Search Results

Search found 7570 results on 303 pages for 'doug hope'.

Page 208/303 | < Previous Page | 204 205 206 207 208 209 210 211 212 213 214 215  | Next Page >

• Keymap issues with NX from Mac OS X Lion

  - by Andy

  I tried to answer the question from Mark: Keymap issues with NX from Mac OS X Lion to Ubuntu However, it is locked so I figured I would post a new question / answer. I have been trying to answer this for a few days now because I have no issues when connecting through NX Client (technically OpenNX) to FreeNX server from an iMac (with Lion), but if I try to connect with a Macbook Pro I get horrible keyboard binding issues. The fix that is working for me is to go into: ~/.nx/config/HOST.nxs and change: <option key="Current keyboard" value="false"/> <option key="Custom keyboard layout" value="empty"/> <option key="Grab keyboard" value="false"/> I have tried this on three NX Servers and all are fixed. Hope it helps or gets you closer. Always check in the ~/.nx/temp/ for the sshlog and see if --keyboard="empty/empty" instead of "pc105/en" because the Mac is really pc104. 9:05:35: startsession --session="HOST" --type="unix-gnome" --cache="8M" --images="32M" --link="adsl" --geometry="2556\ x1396" --screeninfo="2560x1440x32+render" --keyboard="empty/empty" --backingstore="1" --encryption="1" --composite="1" --\ shmem="1" --shpix="1" --streaming="1" --samba="0" --cups="0" --nodelay="1" --defer="0" --client="macosx" --media="0" --st\ rict="0" --aux="1"

  Read the article

• django shopping cart as a beginner

  - by Jacques Knie

  Hi, i'm quite new to django and trying to add a shopping cart to a simple webshop. What I need is a simple cart that can be filled and presents its content, which is then sent to the vendor via email. So Satchmo might be too big for this task. Therefore i chose django-cart (http://code.google.com/p/django-cart/) which causes some problems now. 1. Is django-cart the right thing? Or are there any better approaches to this task? 2. As I am a beginner even django-cart makes me struggle. I used the view and the template of the django-cart-website, but writing a form that can be used to add products to the cart took me hours. I probably need help in understanding the general layout of a shopping cart and its integration into a website. 3. Two more specific questions: Is it possible to dynamically populate a formfield in a template (e.g. with {{ object.id }})? Is django-cart able to change (update) the contents of a cart? I hope it's not too many questions at once. Thanks in advance Jacques

  Read the article

• Using a .MDF SQL Server Database with ASP.NET Versus Using SQL Server

  - by Maxim Z.

  I'm currently writing a website in ASP.NET MVC, and my database (which doesn't have any data in it yet, it only has the correct tables) uses SQL Server 2008, which I have installed on my development machine. I connect to the database out of my application by using the Server Explorer, followed by LINQ to SQL mapping. Once I finish developing the site, I will move it over to my hosting service, which is a virtual hosting plan. I'm concerned about whether using the SQL Server setup that is currently working on my development machine will be hard to do on the production server, as I'll have to import all the database tables through the hosting control panel. I've noticed that it is possible to create a SQL Server database from inside Visual Studio. It is then stored in the App_Data directory. My questions are the following: Does it make sense to move my SQL Server DB out of SQL Server and into the App_Data directory as an .mdf file? If so, how can I move it? I believe this is called the Detach command, is it not? Are there any performance/security issues that can occur with a .mdf file like this? Would my intended setup work OK with a typical virtual hosting plan? I'm hoping that the .mdf database won't count against the limited number of SQL Server databases that can be created with my plan. I hope this question isn't too broad. Thanks in advance! Note: I'm just starting out with ASP.NET MVC and all this, so I might be completely misunderstanding how this is supposed to work.

  Read the article

• Android Application is unexpectedly stopped error when button is clicked

  - by user1794499

  Hi there I'm totally new to Android development and I'm working in my android application my application includes a forum where users can post, comment and have their discussion there.... So I'm working in the interface but I get error when I click on the button I directs me to the signup page can somebody please help me with this error this is the code of the mainuserinterface.java for the mainuserinterface.xml file where the button resides. and the signupform.class is the java file for the next activity triggered when the button is clicked the error I receive is the application is unexpectedly stopped.. Hope I make it clear for you guys package com.mohammed.watzIslam; import android.app.Activity; import android.content.Intent; import android.os.Bundle; import android.view.View; import android.widget.Button; public class mainuserinterface extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { // TODO Auto-generated method stub super.onCreate(savedInstanceState); setContentView(R.layout.mainuserinterface); // this is the button where I receive errors when I click Button forum = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent, 0); } }); //these two button still not directing to any next activity yet Button button1 = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent1 = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent1, 0); } }); Button button2 = (Button) findViewById(R.id.next); forum.setOnClickListener(new View.OnClickListener() { public void onClick(View view){ Intent myIntent2 = new Intent (view.getContext(), signupform.class); startActivityForResult (myIntent2, 0); } }); } }

  Read the article

• How to make Processes Run Parallel in Erlang?

