Search Results

Search found 8839 results on 354 pages for 'optional parameters'.

Page 217/354 | < Previous Page | 213 214 215 216 217 218 219 220 221 222 223 224  | Next Page >

  • #include - brackets vs quotes in XCode?

    - by Chris Becke
    In MSVC++ #include files are searched for differently depending on whether the file is enclosed in "" or <. The quoted form searches first in the local folder, then in /I specified locations, The angle bracket form avoids the local folder. This means, in MSVC++, its possible to have header files with the same name as runtime and SDK headers. So, for example, I need to wrap up the windows sdk windows.h file to undefine some macro's that cause trouble. With MSVS I can just add a (optional) windows.h file to my project as long as I include it using the quoted form :- // some .cpp file #include "windows.h" // will include my local windows.h file And in my windows.h, I can pull in the real one using the angle bracket form: // my windows.h #include <windows.h> // will load the real one #undef ConflictingSymbol Trying this trick with GCC in XCode didn't work. angle bracket #includes in system header files in fact are finding my header files with similar names in my local folder structure. The MSVC system means its quite safe to have a "String.h" header file in my own folder structre. On XCode this seems to be a major no no. Is there some way to control this search path behaviour in XCode to be more like MSVC's? Or do I just have to avoid naming any of my headers anything that might possibly conflict with a system header. Writing cross platform code and using lots of frameworks means the possibility of incidental conflicts seems large.

    Read the article

  • ASP.NET MVC 2 - Custom route doesn't find controller action

    - by mcfroob
    For some reason my application isn't routing to my controller method correctly. I have a routelink like this in my webpage - <%= Html.RouteLink("View", "Blog", new { id=(item.BlogId), slug=(item.Slug) }) %> In global.asax.cs I have the following routes - routes.IgnoreRoute("{resource}.axd/{*pathInfo}"); routes.MapRoute( "MoreBlogs", "Blog/Page/{page}", new { controller = "Blog", action = "Index" } ); routes.MapRoute( "Blog", "Blog/View/{id}/{slug}", new { controller = "Blog", action = "View"} ); routes.MapRoute( "Default", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Blog", action = "Index", id = UrlParameter.Optional } // Parameter defaults ); And then I have a class BlogController that has a method - public ActionResult View(int id, string slug) { ... etc. } I put a breakpoint in the first line of the View method but it's not getting hit at all. I checked with a route debugger for the format localhost/Blog/View/1/test and it matched my custom route. All I'm getting is a 404 while running this, I can't work out why the route won't post to the view method in my controller - any ideas?

    Read the article

  • How to transform a production to LL(1) grammar for a list separated by a semicolon?

    - by Subb
    Hi, I'm reading this introductory book on parsing (which is pretty good btw) and one of the exercice is to "build a parser for your favorite language." Since I don't want to die today, I thought I could do a parser for something relatively simple, ie a simplified CSS. Note: This book teach you how to right a LL(1) parser using the recursive-descent algorithm. So, as a sub-exercice, I am building the grammar from what I know of CSS. But I'm stuck on a production that I can't transform in LL(1) : //EBNF block = "{", declaration, {";", declaration}, [";"], "}" //BNF <block> =:: "{" <declaration> "}" <declaration> =:: <single-declaration> <opt-end> | <single-declaration> ";" <declaration> <opt-end> =:: "" | ";" This describe a CSS block. Valid block can have the form : { property : value } { property : value; } { property : value; property : value } { property : value; property : value; } ... The problem is with the optional ";" at the end, because it overlap with the starting character of {";", declaration}, so when my parser meet a semicolon in this context, it doesn't know what to do. The book talk about this problem, but in its example, the semicolon is obligatory, so the rule can be modified like this : block = "{", declaration, ";", {declaration, ";"}, "}" So, Is it possible to achieve what I'm trying to do using a LL(1) parser?

    Read the article

  • Google App engine Url Mapping using WSGIAppl and regx grouping Help Needed

    - by spidee
    Hi take this example from google docs class BrowseHandler(webapp.RequestHandler): > def get(self, category, product_id): > # Display product with given ID in the given category. > > > # Map URLs like /browse/(category)/(product_id) to > BrowseHandler. application = > webapp.WSGIApplication([(r'/browse/(.*)/(.*)', > BrowseHandler) > ], > debug=True) > > def main(): > run_wsgi_app(application) > > if __name__ == '__main__': > main() How can i change the regx groupings so that Product id is optional ie the url http://yourdomain.com/category will be sent to the browse handler in the current above example you must add a product id or at least the / after the category ie http://yourdomain.com/category/ r'/browse/(.)/(.)' Any ideas?

