Search Results

Search found 5919 results on 237 pages for 'regex matching'.

Page 21/237 | < Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28  | Next Page >

  • Python re module becomes 20 times slower when called on greater than 101 different regex

    - by Wiil
    My problem is about parsing log files and removing variable parts on each lines to be able to group them. For instance: s = re.sub(r'(?i)User [_0-9A-z]+ is ', r"User .. is ", s) s = re.sub(r'(?i)Message rejected because : (.*?) \(.+\)', r'Message rejected because : \1 (...)', s) I have about 120+ matching rules like those above. I have found no performances issues while searching successively on 100 different regex. But a huge slow down comes when applying 101 regex. Exact same behavior happens when replacing my rules set by for a in range(100): s = re.sub(r'(?i)caught here'+str(a)+':.+', r'( ... )', s) Got 20 times slower when putting range(101) instead. # range(100) % ./dashlog.py file.bz2 == Took 2.1 seconds. == # range(101) % ./dashlog.py file.bz2 == Took 47.6 seconds. == Why such thing is happening ? And is there any known workaround ? (Happens on Python 2.6.6/2.7.2 on Linux/Windows.)

    Read the article

  • Regex expression is too greedy

    - by alastairs
    I'm writing a regular expression to match data from the IMDb soundtracks data file. My regexes are mostly working, although they are in places slurping too much text into my named groups. Take the following regex for example: "^ Performed by '?(?<performer>.*)('? \(qv\))?$" The performer group includes the string ' (qv) as well as the performer's name. Unfortunately, because the records are not consistently formatted, some performers' names are surrounded by single quotation marks whilst others are not. This means they are optional as far as the regex is concerned. I've tried marking the last group as a greedy group using the ?> group specifier, but this appeared to have no effect on the results. I can improve the results by changing the performer group to match a small range of characters, but this reduces my chances of parsing the name out correctly. Furthermore, if I were to just exclude the apostrophe character, I would then be unable to parse, e.g., band names containing apostrophes, such as Elia's Lonely Friends Band who performed Run For Your Life featured in Resident Evil: Apocalypse.

    Read the article

  • JavaScript Regex: Complicated input validation

    - by ScottSEA
    I'm trying to construct a regex to screen valid part and/or serial numbers in combination, with ranges. A valid part number is a two alpha, three digit pattern or /[A-z]{2}\d{3}/ i.e. aa123 or ZZ443 etc... A valid serial number is a five digit pattern, or /\d{5}/ 13245 or 31234 and so on. That part isn't the problem. I want combinations and ranges to be valid as well: 12345, ab123,ab234-ab245, 12346 - 12349 - the ultimate goal. Ranges and/or series of part and/or serial numbers in any combination. Note that spaces are optional when specifying a range or after a comma in a series. Note that a range of part numbers has the same two letter combination on both sides of the range (i.e. ab123 - ab239) I have been wrestling with this expression for two days now, and haven't come up with anything better than this: /^(?:[A-z]{2}\d{3}[, ]*)|(?:\d{5}[, ]*)|(?:([A-z]{2})\d{3} ?- ?\4\d{3}[, ]*)|(?:\d{5} ?- ?\d{5}[, ]*)$/ ... My Regex-Fu is weak.

    Read the article

  • regex match css class name from single string containing multiple classes

    - by effectica
    I have a long string that contains multiple css classes. With regex I would like to match every class name as I then need to replace these class names like so: <span>CLASSNAME</span> I have tried for hours to come up with a solution and I think I am close however for certain class names I am not able to exclude closing curly brackets from the match. Here is a sample string I have been carrying out testing on: #main .items-Outer p{ font-family:Verdana; color: #000000; font-size: 50px; font-weight: bold; }#footer .footer-inner p.intro{ font-family:Arial; color: #444444; font-size: 30; font-weight: normal; }.genericTxt{ font-family:Courier; color: #444444; font-size: 30; font-weight: normal; } And here is the the regex I came up with so far: ((^(?:.+?)(?:[^{]*))|((?:\})(?:.+?)(?:[^{]*))) Please look at the screenshot I am attaching as it will show more clearly the matches I get. My problem is that I would obviously like to exclude curly brackets from any match.