  - by Ankit S

  Hello, startTrains() -> TotalDist = 100, Trains = [trainA,trainB ], PID = spawn(fun() -> train(1,length(Trains)) end), [ PID ! {self(),TrainData,TotalDist} || TrainData <- Trains], receive {_From, Mesg} -> error_logger:info_msg("~n Mesg ~p ~n",[Mesg]) after 10500 -> refresh end. so, I created Two Processes named trainA, trainB. I want to increment these process by 5 till it gets 100. I made different processes to make each of the train (process) increments its position parallely. But I was surprised to get the output sequentially i.e process trainA ends then process trainB starts. But I want to increment themselves at simultaneously. I want to run processes like this trainA 10 trainB 0 trainA 15 trainB 5 .... trainA 100 trainB 100 but I m getting trainA 0 .... trainA 90 trainA 95 trainA 100 trainA ends trainB 0 trainB 5 trainB 10 ..... trainB 100 How to make the processes run parallel/simultaneously? Hope you get my Q's. Please help me.

  Read the article

• How to Verify Signature, Loading PUBLIC KEY From PEM file?

  - by bbirtle

  I'm posting this in the hope it saves somebody else the hours I lost on this really stupid problem involving converting formats of public keys. If anybody sees a simpler solution or a problem, please let me know! The eCommerce system I'm using sends me some data along with a signature. They also give me their public key in .pem format. The .pem file looks like this: -----BEGIN PUBLIC KEY----- MIGfMA0GCSqGSIb3DQEBAQUAA4GNADCBiQKBgQDe+hkicNP7ROHUssGNtHwiT2Ew HFrSk/qwrcq8v5metRtTTFPE/nmzSkRnTs3GMpi57rBdxBBJW5W9cpNyGUh0jNXc VrOSClpD5Ri2hER/GcNrxVRP7RlWOqB1C03q4QYmwjHZ+zlM4OUhCCAtSWflB4wC Ka1g88CjFwRw/PB9kwIDAQAB -----END PUBLIC KEY----- Here's the magic code to turn the above into an "RSACryptoServiceProvider" which is capable of verifying the signature. Uses the BouncyCastle library, since .NET apparently (and appallingly cannot do it without some major headaches involving certificate files): RSACryptoServiceProvider thingee; using (var reader = File.OpenText(@"c:\pemfile.pem")) { var x = new PemReader(reader); var y = (RsaKeyParameters)x.ReadObject(); thingee = (RSACryptoServiceProvider)RSACryptoServiceProvider.Create(); var pa = new RSAParameters(); pa.Modulus = y.Modulus.ToByteArray(); pa.Exponent = y.Exponent.ToByteArray(); thingee.ImportParameters(pa); } And then the code to actually verify the signature: var signature = ... //reads from the packet sent by the eCommerce system var data = ... //reads from the packet sent by the eCommerce system var sha = new SHA1CryptoServiceProvider(); byte[] hash = sha.ComputeHash(Encoding.ASCII.GetBytes(data)); byte[] bSignature = Convert.FromBase64String(signature); ///Verify signature, FINALLY: var hasValidSig = thingee.VerifyHash(hash, CryptoConfig.MapNameToOID("SHA1"), bSignature);