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Problem updating collection using JPA

    - by FarmBoy
    I have an entity class Foo foo that contains Collection<Bar> bars. I've tried a variety of ways, but I'm unable to successfully update my collection. One attempt: foo = em.find(key); foo.getBars().clear(); foo.setBars(bars); em.flush; \\ commit, etc. This appends the new collection to the old one. Another attempt: foo = em.find(key); bars = foo.getBars(); for (Bar bar : bars) { em.remove(bar); } em.flush; At this point, I thought I could add the new collection, but I find that the entity foo has been wiped out. Here are some annotations. In Foo: @OneToMany(cascade = { CascadeType.ALL }, mappedBy = "foo") private List<Bar> bars; In Bar: @ManyToOne(optional = false, cascade = { CascadeType.ALL }) @JoinColumn(name = "FOO_ID") private Foo foo; Has anyone else had trouble with this? Any ideas?

    Read the article

  • F# How to tokenise user input: separating numbers, units, words?

    - by David White
    I am fairly new to F#, but have spent the last few weeks reading reference materials. I wish to process a user-supplied input string, identifying and separating the constituent elements. For example, for this input: XYZ Hotel: 6 nights at 220EUR / night plus 17.5% tax the output should resemble something like a list of tuples: [ ("XYZ", Word); ("Hotel:", Word); ("6", Number); ("nights", Word); ("at", Operator); ("220", Number); ("EUR", CurrencyCode); ("/", Operator); ("night", Word); ("plus", Operator); ("17.5", Number); ("%", PerCent); ("tax", Word) ] Since I'm dealing with user input, it could be anything. Thus, expecting users to comply with a grammar is out of the question. I want to identify the numbers (could be integers, floats, negative...), the units of measure (optional, but could include SI or Imperial physical units, currency codes, counts such as "night/s" in my example), mathematical operators (as math symbols or as words including "at" "per", "of", "discount", etc), and all other words. I have the impression that I should use active pattern matching -- is that correct? -- but I'm not exactly sure how to start. Any pointers to appropriate reference material or similar examples would be great.

    Read the article

  • Re-usable Obj-C classes with custom values: The right way

    - by Prairiedogg
    I'm trying to reuse a group of Obj-C clases between iPhone applications. The values that differ from app to app have been isolated and I'm trying to figure out the best way to apply these custom values to the classes on an app-to-app basis. Should I hold them in code? // I might have 10 customizable values for each class, that's a long signature! CarController *controller = [[CarController alloc] initWithFontName:@"Vroom" engine:@"Diesel" color:@"Red" number:11]; Should I store them in a big settings.plist? // Wasteful! I sometimes only use 2-3 of 50 settings! AllMyAppSettings *settings = [[AllMyAppSettings alloc] initFromDisk:@"settings.plist"]; MyCustomController *controller = [[MyCustomController alloc] initWithSettings:settings]; [settings release]; Should I have little, optional n_settings.plists for each class? // Sometimes I customize CarControllerSettings *carSettings = [[CarControllerSettings alloc] initFromDisk:@"car_settings.plist"]; CarController *controller = [[CarController alloc] initWithSettings:carSettings]; [carSettings release]; // Sometimes I don't, and CarController falls back to internally stored, reasonable defaults. CarController *controller = [[CarController alloc] initWithSettings:nil]; Or is there an OO solution that I'm not thinking of at all that would be better?

    Read the article

  • Forming triangles from points and relations

    - by SiN
    Hello, I want to generate triangles from points and optional relations between them. Not all points form triangles, but many of them do. In the initial structure, I've got a database with the following tables: Nodes(id, value) Relations(id, nodeA, nodeB, value) Triangles(id, relation1_id, relation2_id, relation3_id) In order to generate triangles from both nodes and relations table, I've used the following query: INSERT INTO Triangles SELECT t1.id, t2.id , t3.id, FROM Relations t1, Relations t2, Relations t3 WHERE t1.id < t2.id AND t3.id > t1.id AND ( t1.nodeA = t2.nodeA AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeB OR t3.nodeA = t2.nodeB AND t3.nodeB = t1.nodeB) OR t1.nodeA = t2.nodeB AND (t3.nodeA = t1.nodeB AND t3.nodeB = t2.nodeA OR t3.nodeA = t2.nodeA AND t3.nodeB = t1.nodeB) ) It's working perfectly on small sized data. (~< 50 points) In some cases however, I've got around 100 points all related to each other which leads to thousands of relations. So when the expected number of triangles is in the hundreds of thousands, or even in the millions, the query might take several hours. My main problem is not in the select query, while I see it execute in Management Studio, the returned results slow. I received around 2000 rows per minute, which is not acceptable for my case. As a matter of fact, the size of operations is being added up exponentionally and that is terribly affecting the performance. I've tried doing it as a LINQ to object from my code, but the performance was even worse. I've also tried using SqlBulkCopy on a reader from C# on the result, also with no luck. So the question is... Any ideas or workarounds?