    Read the article

  • Python finding substring between certain characters using regex and replace()

    - by jCuga
    Suppose I have a string with lots of random stuff in it like the following: strJunk ="asdf2adsf29Value=five&lakl23ljk43asdldl" And I'm interested in obtaining the substring sitting between 'Value=' and '&', which in this example would be 'five'. I can use a regex like the following: match = re.search(r'Value=?([^&>]+)', strJunk) >>> print match.group(0) Value=five >>> print match.group(1) five How come match.group(0) is the whole thing 'Value=five' and group(1) is just 'five'? And is there a way for me to just get 'five' as the only result? (This question stems from me only having a tenuous grasp of regex) I am also going to have to make a substitution in this string such such as the following: val1 = match.group(1) strJunk.replace(val1, "six", 1) Which yields: 'asdf2adsf29Value=six&lakl23ljk43asdldl' Considering that I plan on performing the above two tasks (finding the string between 'Value=' and '&', as well as replacing that value) over and over, I was wondering if there are any other more efficient ways of looking for the substring and replacing it in the original string. I'm fine sticking with what I've got but I just want to make sure that I'm not taking up more time than I have to be if better methods are out there.

    Read the article

  • Regex Replacing only whole matches

    - by Leen Balsters
    I am trying to replace a bunch of strings in files. The strings are stored in a datatable along with the new string value. string contents = File.ReadAllText(file); foreach (DataRow dr in FolderRenames.Rows) { contents = Regex.Replace(contents, dr["find"].ToString(), dr["replace"].ToString()); File.SetAttributes(file, FileAttributes.Normal); File.WriteAllText(file, contents); } The strings look like this _-uUa, -_uU, _-Ha etc. The problem that I am having is when for example this string "_uU" will also overwrite "_-uUa" so the replacement would look like "newvaluea" Is there a way to tell regex to look at the next character after the found string and make sure it is not an alphanumeric character? I hope it is clear what I am trying to do here. Here is some sample data: private function _-0iX(arg1:flash.events.Event):void { if (arg1.type == flash.events.Event.RESIZE) { if (this._-2GU) { this._-yu(this._-2GU); } } return; } The next characters could be ;, (, ), dot, comma, space, :, etc.

    Read the article

  • Parsing CSS by regex

    - by Ross
    I'm creating a CSS editor and am trying to create a regular expression that can get data from a CSS document. This regex works if I have one property but I can't get it to work for all properties. I'm using preg/perl syntax in PHP. Regex (?<selector>[A-Za-z]+[\s]*)[\s]*{[\s]*((?<properties>[A-Za-z0-9-_]+)[\s]*:[\s]*(?<values>[A-Za-z0-9#, ]+);[\s]*)*[\s]*} Test case body { background: #f00; font: 12px Arial; } Expected Outcome Array( [0] => Array( [0] => body { background: #f00; font: 12px Arial; } [selector] => Array( [0] => body ) [1] => Array( [0] => body ) [2] => font: 12px Arial; [properties] => Array( [0] => font ) [3] => Array( [0] => font ) [values] => Array( [0] => 12px Arial [1] => background: #f00 ) [4] => Array( [0] => 12px Arial [1] => background: #f00 ) ) ) Real Outcome Array( [0] => Array ( [0] => body { background: #f00; font: 12px Arial; } [selector] => body [1] => body [2] => font: 12px Arial; [properties] => font [3] => font [values] => 12px Arial [4] => 12px Arial ) ) Thanks in advance for any help - this has been confusing me all afternoon!

