Search Results

Search found 6743 results on 270 pages for 'regular joe'.

Page 210/270 | < Previous Page | 206 207 208 209 210 211 212 213 214 215 216 217  | Next Page >

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • XAMPP on windows 7 not working properly

    - by 404Error
    Hey there, I just installed XAMPP lite on Windows 7. I have two drives - C: for the OS and regular files, and an external drive E:. I installed XAMPP lite on E: (on the root), and its been giving me problems. Apache works well enough, but MySQL doesn't work. When I go to http://localhost/phpmyadmin/, it gives me the following error: Error MySQL said: #2003 - Can't connect to MySQL server on 'localhost' (10061) Connection for controluser as defined in your configuration failed. Any ideas as to what could be the problem? I used the zip file for XAMPP lite, the 32 bit version. This is on Windows 7 Home premium. Thanks!

    Read the article

  • Zend Framework: How to handle exceptions in Ajax requests?

    - by understack
    Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

    Read the article

  • Regex doesn't work properly

    - by oneofthelions
    I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Question in Flex (parser)

    - by shkk
    Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

    Read the article

  • JQuery create new select option

    - by nav
    Hi I have the below functions in regular javascript creating select options. Is there a way I can do this with JQuery without having to use the form object? function populate(form) { form.options.length = 0; form.options[0] = new Option("Select a city / town in Sweden",""); form.options[1] = new Option("Melbourne","Melbourne"); } Below is how I call the function above: populate(document.form.county); //county is the id of the dropdownlist to populate. Many Thanks,

    Read the article

  • Magento - how to create different prices for different sizes of a products?

    - by Lisa Li
    Hi, I am trying to set different prices for different sizes of a few products I have in my store. I am not really sure how to do that propely. The problem is that I already have the regular size defined as a simple product. Now, I want to add a smaller size as well, that can be chosen from the same product page, and I need to set the weight of the smaller size, so postage is calculated properly. Any suggestions? Many thanks!

    Read the article

  • Change selected value of drop down list with jQuery

    - by Phairoh
    I have a drop down list with known values. What I'm trying to do is set the drop down list to a particular value that I know exists using jQuery. Using regular JavaScript, I would do something like: ddl = document.getElementById("ID of element goes here"); ddl.value = 2; // 2 being the value I want to set it to. However, I need to do this with jQuery because I'm using a CSS class for my selector (stupid ASP.NET client ids...). Here are a few things I've tried: $("._statusDDL").val(2); // doesn't find 2 as a value $("._statusDDL").children("option").val(2) // also failed. How can I do it with jQuery?

    Read the article

  • HandsOnTable - using date functions with methods

    - by briansol
    I have a function used on the datepicker to limit dates selected to the first of the month... I invoke it by setting a class and listener, such as: $( ".datepickfom" ).datepicker( { beforeShowDay: fom, showOn: "both", buttonImage: "/images/calendar.png", buttonImageOnly: true, changeMonth: true, changeYear: true, dateFormat: "m/d/yy", yearRange: "-25:+100", constrainInput: true } ); the fom call: function fom(date){ if (date.getDate() != 1) { return [false, "", "Specify 1st of Month"]; } return [true, ""]; } This works great for regular forms. I'm looking to extend this functionality to the HandsOnTable 'date' cell data types. var $container_1 = $("#datatable_1"); var handsontable_1 = $container_1.data('handsontable'); $("#datatable_1").handsontable( { columns: [ {}, {}, { type: 'date', dateFormat: 'm/d/yy' }, {}, { type: 'dropdown', source: ["","Y","N"] }, {}, {} ] }); This also works as it should, but the date lets me pick other dates besides the first. Is there a way to attach the beforeShowDay option to the HOT cell call as well?

    Read the article

  • Java Util Linked List - how to find next?

    - by drozzy
    When using Java LinkedList how do you find out the element's next or previous relationships? I mean, in a regular linked list I would do something like this: Node node1 = new Node(); Node node2 = new Node(); LinkedList list = new LinkedList(); list.add(node1); list.add(node2); //then my node1 will know who it's next is: assertEquals(node2, node1.next()); But in Java's LinkedList, the data does not seem to be modified. So how do I actually find out who the "next" (or "previous" in the case of doubly-linked lists) element is?