    Read the article

  • Better language or checking tool?

    - by rwallace
    This is primarily aimed at programmers who use unmanaged languages like C and C++ in preference to managed languages, forgoing some forms of error checking to obtain benefits like the ability to work in extremely resource constrained systems or the last increment of performance, though I would also be interested in answers from those who use managed languages. Which of the following would be of most value? A language that would optionally compile to CLR byte code or to machine code via C, and would provide things like optional array bounds checking, more support for memory management in environments where you can't use garbage collection, and faster compile times than typical C++ projects. (Think e.g. Ada or Eiffel with Python syntax.) A tool that would take existing C code and perform static analysis to look for things like potential null pointer dereferences and array overflows. (Think e.g. an open source equivalent to Coverity.) Something else I haven't thought of. Or put another way, when you're using C family languages, is the top of your wish list more expressiveness, better error checking or something else? The reason I'm asking is that I have a design and prototype parser for #1, and an outline design for #2, and I'm wondering which would be the better use of resources to work on after my current project is up and running; but I think the answers may be useful for other tools programmers also. (As usual with questions of this nature, if the answer you would give is already there, please upvote it.)

    Read the article

  • Can I write a .NETCF Partial Class to extend System.Windows.Forms.UserControl?

    - by eidylon
    Okay... I'm writing a .NET CF (VBNET 2008 3.5 SP1) application, which has one master form, and it dynamically loads specific UserControls based on menu click, in a sort of framework idea. There are certain methods and properties these controls all need to work within the app. Right now I am doing this as an Interface, but this is aggravating as all get up, because some of the methods are optional, and yet I MUST implement them by the nature of interfaces. I would prefer to use inheritance, so that I can have certain code be inherited with overridability, but if I write a class which inherits System.Windows.Forms.UserControl and then inherit my control from that, it squiggles, and tells me that UserControls MUST inherit directly from System.Windows.Forms.UserControl. (Talk about a design flaw!) So next I thought, well, let me use a partial class to extend System.Windows.Forms.UserControl, but when I do that, even though it all seems to compile fine, none of my new properties/methods show up on my controls. Is there any way I can use partial classes to 'extend' System.Windows.Forms.UserControl? For example, can anyone give me a code sample of a partial class which simply adds a MyCount As Integer readonly property to the System.Windows.Forms.UserControl class? If I can just see how to get this going, I can take it from there and add the rest of my functionality. Thanks in advance! I've been searching google, but can't find anything that seems to work for UserControl extension on .NET CF. And the Interface method is driving me crazy as even a small change means updating ALL the controls whether they need to 'override' the method or not.

    Read the article

  • Why does the WCF 3.5 REST Starter Kit do this?

    - by Brandon
    I am setting up a REST endpoint that looks like the following: [WebInvoke(Method = "POST", UriTemplate = "?format=json", BodyStyle = WebMessageBodyStyle.WrappedRequest, ResponseFormat = WebMessageFormat.Json)] and [WebInvoke(Method = "DELETE", UriTemplate = "?token={token}&format=json", ResponseFormat = WebMessageFormat.Json)] The above throws the following error: UriTemplateTable does not support '?format=json' and '?token={token}&format=json' since they are not equivalent, but cannot be disambiguated because they have equivalent paths and the same common literal values for the query string. See the documentation for UriTemplateTable for more detail. I am not an expert at WCF, but I would imagine that it should map first by the HTTP Method and then by the URI Template. It appears to be backwards. If both of my URI templates are: ?token={token}&format=json This works because they are equivalent and it then appears to look at the HTTP Method where one is POST and the other is DELETE. Is REST supposed to work this way? Why are the URI Template Tables not being sorted first by HTTP Method and then by URI Template? This can cause some serious frustrations when 1 HTTP Method requires a parameter and another does not, or if I want to do optional parameters (e.g. if the 'format' parameter is not passed, default to XML).