  Read the article

• Differences between iPhone/iPod Simulator and Devices

  - by Allisone

  Hi, since I started iPhone/iPod Development I have come across some differences between how the simulator and how real device react. Maybe I will come across some other differences I will have to figure out as well, maybe other people haven't met these problems here (YET) and can profit from the knowledge, and maybe you know some problems/differences that you would have been happy to know about earlier before you spent several hours or days figuring out what the heck is going on. So here is what I came across. Simulator is not case sensitive, Devices are case sensitive. This means a default.png or Icon.png will work in simulator, but not on a device where they must be named Default.png and icon.png (if it's still not working read this answer) Simulator has different codecs to play audio and video If you use f.e. MPMoviePlayerController you might play certain video on the simulator while on the device it won't work (use Handbrake-presets-iPhone & iPod Touch to create playable videos for Simulator and Device). If you play audio with AudioServicesPlaySystemSound(&soundID) you might here the sound on simulator but not an a device. (use Audacity to open your soundfile, export as wav and run afconvert -f caff -d LEI16@44100 -c 1 audacity.wav output.caf in terminal) Also there is this flickering on second run problem which can be resolved with an playerViewCtrl.initialPlaybackTime = -1.0; either on the end of playing or before each beginning. Simulator is mostly much faster cause it doesn't simulate the hardware but uses Mac resources, therefore f.e. sio2 Apps (OpenGL,OpenAL,etc. framework) run much better on simulator, well everything that uses more resources will run visibly better in simulator than on device. I hope we can add some more to this.

  Read the article

• Using Java PDFBox library to write Russian PDF

  - by Brad

  Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

  Read the article

• AS3 microphone recording/saving works, in-flash PCM playback double speed

  - by Lowgain

  I have a working mic recording script in AS3 which I have been able to successfully use to save .wav files to a server through AMF. These files playback fine in any audio player with no weird effects. For reference, here is what I am doing to capture the mic's ByteArray: (within a class called AudioRecorder) public function startRecording():void { _rawData = new ByteArray(); _microphone.addEventListener(SampleDataEvent.SAMPLE_DATA, _samplesCaptured, false, 0, true); } private function _samplesCaptured(e:SampleDataEvent):void { _rawData.writeBytes(e.data); } This works with no problems. After the recording is complete I can take the _rawData variable and run it through a WavWriter class, etc. However, if I run this same ByteArray as a sound using the following code which I adapted from the adobe cookbook: (within a class called WavPlayer) public function playSound(data:ByteArray):void { _wavData = data; _wavData.position = 0; _sound.addEventListener(SampleDataEvent.SAMPLE_DATA, _playSoundHandler); _channel = _sound.play(); _channel.addEventListener(Event.SOUND_COMPLETE, _onPlaybackComplete, false, 0, true); } private function _playSoundHandler(e:SampleDataEvent):void { if(_wavData.bytesAvailable <= 0) return; for(var i:int = 0; i < 8192; i++) { var sample:Number = 0; if(_wavData.bytesAvailable > 0) sample = _wavData.readFloat(); e.data.writeFloat(sample); } } The audio file plays at double speed! I checked recording bitrates and such and am pretty sure those are all correct, and I tried changing the buffer size and whatever other numbers I could think of. Could it be a mono vs stereo thing? Hope I was clear enough here, thanks!

  Read the article

• Ideal Multi-Developer Lamp Stack?

  - by devians

  I would like to build an 'ideal' lamp development stack. Dual Server (Virtualised, ESX) Apache / PHP on one, Databases (MySQL, PgSQL, etc) on the other. User (Developer) Manageable mini environments, or instance. Each developer instance shares the top level config (available modules and default config etc) A developer should have control over their apache and php version for each project. A developer might be able to change minor settings, ie magicquotes on for legacy code. Each project would determine its database provider in its code The idea is that it is one administrate-able server that I can control, and provide globally configured things like APC, Memcached, XDebug etc. Then by moving into subsets for each project, i can allow my users to quickly control their environments for various projects. Essentially I'm proposing the typical system of a developer running their own stack on their own machine, but centralised. In this way I'd hope to avoid problems like Cross OS code problems, database inconsistencies, slightly different installs producing bugs etc. I'm happy to manage this in custom builds from source, but if at all possible it would be great to have a large portion of it managed with some sort of package management. We typically use CentOS, so yum? Has anyone ever built anything like this before? Is there something turnkey that is similar to what I have described? Are there any useful guides I should be reading in order to build something like this?