    Read the article

  • Get "2:35pm" instead of "02:35PM" from Python date/time?

    - by anonymous coward
    I'm still a bit slow with Python, so I haven't got this figured out beyond what's obviously in the docs, etc. I've worked with Django a bit, where they've added some datetime formatting options via template tags, but in regular python code how can I get the 12-hour hour without a leading zero? Is there a straightforward way to do this? I'm looking at the 2.5 and 2.6 docs for "strftime()" and there doesn't seem to be a formatting option there for this case. Should I be using something else? Feel free to include any other time-formatting tips that aren't obvious from the docs. =)

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Just how much do I want to make virtual?

    - by Alex
    I am writing an abstract superclass where literally every method is going to be overridden. There is some default functionality I could implement, but most of the time it's enough to leave the implementation to the subclass writer. Since just about every method is going to be overwritten, how much should I make virtual and how much should I just leave as regular methods? In the current incarnation, everything is virtual, but I still haven't let this loose to anyone to use, so the design is flexible. What advantages/disadvantages are there to virtual functions? Links to good reading material about this would be appreciated.

    Read the article

  • c# performance- create font

    - by user85917
    I have performance issues in this code segment which I think is caused by the "new Font". Will it be faster if fonts are static/global ? if (row.StartsWith(TILD_BEGIN)) { rtbTrace.SelectionColor = Color.Maroon; rtbTrace.SelectionFont = new Font(myFont, (float)8.25, FontStyle.Regular); if (row.StartsWith(BEGIN) ) rtbTrace.AppendText(Environment.NewLine + row + Environment.NewLine); else rtbTrace.AppendText(Environment.NewLine + row.Substring(1) + Environment.NewLine); continue; } if (row.StartsWith(EXCL_BEGIN)) { -- similar block } if (row.StartsWith(DLR_BEGIN)) { -- similar block } . . .

    Read the article

  • Get seleted text parent tag using regex C#

    - by Aruna Tennakoon
    <SPAN id=spanD121C150D2 style="BACKGROUND-COLOR: antiquewhite" CategoryID="1" MessageID="2316" refSpan=""> <SPAN id=span1CE69EDE12 style="BACKGROUND-COLOR: blue" CategoryID="2" MessageID="2316" refSpan="">platnosci inny srodkiem platnosci. DC - zakup paliwa na stacji benzynowej 101-500 (150 zl). 27 </SPAN> </SPAN> I have a string like above. If the selected text is "srodkiem ", is it possible to get the relevant span tag? Is this possible using a regular expression?

    Read the article

  • How do I compute a variable in Javascript if and only if it is used?

    - by LLer
    This is what I'm doing right now. var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = function() { return x; }; return x; } It works but only if foo is called as a function like so foo(); But what if I want to call it as a normal variable with a value? I could modify the code to be var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = x; return x; } That would allow me to only call it once as a function and after that as a regular variable. But it's still not what I want. Plus it gets complicated if it accidentally gets called as a function again, returning an error. Is this even possible in Javascript?

    Read the article

  • Assign RegEx submatches to variables or map (C++/C)

    - by Michael
    I need to extract the SAME type of information (e.g. First name, Last Name, Telephone, ...), from numerous different text sources (each with a different format & different order of the variables of interest). I want a function that does the extraction based on a regular expression and returns the result as DESCRIPTIVE variables. In other words, instead of returning each match result as submatch[0], submatch[1], submatch[2], ..., have it do EITHER of the following: 1.) return std::map so that the submatches can be accessed via: submatch["first_name"], submatch["last_name"], submatch["telephone"] 2.) return a variables with the submatches so that the submatches can be accessed via: submatch_first_name, submatch_last_name, submatch_telephone I can write a wrapper class around boost::regex to do #1, but I was hoping there would be a built-in or a more elegant way to do this in C++/Boost/STL/C.