    Read the article

  • Getting Started: Silverlight 4 Business Application

    - by Eric J.
    With the arrival of VS 2010 and Silverlight 4, I decided it's time to look into Silverlight and understand how to build a 3-Tier business application. After several hours of searching for and reading documentation and tutorials, I'm thoroughly confused (and that doesn't happen easily). Here are some specific points I don't understand. I welcome guidance on any of them, and also would appreciate any references to a really good tutorial. Brad Abrahm's What is a .NET RIA services (written for Silverlight 3) seemed very promising, until I realized I don't have System.Web.Ria.dll on my system. Am I missing an optional download? Was this rolled into another DLL for Silverlight 4? Did this go away in favor of something else in Silverlight 4? This recent blog says to start from a Silverlight Business Application, remove unwanted stuff, create a WCF RIA services Class Library project, and copy files and references from the Business Application to the WCF RIA services project, while manually updating resource references (perhaps bug in B2 compiler). Is this really the right road to go down? It seems very clumsy. My requirements are to perform very simple CRUD on straightforward business objects. I'm looking forward to suggestions on how to do that the Silverlight 4 way.

    Read the article

  • Make function declarations based on function definitions

    - by Clinton Blackmore
    I've written a .cpp file with a number of functions in it, and now need to declare them in the header file. It occurred to me that I could grep the file for the class name, and get the declarations that way, and it would've worked well enough, too, had the complete function declaration before the definition -- return code, name, and parameters (but not function body) -- been on one line. It seems to me that this is something that would be generally useful, and must've been solved a number of times. I am happy to edit the output and not worried about edge cases; anything that gives me results that are right 95% of the time would be great. So, if, for example, my .cpp file had: i2cstatus_t NXTI2CDevice::writeRegisters( uint8_t start_register, // start of the register range uint8_t bytes_to_write, // number of bytes to write uint8_t* buffer = 0) // optional user-supplied buffer { ... } and a number of other similar functions, getting this back: i2cstatus_t NXTI2CDevice::writeRegisters( uint8_t start_register, // start of the register range uint8_t bytes_to_write, // number of bytes to write uint8_t* buffer = 0) for inclusion in the header file, after a little editing, would be fine. Getting this back: i2cstatus_t writeRegisters( uint8_t start_register, uint8_t bytes_to_write, uint8_t* buffer); or this: i2cstatus_t writeRegisters(uint8_t start_register, uint8_t bytes_to_write, uint8_t* buffer); would be even better.

    Read the article

  • What is the nicest way to parse this in C++ ?

    - by ereOn
    Hi, In my program, I have a list of "server address" in the following format: host[:port] The brackets here, indicate that the port is optional. host can be a hostname, an IPv4 or IPv6 address. port, if present can be a numeric port number or a service string (like: "http" or "ssh"). If port is present and host is an IPv6 address, host must be in "bracket-enclosed" notation (Example: [::1]) Here are some valid examples: localhost localhost:11211 127.0.0.1:http [::1]:11211 ::1 [::1] And an invalid example: ::1:80 // Invalid: Is this the IPv6 address ::1:80 and a default port, or the IPv6 address ::1 and the port 80 ? ::1:http // This is not ambigous, but for simplicity sake, let's consider this is forbidden as well. My goal is to separate such entries in two parts (obviously host and port). I don't care if either the host or port are invalid as long as they don't contain a : (290.234.34.34.5 is ok for host, it will be rejected in the next process); I just want to separate the two parts, or if there is no port part, to know it somehow. I tried to do something with std::stringstream but everything I come up to seems hacky and not really elegant. How would you do this in C++ ? I don't mind answers in C but C++ is prefered. Any boost solution is welcome as well. Thank you.

    Read the article

  • a way to use log4j pass values like java -DmyEnvVar=A_VALUE to my code

    - by raticulin
    I need to pass some value to enable certain code in may app (in this case is to optionally enable writing some stats to a file in certain conditions, but it might be anything generally). My java app is installed as a service. So every way I have thought of has some drawbacks: Add another param to main(): cumbersome as customers already have the tool installed, and the command line would need to be changed every time. Adding java -DmyEnvVar=A_VALUE to my command line: same as above. Set an environment variable: service should at least be restarted, and even then you must take care of what user is the service running under etc. Adding the property in the config file: I prefer not to have this visible on the config file so the user does not see it, it is something for debugging etc. So I thought maybe there is some way (or hack) to use log4j loggers to pass that value to my code. I have thought of one way already, although is very limited: Add a dummy class to my codebase com.dummy.DevOptions public class DevOptions { public static final Logger logger = Logger.getLogger(DevOptions.class); In my code, use it like this: if (DevOptions.logger.isInfoEnabled()){ //do my optional stuff } //... if (DevOptions.logger.isDebugEnabled()){ //do other stuff } This allows me to use discriminate among various values, and I could increase the number by adding more loggers to DevOptions. But I wonder whether there is a cleaner way, possibly by configuring the loggers only in log4j.xml??