    Read the article

  • Javascript Regex: Testing string for intelligent query

    - by Shyam
    Hi, I have a string that holds user input. This string can contain various types of data, like: a six digit id a zipcode that contains out of 4 digits and two alphanumeric characters a name (characters only) As I am using this string to search through a database, the query type is determined on the type of search, which i want to handle serverside using JavaScript (yes, I am using JavaScript serverside). Searching on StackOverflow, brought me some interesting information, like the .test-method, which seems perfect for my needs. The test-method returns either true or false based on the evaluation on the string using a regex object. I am using this page as a reference: http://www.javascriptkit.com/jsref/regexp.shtml So I am trying to determine the zipcode, by using the following very noobish regex. var r = /[A-Za-z]{2,2}/ As far I can understand, this should limit the amount of occurrences of alphanumeric characters to a maximum of two. See beneath the output of my JavaScript console. > var r = /[A-Za-z]{2,2}/ > var x = "2233AL" > r.test(x) true > var x = "2233A" > r.test(x) false > var x = "2233ALL" > r.test(x) true /* i want this to be false */ > A little help would be really appreciated!

    Read the article

  • Regex for ignoring consecutive quotation marks in string

    - by will-hart
    I have built a parser in Sprache and C# for files using a format I don't control. Using it I can correctly convert: a = "my string"; into my string The parser (for the quoted text only) currently looks like this: public static readonly Parser<string> QuotedText = from open in Parse.Char('"').Token() from content in Parse.CharExcept('"').Many().Text().Token() from close in Parse.Char('"').Token() select content; However the format I'm working with escapes quotation marks using "double doubles" quotes, e.g.: a = "a ""string""."; When attempting to parse this nothing is returned. It should return: a ""string"". Additionally a = ""; should be parsed into a string.Empty or similar. I've tried regexes unsuccessfully based on answers like this doing things like "(?:[^;])*", or: public static readonly Parser<string> QuotedText = from content in Parse.Regex("""(?:[^;])*""").Token() This doesn't work (i.e. no matches are returned in the above cases). I think my beginners regex skills are getting in the way. Does anybody have any hints? EDIT: I was testing it here - http://regex101.com/r/eJ9aH1

    Read the article

  • java regex for alpha and spaces is including [ ] \

    - by JayAvon
    This is my regex for my JTextField to not be longer than x characters and to not include anything other than letters or spaces. For some reason it is allowing [ ] and \ characters. This is driving me crazy. Is my regex wrong?? package com.jayavon.game.helper; import java.awt.Toolkit; import javax.swing.text.AttributeSet; import javax.swing.text.BadLocationException; import javax.swing.text.PlainDocument; public class CharacterNameCreationDocument extends PlainDocument { private static final long serialVersionUID = 1L; private int limit; public CharacterNameCreationDocument(int limit) { super(); this.limit = limit; } public void insertString(int offset, String str, AttributeSet attr) throws BadLocationException { if (str == null || (getLength() + str.length()) > limit || !str.matches("[a-zA-z\\s]*")){ Toolkit.getDefaultToolkit().beep(); return; } else { super.insertString(offset, str, attr); } } }