  Read the article

• How do I 'addChild' an DisplayObject3d from another class? (Papervision3d)

  - by Sandor

  Hi All Im kind of new in the whole papervision scene. For a school assignment I'm making a panorama version of my own room using a cube with 6 pictures in it. It created the panorama, it works great. But now I want to add clickable objects in it. One of the requirements is that my code is OOP focused. So that's what I am trying right now. Currently I got two classes - Main.as (Here i make the panorama cube as the room) - photoWall.as (Here I want to create my first clickable object) Now my problem is: I want to addChild a clickable object from photoWall.as to my panorama room. But he doesn't show it? I think it has something to do with the scenes. I use a new scene in Main.as and in photoWall.as. No errors or warnings are reported This is the piece in photoWall.as were I want to addChild my object (photoList): private function portret():void { //defining my material for the clickable portret var material : BitmapFileMaterial = new BitmapFileMaterial('images/room.jpg'); var material_list : MaterialsList = new MaterialsList( { front: material, back: material } ); // I don't know if this is nessecary? that's my problem scene = new Scene3D(); material.interactive = true; // make the clickable object as a cube var photoList : DisplayObject3D = new Cube(material_list, 1400, 1400, 1750, 1, 4, 4, 4); // positioning photoList.x = -1400; photoList.y = -280; photoList.z = 5000; //mouse event photoList.addEventListener( InteractiveScene3DEvent.OBJECT_CLICK, onPress); // this is my problem! I cannot see 'photoList' within my scene!!! scene.addChild(photoList); // trace works, so the function must be loaded. trace('function loaded'); } Hope you guys can help me out here. Would really be great! Thanks, Sandor

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• rename files with the same name

  - by snorpey

  Hi. I use the following function to rename thumbnails. For example, if I upload a file called "image.png" to an upload folder, and this folder already has a file named "image.png" in it, the new file automatically gets renamed to "image-copy-1.png". If there also is a file called "image-copy-1.png" it gets renamed to "image-copy-2.png" and so on. The following function returns the new filename. At least that's what it is supposed to do... The renaming doesn't seeem to work correctly, though. Sometimes it produces strange results, like: 1.png 1-copy-1.png 1-copy-2.png 1-copy-2-copy-1.png 1-copy-2-copy-3.png I hope you understand my problem, despite my description being somewhat complex... Can you tell me what went wrong here? (bonus question: Is regular expressions the right tool for doing this kind of stuff?) <?php function renameDuplicates($path, $file) { $fileName = pathinfo($path . $file, PATHINFO_FILENAME); $fileExtension = "." . pathinfo($path . $file, PATHINFO_EXTENSION); if(file_exists($path . $file)) { $fileCopy = $fileName . "-copy-1"; if(file_exists($path . $fileCopy . $fileExtension)) { if ($contains = preg_match_all ("/.*?(copy)(-)(\\d+)/is", $fileCopy, $matches)) { $copyIndex = $matches[3][0]; $fileName = substr($fileCopy, 0, -(strlen("-copy-" . $copyIndex))) . "-copy-" . ($copyIndex + 1); } } else { $fileName .= "-copy-1"; } } $returnValue = $fileName . $fileExtension; return $returnValue; }?>

  Read the article

• How to delete duplicate records in MySQL by retaining those fields with data in the duplicate item b

  - by NJTechGuy

  I have few thousands of records with few 100 fields in a MySQL Table. Some records are duplicates and are marked as such. Now while I can simply delete the dupes, I want to retain any other possible valuable non-null data which is not present in the original version of the record. Hope I made sense. For instance : a b c d e f key dupe -------------------- 1 d c f k l 1 x 2 g h j 1 3 i h u u 2 4 u r t 2 x From the above sample table, the desired output is : a b c d e f key dupe -------------------- 2 g c h k j 1 3 i r h u u 2 If you look at it closely, the duplicate is determined by using the key (it is the same for 2 records, so the one that has an 'x' for dupe field is the one to be deleted by retaining some of the fields from the dupe (like c, e values for key 1). Please let me know if you need more info about this puzzling problem. Thanks a tonne! p.s : If it is not possible using MySQL, a PERL/Python script sample would be awesome! Thanks!

  Read the article

• Free solution for automatic updates with a .NET/C# app?

  - by a2h

  Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

  Read the article

• Any good tutorials or resources for learning how to design a scalable and "component" based game 'fr

  - by CodeJustin.com

  In short I'm creating a 2D mmorpg and unlike my last "mmo" I started developing I want to make sure that this one will scale well and work well when I want to add new in-game features or modify existing ones. With my last attempt with an avatar chat within the first few thousand lines of code and just getting basic features added into the game I seen my code quality lowering and my ability to add new features or modify old ones was getting lower too as I added more features in. It turned into one big mess that some how ran, lol. This time I really need to buckle down and find a design that will allow me to create a game framework that will be easy to add and remove features (aka things like playing mini-games within my world or a mail system or buddy list or a new public area with interactive items). I'm thinking that maybe a component based approach MIGHT be what I'm looking for but I'm really not sure. I have read documents on mmorpg design and 2d game engine architecture but nothing really explained a way of designing a game framework that will basically let me "plug-in" new features into the main game and use the resources of the main game without changing much within my 'main game code'. Hope someone understands what I mean, any help will is appreciated.