    Read the article

  • problem linking vba modules in MS Access 2007

    - by Ted
    I am upgrading a database system from Access 2000 db to Access 2007, which communicates with several chemistry measuring devices(pH meter, scale, etc) via an RS 232 serial port. The first db consists of several modules containing vba code that enables the communications with the ports, as well as supports the code behind the forms in the second db. The user, or lab tech, navigates through the forms in the second db to interact with the lab devices, and also to generate the reports which display the info. from the devices. The reports are also part of the second db. The code works in Access 2000, but once I convert it to 2007, the code in the second db cannot find the function calls in the first db that dictate the progression from screen to screen. I have tried importing the modules into the second db, and I have tried linking them, but it still doesn't work. The error message is #438: "Object doesn't support this property or method." Any suggestions would be greatly appreciated. Here is the code for the first function that is not being called correctly: Description: ' This routine is used to return to the calling form and close the active form. ' ' Input: ' strFormCalled --- the active form ' strCallingForm --- the form that called the active form ' blnUnhideOrOpen --- whether to open or just unhide form Public Sub basReturnToCallingForm(ByVal strFormCalled As String, ByVal _ strCallingForm As Variant, Optional blnUnhideOrOpen As Boolean = True) On Error GoTo err_basReturnToCaliingForm If Not basIsBlankString(strCallingForm) And blnUnhideOrOpen Then DoCmd.OpenForm strCallingForm, acNormal Else Call basUnHideForm(strCallingForm) End If Call basCloseForm(strFormCalled) exit_basReturnToCaliingForm: Exit Sub err_basReturnToCaliingForm: Err.Raise Err.Number, "basReturnToCaliingForm", Err.Description End Sub I will post the second function shortly, but I have to go to a meeting... The second funtion that isn't 'working' is a cmdStartClick that is supposed to be called when a user initializes a pump. However, within that function, it's also sticking on a line that is supposed to progress to the next form in the db. The other thing is that the code works in Access 2002, but not in Access 2007...

    Read the article

  • Hibernate many-to-one - bad usage?

    - by DaveA
    Just trying out Hibernate (with Annotations) and I'm having problems with my mappings. I have two entity classes, AudioCD and Artist. @Entity public class AudioCD implements CatalogItem { @Id @GeneratedValue(strategy = GenerationType.AUTO) private int id; private String title; @ManyToOne(cascade = { CascadeType.ALL }, optional = false) private Artist artist; .... } @Entity @Table(uniqueConstraints = { @UniqueConstraint(columnNames = { "name" }) }) public class Artist { @Id @GeneratedValue(strategy = GenerationType.AUTO) private int id; @Column(nullable = false) private String name; ..... } I get AudioCD objects from an external source. When I try to persist the AudioCD the Artist gets persisted as well, just like I want to happen. If I try persisting another different CD, but Artist already exists I get errors due to constraint violations. I want Hibernate to recognise that the Artist already exists and shouldn't be inserted again. Can this be done via annotations? Or do I have to manage the persistence of the AudioCD and Artist seperately?

    Read the article

  • What's the difference between the [OptionalField] and [NonSerialized]

    - by IbrarMumtaz
    I came across this question on transcender: What should you apply to a field if its value is not required during deserialization? Me = [NonSerialized], ANSWER = [OptionalField] My gut reaction was NonSerialised, I have no idea why but in the space of 5 seconds thats what I thought but to my surprise, Transcender says I am wrong. OK fair enough .... but why? looking more closely at the question I have a good idea what to look out for as far as the [Nonseralized] attribute is concerned but still I would really like this clearing up. As far as I can tell the former has relationship with versioning conflicts between newer and older versions of the same assembly. The later is more concerned with not serializing a field FULLSTOP. Is there anything else that might pick these two apart? MSDN does not really say much about this as they both are used on the BinaryFormatters and SoapFormatter with the XMLFormatter using the XMLIgnoreAttribute. My second question is can you mix and match either one of the two attributes ... I am yet to use them as I have not had an excuse to mess about with them. So my curiosity can only go so far. Just throwing this one out there, but does my answer have something to do with the way [OnDeserialized] and the IdeserilizationCallback interface is implemented???? Am guessing here .... Thanks In Advance UPDATE: I know that optional field attribute does not serialize the value held by a data member but NonSerialized will not even serialise the data member or its value. That sounds about a right???? That's all I got on these two attributes.