    Read the article

  • Need Regex for to match special situations

    - by Daniel
    I'm desperately searching for regular expressions that match these scenarios: 1) Match alternating chars I've a string like "This is my foobababababaf string" - and I want to match "babababa" Only thing I know is the length of the fragment to search - I don't know what chars/digits that might be - but they are alternating. I've really no clue where to start :( 2) Match combined groups In a string like "This is my foobaafoobaaaooo string" - and I want to match "aaaooo". Like in 1) I don't know what chars/digits that might be. I only know that they will appear in two groups. I experimented using (.)\1\1\1(.)\1\1\1 and things like this...

    Read the article

  • Given a user control with a form containing validation can I validate entirely server side?

    - by JoshBaltzell
    We have an existing User Control that was built to dynamically generate a web form for an end user. This form includes required field validators, custom validators that use server side code and Regular Expression validatiors. We now have a need to use all these validators to verify that all the needed data is entered when using a separate ordering process that cannot be validated in the same way, but has the same validation requirements before it is added to the database. I would like to use this user control to validate the input by passing it all the values and checking the validation summary. The only way I know how to do this is to render it to a page on the client side and trigger the form submit. Is there any way to populate and validate a web form entirely on the server side?

    Read the article

  • Removing words from a file

    - by user1765792
    I'm trying to take a regular text file and remove words identified in a separate file (stopwords) containing the words to be removed separated by carriage returns ("\n"). Right now I'm converting both files into lists so that the elements of each list can be compared. I got this function to work, but it doesn't remove all of the words I have specified in the stopwords file. Any help is greatly appreciated. def elimstops(file_str): #takes as input a string for the stopwords file location stop_f = open(file_str, 'r') stopw = stop_f.read() stopw = stopw.split('\n') text_file = open('sample.txt') #Opens the file whose stop words will be eliminated prime = text_file.read() prime = prime.split(' ') #Splits the string into a list separated by a space tot_str = "" #total string i = 0 while i < (len(stopw)): if stopw[i] in prime: prime.remove(stopw[i]) #removes the stopword from the text else: pass i += 1 # Creates a new string from the compilation of list elements # with the stop words removed for v in prime: tot_str = tot_str + str(v) + " " return tot_str

    Read the article

  • Replace non-html links with <A> tags

    - by tombazza
    I have a block of code that will take a block of text like the following: Sample text sample text http://www.google.com sample text Using the preg_replace_callback method and the following regular expression: preg_replace_callback('/http:\/\/([,\%\w.\-_\/\?\=\+\&\~\#\$]+)/', create_function( '$matches', '$url = $matches[1]; $anchorText = ( strlen($url) > 35 ? substr($url, 0, 35).\'...\' : $url); return \'<a href="http://\'. $url .\'">\'. $anchorText .\'</a>\';'), $str); Will convert the sample text to look like: Sample text sample text < a href="http://www.google.com"http://www.google.com< /a sample text My problem now is that we have introduced a rich text editor that can create links before being sent to the script. I need to update this piece of code so that it will ignore any URLs that are already inside an tag.

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • compare date split across colums

    - by alex-tech
    Greetings. I am querying tables from Microsoft SQL 2008 which have date split across 3 columns: day, month and year. Unfortunately, I do not have control over this because data is coming in to the database daily from a 3rd party source in that format. I need to add between to a where clause so user can pull records within a range. Would be easy enough if date was in a single column but finding it nearly impossible when its split across three columns. To display the date, I am doing a CAST( CAST(year as varchar(4)) + '-' + CAST(month as varchar(2)) + '-' + CAST(day as varchar(2)) as date) AS "date"` in a select. I tried to put it as a parameter for datediff function or just the regular between but get no results. Thanks for any help.

    Read the article

  • parse unformatted string into dictionary with python

    - by user553131
    I have following string. DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) Key: a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO I need to create dictionary so it would be like { "DATE": "12242010", "Key Type": "Nod32 Anti-Vir (30d trial)", "Key": "a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO" } The problem is that string is unformatted DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) there is no space after Date before Key Type also it would be nice to have some validation for Key, eg if there are 5 chars in each box of key and number of boxes I am a beginner in python and moreover in regular expressions. Thanks a lot.

    Read the article

< Previous Page | 206 207 208 209 210 211 212 213 214 215 216 217  | Next Page >