  Read the article

• CSS absolute DIV causing other absolute DIV problems

  - by Tim

  Hello, I have implemented a chat script which requires an absolutely positioned DIV to be wrapped around the pages content. This is to ensure the chat windows stay at the bottom. The problem is that because of the absolute positioning of this main wrapper, all other absolutely positioned elements (eg. Jquery Auto-completes, datepicker's etc) now scroll up and down with the page. Here is an example of the HTML: <body> <div id="main_container"> <div id="content">Elements like Jquery Autocompletes, Datepickers with absolute positioned elements in here</div> </div> The DIV "main_container" style looks like this: #main_container { width:100%; background-color:#ffffff; /* DO NOT REMOVE THIS; or you'll have issue w/ the scrollbar, when the mouse pointer is on a white space */ overflow-x: hidden; overflow-y: scroll; height:100%; /* this will make sure that the height will extend at the bottom */ position:absolute; /* container div must be absolute, for our fixed bar to work */ } I hope there is a simple fix as the chat script is too good to get rid of. Thanks, Tim

  Read the article

• JAVASCRIPT changing on click

  - by Webby

  Hello, Id like some help changing this javascript onclick event to just load the data on page the page load... Preferably not using the body on load tag... So obviously I'd pre set the var for term inside the script term rather than the excisting on click event.. Hope that made sense <p><a id="keywordlink" href="?term=wombats">Get keywords for wombats</a></p> <script type="text/javascript" src="keywords.js"></script> <script type="text/javascript"> var x = document.getElementById('keywordlink'); if(x){ x.onclick = function(){ var term = this.href.split('=')[1]; this.innerHTML += ' (loading...)'; KEYWORDS.get(term,seed); return false; } } function seed(o){ var div = document.createElement('div'); var head = document.createElement('h2'); head.innerHTML = 'Keywords for '+o.term; div.appendChild(head); var p = document.createElement('p'); p.innerHTML = o.toplist; div.appendChild(p); var head = document.createElement('h3'); head.innerHTML = 'Details:'; div.appendChild(head); var list = document.createElement('ol'); for(var i=0,j=o.keywords.length;i<j;i++){ var li = document.createElement('li'); li.innerHTML = o.keywords[i].term + '('+o.keywords[i].amount+')'; list.appendChild(li); } div.appendChild(list); x.parentNode.replaceChild(div,x); } </script>

  Read the article

• video streaming over http in blackberry

  - by ysnky

  hi all, while i was searching video player over http, i found the article which is located at this url; http://www.blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/Stream ing_media_-_Start_to_finish.html?nodeid=2456737&ve rnum=0 i can run by adding ";deviceside=true" at the end of url. it works fine in the jde4.5 simulator. it gets 3gp videos from my local server. i tested with 580kb files and works fine. but when i get the same file from my server (not local, real server) i have problems with big files (e.g 580 kb). it plays 180kb files (but sometimes it does not play this file either) but not plays 580kb file. and also i deployed my application to my 9000 device it sometimes plays small file (180kb) but never plays big file (580kb). why it plays if it is on my local file, not play in real world? i ve stucked for days. hope you help me. and also the code at the url given below is not work, the only code i ve found is the above. blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/How_To _-_Play_video_within_a_BlackBerry_smartphone_appli cation.html?nodeid=1383173&vernum=0 btw, there is no method such as resize(long param) of CircularByteBuffer class. so i comment relavent line (buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); as shown below. public void increaseBufferCapacity(int percent) { if(percent < 0){ log(0, "FAILED! SP.setBufferCapacity() - " + percent); throw new IllegalArgumentException("Increase factor must be positive.."); } synchronized(readLock){ synchronized(connectionLock){ synchronized(userSeekLock){ synchronized(mediaIStream){ log(0, "SP.setBufferCapacity() - " + percent); //buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); this.bufferCapacity = buffer.getSize(); } } } } } thanks in advance.