    Read the article

  • Optimising ruby regexp -- lots of match groups

    - by Farcaller
    I'm working on a ruby baser lexer. To improve performance, I joined up all tokens' regexps into one big regexp with match group names. The resulting regexp looks like: /\A(?<__anonymous_-1038694222803470993>(?-mix:\n+))|\A(?<__anonymous_-1394418499721420065>(?-mix:\/\/[\A\n]*))|\A(?<__anonymous_3077187815313752157>(?-mix:include\s+"[\A"]+"))|\A(?<LET>(?-mix:let\s))|\A(?<IN>(?-mix:in\s))|\A(?<CLASS>(?-mix:class\s))|\A(?<DEF>(?-mix:def\s))|\A(?<DEFM>(?-mix:defm\s))|\A(?<MULTICLASS>(?-mix:multiclass\s))|\A(?<FUNCNAME>(?-mix:![a-zA-Z_][a-zA-Z0-9_]*))|\A(?<ID>(?-mix:[a-zA-Z_][a-zA-Z0-9_]*))|\A(?<STRING>(?-mix:"[\A"]*"))|\A(?<NUMBER>(?-mix:[0-9]+))/ I'm matching it to my string producing a MatchData where exactly one token is parsed: bigregex =~ "\n ... garbage" puts $~.inspect Which outputs #<MatchData "\n" __anonymous_-1038694222803470993:"\n" __anonymous_-1394418499721420065:nil __anonymous_3077187815313752157:nil LET:nil IN:nil CLASS:nil DEF:nil DEFM:nil MULTICLASS:nil FUNCNAME:nil ID:nil STRING:nil NUMBER:nil> So, the regex actually matched the "\n" part. Now, I need to figure the match group where it belongs (it's clearly visible from #inspect output that it's _anonymous-1038694222803470993, but I need to get it programmatically). I could not find any option other than iterating over #names: m.names.each do |n| if m[n] type = n.to_sym resolved_type = (n.start_with?('__anonymous_') ? nil : type) val = m[n] break end end which verifies that the match group did have a match. The problem here is that it's slow (I spend about 10% of time in the loop; also 8% grabbing the @input[@pos..-1] to make sure that \A works as expected to match start of string (I do not discard input, just shift the @pos in it). You can check the full code at GH repo. Any ideas on how to make it at least a bit faster? Is there any option to figure the "successful" match group easier?

    Read the article

  • Sed: regular expression match lines without <!--

    - by sixtyfootersdude
    I have a sed command to comment out xml commands sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml Takes: <a> <!-- Comment --> <b> bla </b> </a> Produces: <!-- Security: <a> --> <!-- Security: <!-- Comment --> --> // NOTE: there are two end comments. <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> Ideally I would like to not use my sed script to comment things that are already commented. Ie: <!-- Security: <a> --> <!-- Comment --> <!-- Security: <b> --> <!-- Security: bla --> <!-- Security: </b> --> <!-- Security: </a> --> I could do something like this: sed 's/^\([ \t]*\)\(.*[0-9a-zA-Z<].*\)$/\1<!-- Security: \2 -->/' web.xml sed 's/^[ \t]*<!-- Security: \(<!--.*-->\) -->/\1/' web.xml but I think a one liner is cleaner (?) This is pretty similar: http://stackoverflow.com/questions/436850/matching-a-line-that-doesnt-contain-specific-text-with-regular-expressions

