1.12 GB $19.95 / 500MB + $49.95 / 9GB Blackberry -----> 9.5GB $174.95 Blackberry 24GB + $10 / 1GB Datapack ----> 25GB $79 / 6GB --> 6GB Null --> Null $20 Plan --> 0GB Note: for our purpose, 1000MB = 1 GB (not 1024). The pattern is numbers followed by GB/MB, usually they are combined like 1GB (without any space but may sometimes may contain a space, it is not particularly important if hard to implement for this exception). Sometimes there are up to three or four instances of GB/MB occurring in the same string which are usually separated by a + sign (see row 2 and 3 of my example above). I have seen how we extract the dollar values in one of the answers where numbers were followed by $ or extract all integers in a string but I don't want to extract the dollar values or all the integers in a string. I just want the sum of GB/MB in the string.

    Read the article

  • String Index Out Of Bound Exception error

    - by Fd Fehfhd
    Im not really sure why a am getting this error. But here is my code it is meant to test palindromes disregarding punctuation. So here is my code import java.util.Scanner; public class PalindromeTester { public static void main(String [] args) { Scanner kb = new Scanner(System.in); String txt = ""; int left; int right; int cntr = 0; do { System.out.println("Enter a word, phrase, or sentence (blank line to stop):"); txt = kb.nextLine(); txt = txt.toLowerCase(); char yP; String noP = ""; for (int i = 0; i < txt.length(); i++) { yP = txt.charAt(i); if (Character.isLetterOrDigit(txt.charAt(yP))) { noP += yP; } } txt = noP; left = 0; right = txt.length() -1; while (txt.charAt(left) == txt.charAt(right) && right > left) { left++; right--; } if (left > right) { System.out.println("Palindrome"); cntr++; } else { System.out.println("Not a palindrome"); } } while (!txt.equals("")); System.out.println("You found " + cntr + " palindromes. Thank you for using palindromeTester."); } } And if i test it and then i put enter so it will tell me how many palindromes you found the error i am getting is javav.lang.StringIndexOutOfBoundException : String index out of range 0 at PalindromeTester.main(PalindromeTester.java:38) and line 28 is while (txt.charAt(left) == txt.charAt(right) && right > left) Thanks for the help in advance

    Read the article

  • Passing.getText() String to another class

    - by DanMc
    I'm currently working on a first year university project and I have a problem, although I doubt it's a very complicated one, but I've been searching and I just can't find a suitable answer to it. The problem concerns two classes. A gui class (class1) and another class (class2). I have a JTextField in class1 and am trying to pass through the .getText() value to class2 and store it in a String type variable. The current code I'm trying to achieve this with is the following: (Class1) private JTextField textField = new JTextField("Something"); ... public String getTextFieldString() { return textField.getText(); } (Class2) private c1 Class1 = new Class1(); private String s = new String(); ... s = c1.getTextFieldString(); I'm pretty new to coding, I've read that maybe I need to pass through an argument somewhere and I assume that's because textField is not static in itself, it changes when somebody enters a new value. (sorry for stating the obvious there.) Anyway, help is appreciated. Thanks a lot!

    Read the article

  • Fast find object by string property

    - by Andrew Kalashnikov
    Hello, colleagues. I've got task to fast find object by its string property. Object: class DicDomain { public virtual string Id{ get; set; } public virtual string Name { get; set; } } For storing my object I use List[T] dictionary where T is DicDomain for now . I've got 5-10 such lists, which contain about 500-20000 at each one. Task is find objects by its Name. I use next code now: List<T> entities = dictionary.FindAll(s => s.Name.Equals(word, StringComparison.OrdinalIgnoreCase)); I've got some questions: Is my search speed optimal. I think now. Data structure. It List good for this task. What about hashtable,sorted... Method Find. May be i should use string intern?? I haven't much exp at these tasks. Can u give me good advice for increase perfomance. Thanks

    Read the article

  • Unable to parse variable length string separated by delimiter

    - by Technext
    Hi, I have a problem with parsing a string, which consists only of directory path. For ex. My input string is Abc\Program Files\sample\ My output should be Abc//Program Files//sample The script should work for input path of any length i.e., it can contain any no. of subdirectories. (For ex., abc\temp\sample\folder\joe) I have looked for help in many links but to no avail. Looks like FOR command extracts only one whole line or a string (when we use ‘token’ keyword in FOR syntax) but my problem is that I am not aware of the input path length and hence, the no. of tokens. My idea was to use \ as a delimiter and then extract each word before and after it (), and put the words to an output file along with // till we reach the end of the string. I tried implementing the following but it did not work: @echo off FOR /F "delims=\" %%x in (orig.txt) do ( IF NOT %%x == "" echo.%%x//output.txt ) The file orig.txt contains only one line i.e, Abc\Program Files\sample\ The output that I get contains only: Abc// The above output contains blank spaces as well after ‘Abc//’ My desired output should be: Abc//program Files//sample// Can anyone please help me with this? Regards, Technext