  Read the article

• Python: How to execute a SQL file or command

  - by Mestika

  Hi, I have this Python script: import sys import getopt import timeit import random import os import re import ibm_db import time from string import maketrans runs=5 queries=50 file = open("results.txt", "a") for r in range(5): print "Run %s\n" % r os.system("python reads.py -r1 -pquery1.sql -q50 -sespec") file.write('END QUERY READ 01') file.close() os.system("python query_read_02.py") Everything here is working, it is creating the results.txt file, it run the os.system("python reads.py...") file and that file is doing everything it's suppose to, but the problem comes when go and run the query_read_02.py file. In this file, it should execute a SQL command or a SQL file on my database, so I can create an index and see what the performance of that input is, but how do i do it? I create the connection to the database in the reads.py file, but it's hard to create the queries in there because I doesn't keep track of which file it has reached, it just execute commands from what the parameters are. I hope I've explained myself clear enough, otherwise please let me know. I just want to execute a SQL command or file which each query_read_0x.py file. Sincerely Mestika

  Read the article

• How to import data to SAP

  - by Mehmet AVSAR

  Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

  Read the article

• Skipping one item in the column

  - by zurna

  I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

  Read the article

• Help me find an appropriate ruby/python parser generator

  - by Geo

  The first parser generator I've worked with was Parse::RecDescent, and the guides/tutorials available for it were great, but the most useful feature it has was it's debugging tools, specifically the tracing capabilities ( activated by setting $RD_TRACE to 1 ). I am looking for a parser generator that can help you debug it's rules. The thing is, it has to be written in python or in ruby, and have a verbose mode/trace mode or very helpful debugging techniques. Does anyone know such a parser generator ? EDIT: when I said debugging, I wasn't referring to debugging python or ruby. I was referring to debugging the parser generator, see what it's doing at every step, see every char it's reading, rules it's trying to match. Hope you get the point. BOUNTY EDIT: to win the bounty, please show a parser generator framework, and illustrate some of it's debugging features. I repeat, I'm not interested in pdb, but in parser's debugging framework. Also, please don't mention treetop. I'm not interested in it.

  Read the article

• How to scrape Google SERP based on copyright year?

  - by Michael Mao

  Hi all: I know there must be ways to do this sort of things. I am not pro in RoR or Python, not even an expert in PHP. So my solution tends to be quite dumb: It uses a FireFox add-on called imarcos to scrape the target urls from Google SERP, and use PHP to store info into the database. At the very core of my workaround there lies a problem: How to specifically find target urls based on their copyright year? I mean, something like "copyright 1998-2006" in the footer is to be considered a target, but my search results are not 100% accurate. I used the following url to search : http://www.google.com.au/#hl=en&q=inurl:.com.au+intext:copyright+1995..2007+--2008+--2009&start=0&cad=b&fp=6a8119b094529f00 It reads : search for pages that have .com.au in URL and a copyright range from 1995 to 2007 exclude the year of 2008 or 2009. Starting position is 0, of course the offset can be changed. I've already done a dummy list and honestly I am not pleased with the result. That's mostly because I cannot find a way to restrict search terms in the exact order as they are entered into the search url. copyright can appear in anywhere on page and doesn't necessarily before the years, that's the current story. Is there a more clear way to sort out this? Oh, almost forgot to say the client doesn't wanna spent too much in this - I cannot persuade him simply buy some cool software, unfortunately. I hope there is a way to use clever Google search operators or similar things to go around this issue. Many thanks in advance!

  Read the article

• Should the entity framework + self tracking entities be saving me time

  - by sipwiz

  I've been using the entity framework in combination with the self tracking entity code generation templates for my latest silverlight to WCF application. It's the first time I've used the entity framework in a real project and my hope was that I would save myself a lot of time and effort by being able to automatically update the whole data access layer of my project when my database schema changed. Happily I've found that to be the case, updating my database schema by adding a new table, changing column names, adding new columns etc. etc. can be propagated to my business object classes by using the update from database option on the entity framework model. Where I'm hurting is the CRUD operations within my WCF service in response to actions on my Silverlight client. I use the same self tracking entity framework business objects in my Silverlight app but I find I'm continually having to fight against problems such as foreign key associations not being handled correctly when updating an object or the change tracker getting confused about the state of an object at the Silverlight end and the data access operation within the WCF layer throwing a wobbly. It's got to a point where I have now spent more time dealing with this quirks than I have on my previous project where I used Linq-to-SQL as the starting point for rolling my own business objects. Is it just me being hopeless or is the self tracking entities approach something that should be avoided until it's more mature?

  Read the article

< Previous Page | 204 205 206 207 208 209 210 211 212 213 214 215  | Next Page >