    Read the article

  • Spring security request matcher is not working with regex

    - by Felipe Cardoso Martins
    Using Spring MVC + Security I have a business requirement that the users from SEC (Security team) has full access to the application and FRAUD (Anti-fraud team) has only access to the pages that URL not contains the words "block" or "update" with case insensitive. Bellow, all spring dependencies: $ mvn dependency:tree | grep spring [INFO] +- org.springframework:spring-webmvc:jar:3.1.2.RELEASE:compile [INFO] | +- org.springframework:spring-asm:jar:3.1.2.RELEASE:compile [INFO] | +- org.springframework:spring-beans:jar:3.1.2.RELEASE:compile [INFO] | +- org.springframework:spring-context:jar:3.1.2.RELEASE:compile [INFO] | +- org.springframework:spring-context-support:jar:3.1.2.RELEASE:compile [INFO] | \- org.springframework:spring-expression:jar:3.1.2.RELEASE:compile [INFO] +- org.springframework:spring-core:jar:3.1.2.RELEASE:compile [INFO] +- org.springframework:spring-web:jar:3.1.2.RELEASE:compile [INFO] +- org.springframework.security:spring-security-core:jar:3.1.2.RELEASE:compile [INFO] | \- org.springframework:spring-aop:jar:3.0.7.RELEASE:compile [INFO] +- org.springframework.security:spring-security-web:jar:3.1.2.RELEASE:compile [INFO] | +- org.springframework:spring-jdbc:jar:3.0.7.RELEASE:compile [INFO] | \- org.springframework:spring-tx:jar:3.0.7.RELEASE:compile [INFO] +- org.springframework.security:spring-security-config:jar:3.1.2.RELEASE:compile [INFO] +- org.springframework.security:spring-security-acl:jar:3.1.2.RELEASE:compile Bellow, some examples of mapped URL path from spring log: Mapped URL path [/index] onto handler 'homeController' Mapped URL path [/index.*] onto handler 'homeController' Mapped URL path [/index/] onto handler 'homeController' Mapped URL path [/cellphone/block] onto handler 'cellphoneController' Mapped URL path [/cellphone/block.*] onto handler 'cellphoneController' Mapped URL path [/cellphone/block/] onto handler 'cellphoneController' Mapped URL path [/cellphone/confirmBlock] onto handler 'cellphoneController' Mapped URL path [/cellphone/confirmBlock.*] onto handler 'cellphoneController' Mapped URL path [/cellphone/confirmBlock/] onto handler 'cellphoneController' Mapped URL path [/user/update] onto handler 'userController' Mapped URL path [/user/update.*] onto handler 'userController' Mapped URL path [/user/update/] onto handler 'userController' Mapped URL path [/user/index] onto handler 'userController' Mapped URL path [/user/index.*] onto handler 'userController' Mapped URL path [/user/index/] onto handler 'userController' Mapped URL path [/search] onto handler 'searchController' Mapped URL path [/search.*] onto handler 'searchController' Mapped URL path [/search/] onto handler 'searchController' Mapped URL path [/doSearch] onto handler 'searchController' Mapped URL path [/doSearch.*] onto handler 'searchController' Mapped URL path [/doSearch/] onto handler 'searchController' Bellow, a test of the regular expressions used in spring-security.xml (I'm not a regex speciality, improvements are welcome =]): import java.util.Arrays; import java.util.List; public class RegexTest { public static void main(String[] args) { List<String> pathSamples = Arrays.asList( "/index", "/index.*", "/index/", "/cellphone/block", "/cellphone/block.*", "/cellphone/block/", "/cellphone/confirmBlock", "/cellphone/confirmBlock.*", "/cellphone/confirmBlock/", "/user/update", "/user/update.*", "/user/update/", "/user/index", "/user/index.*", "/user/index/", "/search", "/search.*", "/search/", "/doSearch", "/doSearch.*", "/doSearch/"); for (String pathSample : pathSamples) { System.out.println("Path sample: " + pathSample + " - SEC: " + pathSample.matches("^.*$") + " | FRAUD: " + pathSample.matches("^(?!.*(?i)(block|update)).*$")); } } } Bellow, the console result of Java class above: Path sample: /index - SEC: true | FRAUD: true Path sample: /index.* - SEC: true | FRAUD: true Path sample: /index/ - SEC: true | FRAUD: true Path sample: /cellphone/block - SEC: true | FRAUD: false Path sample: /cellphone/block.* - SEC: true | FRAUD: false Path sample: /cellphone/block/ - SEC: true | FRAUD: false Path sample: /cellphone/confirmBlock - SEC: true | FRAUD: false Path sample: /cellphone/confirmBlock.* - SEC: true | FRAUD: false Path sample: /cellphone/confirmBlock/ - SEC: true | FRAUD: false Path sample: /user/update - SEC: true | FRAUD: false Path sample: /user/update.* - SEC: true | FRAUD: false Path sample: /user/update/ - SEC: true | FRAUD: false Path sample: /user/index - SEC: true | FRAUD: true Path sample: /user/index.* - SEC: true | FRAUD: true Path sample: /user/index/ - SEC: true | FRAUD: true Path sample: /search - SEC: true | FRAUD: true Path sample: /search.* - SEC: true | FRAUD: true Path sample: /search/ - SEC: true | FRAUD: true Path sample: /doSearch - SEC: true | FRAUD: true Path sample: /doSearch.* - SEC: true | FRAUD: true Path sample: /doSearch/ - SEC: true | FRAUD: true Tests Scenario 1 Bellow, the important part of spring-security.xml: <security:http entry-point-ref="entryPoint" request-matcher="regex"> <security:intercept-url pattern="^.*$" access="ROLE_SEC" /> <security:intercept-url pattern="^(?!.*(?i)(block|update)).*$" access="ROLE_FRAUD" /> <security:access-denied-handler error-page="/access-denied.html" /> <security:form-login always-use-default-target="false" login-processing-url="/doLogin.html" authentication-failure-handler-ref="authFailHandler" authentication-success-handler-ref="authSuccessHandler" /> <security:logout logout-url="/logout.html" success-handler-ref="logoutSuccessHandler" /> </security:http> Behaviour: FRAUD group **can't" access any page SEC group works fine Scenario 2 NOTE that I only changed the order of intercept-url in spring-security.xml bellow: <security:http entry-point-ref="entryPoint" request-matcher="regex"> <security:intercept-url pattern="^(?!.*(?i)(block|update)).*$" access="ROLE_FRAUD" /> <security:intercept-url pattern="^.*$" access="ROLE_SEC" /> <security:access-denied-handler error-page="/access-denied.html" /> <security:form-login always-use-default-target="false" login-processing-url="/doLogin.html" authentication-failure-handler-ref="authFailHandler" authentication-success-handler-ref="authSuccessHandler" /> <security:logout logout-url="/logout.html" success-handler-ref="logoutSuccessHandler" /> </security:http> Behaviour: SEC group **can't" access any page FRAUD group works fine Conclusion I did something wrong or spring-security have a bug. The problem already was solved in a very bad way, but I need to fix it quickly. Anyone knows some tricks to debug better it without open the frameworks code? Cheers, Felipe