    Read the article

  • NHibernate with string primary key and relationships

    - by John_
    I've have just been stumped with this problem for an hour and I annoyingly found the problem eventually. THE CIRCUMSTANCES I have a table which users a string as a primary key, this table has various many to one and many to many relationships all off this primary key. When searching for multiple items from the table all relationships were brought back. However whenever I tried to get the object by the primary key (string) it was not bringing back any relationships, they were always set to 0. THE PARTIAL SOLUTION So I looked into my logs to see what the SQL was doing and that was returning the correct results. So I tried various things in all sorts of random ways and eventually worked out it was. The case of the string being passed into the get method was not EXACTLY the same case as it was in the database, so when it tried to match up the relationship items with the main entity it was finding nothing (Or at least NHIbernate wasn't because as I stated above the SQL was actually returning the correct results) THE REAL SOLUTION Has anyone else come across this? If so how do you tell NHibernate to ignore case when matching SQL results to the entity? It is silly because it worked perfectly well before now all of a sudden it has started to pay attention to the case of the string.

    Read the article

  • Working with a string as an array of characters

    - by Malfunction
    I'm having some trouble with a string represented as an array of characters. What I'd like to do, as I would do in java, is the following: while (i < chars.length) { char ch = chars[i]; if ((WORD_CHARS.indexOf(ch) >= 0) == punctuation) { String token = buffer.toString(); if (token.length() > 0) { parts.add(token); } buffer = new StringBuffer(); } buffer.append(ch); i++; } What I'm doing is something like this: while(i < strlen(chars)) { char ch = chars[i]; if(([WORD_CHARS rangeOfString:ch] >= 0) == punctuation) { NSString *token = buffer.toString(); if([token length] > 0) { [parts addObject:token]; } buffer = [NSMutableString string]; } [buffer append(ch)]; i++; } I'm not sure how I'm supposed to convert String token = buffer.toString(); to objective c, where buffer is an NSMutableString. Also, how do I check this if condition in objective c? if ((WORD_CHARS.indexOf(ch) >= 0) == punctuation) WORD_CHARS is an NSString. I'm also having trouble with appending ch to buffer. Any help is greatly appreciated.

    Read the article

  • Iterating over a String to check for a number and printing out the String value if it doesn't have a number

    - by wheelerlc64
    I have set up my function for checking for a number in a String, and printing out that String if it has no numbers, and putting up an error message if it does. Here is my code: public class NumberFunction { public boolean containsNbr(String str) { boolean containsNbr = false; if(str != null && !str.isEmpty()) { for(char c : str.toCharArray()) { if(containsNbr = Character.isDigit(c)) { System.out.println("Can't contain numbers in the word."); break; } else { System.out.println(str); } } } return containsNbr; } } import com.imports.validationexample.function.NumberFunction; public class Main { public static void main(String[] args) { NumberFunction nf = new NumberFunction(); System.out.println(nf.containsNbr("bill4")); } } I am trying to get it to print out the result to the console, but the result keeps printing multiple times and prints the boolean value, which I do not want, something like this: bill4 bill4 bill4 bill4 Can't contain numbers in the word. true Why is this happening? I've tried casting but that hasn't worked out either. Any help would be much appreciated.

    Read the article

  • LinqtoSql Pre-compile Query problem with Count() on a group by

    - by Joe Pitz
    Have a LinqtoSql query that I now want to precompile. var unorderedc = from insp in sq.Inspections where insp.TestTimeStamp > dStartTime && insp.TestTimeStamp < dEndTime && insp.Model == "EP" && insp.TestResults != "P" group insp by new { insp.TestResults, insp.FailStep } into grp select new { FailedCount = (grp.Key.TestResults == "F" ? grp.Count() : 0), CancelCount = (grp.Key.TestResults == "C" ? grp.Count() : 0), grp.Key.TestResults, grp.Key.FailStep, PercentFailed = Convert.ToDecimal(1.0 * grp.Count() / tcount * 100) }; I have created this delegate: public static readonly Funct<SQLDataDataContext, int, string, string, DateTime, DateTime, IQueryable<CalcFailedTestResult>> GetInspData = CompiledQuery.Compile((SQLDataDataContext sq, int tcount, string strModel, string strTest, DateTime dStartTime, DateTime dEndTime, IQueryable<CalcFailedTestResult> CalcFailed) => from insp in sq.Inspections where insp.TestTimeStamp > dStartTime && insp.TestTimeStamp < dEndTime && insp.Model == strModel && insp.TestResults != strTest group insp by new { insp.TestResults, insp.FailStep } into grp select new { FailedCount = (grp.Key.TestResults == "F" ? grp.Count() : 0), CancelCount = (grp.Key.TestResults == "C" ? grp.Count() : 0), grp.Key.TestResults, grp.Key.FailStep, PercentFailed = Convert.ToDecimal(1.0 * grp.Count() / tcount * 100) }); The syntax error is on the CompileQuery.Compile() statement It appears to be related to the use of the select new {} syntax. In other pre-compiled queries I have written I have had to just use the select projection by it self. In this case I need to perform the grp.count() and the immediate if logic. I have searched SO and other references but cannot find the answer.