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to do this Python / MySQL manipulation (match) more efficiently?

    - by NJTechie
    Following is my data : Company Table : ID Company Address City State Zip Phone 1 ABC 123 Oak St Philly PA 17542 7329878901 2 CDE 111 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 KLE 87 Ilk St Plains NY 07654 7376578901 6 AB 1 W.House SField PA 87656 7329878901 Branch Office Table : ID Address City State Zip Phone 1 323 Alk St Philly PA 17542 7329832221 1 171 Joe St Newark NJ 08654 3 287 Foe St Brick NJ 07740 7321178901 3 700 Wall Ocean NJ 07764 7322278901 1 89 Blk St Surrey NY 07154 7376222901 File to be Matched (In MySQL): ID Company Address City State Zip Phone 1 ABC 123 Oak St Philly PA 17542 7329878901 2 AB 171 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 K 87 Ilk St Plains NY 07654 7376578901 Resulting File : ID Company Address City State Zip Phone appendedID 1 ABC 123 Oak St Philly PA 17542 7329878901 [Original record, field always empty] 1 ABC 171 Joe St Newark NJ 08654 1 [Company Table] 1 ABC 323 Alk St Philly PA 17542 7329832221 1 [Branch Office Table] 1 AB 1 W.House SField PA 87656 7329878901 6 [Partial firm and State, Zip match] 2 CDE 111 Joe St Newark NJ 08654 3 GHI 211 Foe St Brick NJ 07740 7321178901 3 GHI 700 Wall Ocean NJ 07764 7322278901 3 3 GHI 287 Foe St Brick NJ 07740 7321178901 3 4 JAK 777 Wall Ocean NJ 07764 7322278901 5 KLE 87 Ilk St Surrey NY 07654 7376578901 5 KLE 89 Blk St Surrey NY 07154 7376222901 5 Requirement : 1) I have to match each firm on the 'File to be Matched' to that of Company and Branch Office tables (MySQL). 2) If there are multiple exact/partial matches, then the ID from Company, Branch Office table is inserted as a new row in the resulting file. 3) Not all the firms will be matched perfectly, in that case I have to match on partial Company names (like 5/8th of the company name) and any of the address fields and insert them in the resulting file. Please help me out in the most efficient solution for this problem.

    Read the article

  • jQuery Youtube URL Validation with regex

    - by Mithun
    I know there is plenty of question answered over here http://stackoverflow.com/questions/tagged/youtube+regex, but not able find a question similar to me. Any body has the JavaScript Regular expression for validating the YouTube VIDEO URL's line below listed. Just want to know where such a URL can be possible http://www.youtube.com/watch?v=bQVoAWSP7k4 http://www.youtube.com/watch?v=bQVoAWSP7k4&feature=popular http://www.youtube.com/watch?v=McNqjYiFmyQ&feature=related&bhablah http://youtube.com/watch?v=bQVoAWSP7k4

    Read the article

  • Python 3: regex to split on successions of newline characters

    - by Beau Martínez
    I'm trying to split a string on newline characters (catering for Windows, OS X, and Unix text file newline characters). If there are any succession of these, I want to split on that too and not include any in the result. So, for when splitting the following: "Foo\r\n\r\nDouble Windows\r\rDouble OS X\n\nDouble Unix\r\nWindows\rOS X\nUnix" The result would be: ['Foo', 'Double Windows', 'Double OS X', 'Double Unix', 'Windows', 'OS X', 'Unix'] What regex should I use?

    Read the article

  • Regex: Comma delimited integers

    - by Metju
    Hi Guys, I'm trying to create a regex that accept: An empty string, a single integer or multiple integers separated by a comma but can have no starting and ending comma. I managed to find this, but I cannot undertsand how to remove the digit limit ^\d{1,10}([,]\d{10})*$

    Read the article

  • Regex Replace Between Quotations

    - by Kyle Rozendo
    Hi All, I am wondering on where to begin to perform the following replace in regex: Read file (.cs file) Replace anything between quotations ("e.g:") with its uppercase version ("E.G:") By example: string m = "stringishere"; Becomes string m = "STRINGISHERE"; Thanks in advance, Kyle

    Read the article

  • C# string "search and replace" using a regex

    - by rsturim
    I need to do a 2 rule "replace" -- my rules are, replace all open parens, "(" with a hyphen "-" and strip out all closing parens ")". So for example this: "foobar(baz2)" would become "foobar-baz2" I currently do it like this -- but, my hunch regex would be cleaner. myString.Replace("(", "-").Replace(")", "");

    Read the article

  • Escaping '“' with regular double quotes using Ruby regex

    - by DavidP6
    I have text that has these fancy double quotes: '“' and I would like to replace them with regular double quotes using Ruby gsub and regex. Here's an example and what I have so far: sentence = 'This is a quote, “Hey guys!”' I couldn't figure out how to escape double quotes so I tried using 34.chr: sentence.gsub("“",34.chr). This gets me close but leaves a back slash in front of the double quote: sentence.gsub("“",34.chr) => 'This is a quote, \"Hey guys!”'

    Read the article

  • Codeigniter Routes regex

    - by esryl
    want to route all underscored urls to the dashed equivalent. what would be the codeigniter route regex. url /controller-name/method-name-which-is-long/ would speak to /controller_name/method_name_which_is_long/ see: http://codeigniter.com/forums/viewreply/696690/ which gave me the idea to ask :)

    Read the article

  • Regex to Match White Space or End of String

    - by Kirk
    I'm trying to find every instance of @username in comment text and replace it with a link. Here's my PHP so far: $comment = preg_replace('/@(.+?)\s/', '<a href="/users/${1}/">@${1}</a> ', $comment); The only problem is the regex is dependent upon there being whitespace after the @username reference. Can anyone help me tweak this so it will also match if it is at the end of the string?

    Read the article

  • jQuery regex over multiple lines

    - by Fuxi
    I have the following string: <img alt="over 40 world famous brandedWATCHES BRANDs to choose from " src="http://www.fastblings.com/images/logo.jpg"></strong></a><br> I want to define a regex pattern like <img alt="(.+?)" src="http://(.+?).(jpg|gif)">, but as you can see the target string has a linebreak in the alt attribute - so how can i incorporate this? the rule should be like "anything in the alt-attribute including linebreaks".

    Read the article

< Previous Page | 17 18 19 20 21 22 23 24 25 26 27 28  | Next Page >