    Read the article

  • Help with string equality in Java

    - by annayena
    The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static or global variables. Also it's prohibited to use the method equals in the String class. Can use local variables and method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" ---> true 1: TheExamIsEasy; 2: "Th*mIsEasy*" ---> true 1: TheExamIsEasy; 2: "*" ---> true 1: TheExamIsEasy; 2: "TheExamIsEasy" ---> true 1: TheExamIsEasy; 2: "The*IsHard" ---> FALSE I am stucked on this question for many hours now! I need the solution in Java please kindly help me.

    Read the article

  • Taking item from string array that *might* be there

    - by AndyC
    Hi all, I have a string array, and it may contain an element with the text "mytext" within the string. eg: mystringarray { [0] => "hello world"; [1] => "some of mytext"; } I also have an array that doesn't have the mytext text in it. mystringarray { [0] => "hello world"; [1] => "some of notmy"; } My problem is when I use: string mytextdata = mystringarray.Single<string>(t => t.Contains("mytext")).ToString(); I get an exception for the second array as it can't find an element that matches the expression. Is there a quick way I can edit this one line to not throw an exception if it finds nothing, and instead just ignore? I have a lot of these lines and I don't want to have to wrap each in an if statement. Apologies if question isn't clear.

    Read the article

  • Something for the weekend - Whats the most complex query?

    - by simonsabin
    Whenever I teach about SQL Server performance tuning I try can get across the message that there is no such thing as a table. Does that sound odd, well it isn't, trust me. Rather than tables you need to consider structures. You have 1. Heaps 2. Indexes (b-trees) Some people split indexes in two, clustered and non-clustered, this I feel confuses the situation as people associate clustered indexes with sorting, but don't associate non clustered indexes with sorting, this is wrong. Clustered and non-clustered indexes are the same b-tree structure(and even more so with SQL 2005) with the leaf pages sorted in a linked list according to the keys of the index.. The difference is that non clustered indexes include in their structure either, the clustered key(s), or the row identifier for the row in the table (see http://sqlblog.com/blogs/kalen_delaney/archive/2008/03/16/nonclustered-index-keys.aspx for more details). Beyond that they are the same, they have key columns which are stored on the root and intermediary pages, and included columns which are on the leaf level. The reason this is important is that this is how the optimiser sees the world, this means it can use any of these structures to resolve your query. Even if your query only accesses one table, the optimiser can access multiple structures to get your results. One commonly sees this with a non-clustered index scan and then a key lookup (clustered index seek), but importantly it's not restricted to just using one non-clustered index and the clustered index or heap, and that's the challenge for the weekend. So the challenge for the weekend is to produce the most complex single table query. For those clever bods amongst you that are thinking, great I will just use lots of xquery functions, sorry these are the rules. 1. You have to use a table from AdventureWorks (2005 or 2008) 2. You can add whatever indexes you like, but you must document these 3. You cannot use XQuery, Spatial, HierarchyId, Full Text or any open rowset function. 4. You can only reference your table once, i..e a FROM clause with ONE table and no JOINs 5. No Sub queries. The aim of this is to show how the optimiser can use multiple structures to build the results of a query and to also highlight why the optimiser is doing that. How many structures can you get the optimiser to use? As an example create these two indexes on AdventureWorks2008 create index IX_Person_Person on Person.Person (lastName, FirstName,NameStyle,PersonType) create index IX_Person_Person on Person.Person(BusinessentityId,ModifiedDate)with drop_existing    select lastName, ModifiedDate   from Person.Person  where LastName = 'Smith' You will see that the optimiser has decided to not access the underlying clustered index of the table but to use two indexes above to resolve the query. This highlights how the optimiser considers all storage structures, clustered indexes, non clustered indexes and heaps when trying to resolve a query. So are you up to the challenge for the weekend to produce the most complex single table query? The prize is a pdf version of a popular SQL Server book, or a physical book if you live in the UK.  

    Read the article

  • Escaping an equals sign in DOS batch string replacement command

    - by Alastair
    Hi, I need to replace some text in a JNLP file using a DOS batch file to tune it for the local machine. The problem is that the search pattern contains an equals sign which is messing up the string replacement in the batch file. I want to replace the line, <j2se version="1.5" initial-heap-size="100M" max-heap-size="100M"/> with specific settings for the initial and max heap sizes. For example at the moment I have, for /f "tokens=* delims=" %%a in (%filePath%agility.jnlp) do ( set str=%%a set str=!str:initial-heap-size="100M"=initial-heap-size="%min%M"! echo !str!>>%filePath%new.jnlp) but the = in the search pattern is being read as part of the replacement command. How do I escape the equals sign so it is processed as text?

    Read the article

< Previous Page | 201 202 203 204 205 206 207 208 209 210 211 212  | Next Page >