    Read the article

  • Evaluating creation of GUI via file vs coding

    - by nevets1219
    I'm working on a utility that will be used to test the project I'm currently working on. What the utility will do is allow user to provide various inputs and it will sends out requests and provide the response as output. However, at this point the exact format (which input is required and what is optional) has yet to be fleshed out. In addition, coding in Swing is somewhat repetitive since the overall work is simple though this should be the safest route to go as I have more or less full control and every component can be tweaked as I want. I'm considering using a configuration file that's in XML to describe the GUI (at least one part of it) and then coding the event handling part (in addition to validation, etc). The GUI itself shouldn't be too complicated. For each type of request to make there's a tab for the request and within each tab are various inputs. There seems to be quite a few questions about this already but I'm not asking for a 3rd party library to do this. I'm looking to do this myself, since I don't think it'll be too overly complicated (hopefully). My main consideration for using this is re-usability (later on, for other projects) and for simplifying the GUI work. My question is: are there other pros/cons that I'm overlooking? Is it worth the (unknown) time to do this? I've built GUI in VB.NET and with Flex3 before.

    Read the article

  • Source code dependency manager for C++

    - by 7vies
    There are already some questions about dependency managers here, but it seems to me that they are mostly about build systems, while I am looking for something targeted purely at making dependency tracking and resolution simpler (and I'm not necessarily interested in learning a new build system). So, typically we have a project and some common code with another project. This common code is organized as a library, so when I want to get the latest code version for a project, I should also go get all the libraries from the source control. To do this, I need a list of dependencies. Then, to build the project I can reuse this list too. I've looked at Maven and Ivy, but I'm not sure if they would be appropriate for C++, as they look quite heavily java-targeted (even though there might be plugins for C++, I haven't found people recommending them). I see it as a GUI tool producing some standardized dependency list which can then be parsed by different scripts etc. It would be nice if it could integrate with source control (tag, get a tagged version with dependencies etc), but that's optional. Would you have any suggestions? Maybe I'm just missing something, and usually it's done some other way with no need for such a tool? Thanks.

    Read the article

  • how to unzip uploaded zip file?

    - by Jaydeepsinh Jadeja
    I am trying to upload a zipped file using codeigniter framework with following code function do_upload() { $name=time(); $config['upload_path'] = './uploadedModules/'; $config['allowed_types'] = 'zip|rar'; $this->load->library('upload', $config); if ( ! $this->upload->do_upload()) { $error = array('error' => $this->upload->display_errors()); $this->load->view('upload_view', $error); } else { $data = array('upload_data' => $this->upload->data()); $this->load->library('unzip'); // Optional: Only take out these files, anything else is ignored $this->unzip->allow(array('css', 'js', 'png', 'gif', 'jpeg', 'jpg', 'tpl', 'html', 'swf')); $this->unzip->extract('./uploadedModules/'.$data['upload_data']['file_name'], './application/modules/'); $pieces = explode(".", $data['upload_data']['file_name']); $title=$pieces[0]; $status=1; $core=0; $this->addons_model->insertNewModule($title,$status,$core); } } But the main problem is that when extract function is called, it extract the zip but the result is empty folder. Is there any way to overcome this problem?

    Read the article

  • iPhone AES encryption issue

    - by Dilshan
    Hi, I use following code to encrypt using AES. - (NSData*)AES256EncryptWithKey:(NSString*)key theMsg:(NSData *)myMessage { // 'key' should be 32 bytes for AES256, will be null-padded otherwise char keyPtr[kCCKeySizeAES256 + 1]; // room for terminator (unused) bzero(keyPtr, sizeof(keyPtr)); // fill with zeroes (for padding) // fetch key data [key getCString:keyPtr maxLength:sizeof(keyPtr) encoding:NSUTF8StringEncoding]; NSUInteger dataLength = [myMessage length]; //See the doc: For block ciphers, the output size will always be less than or //equal to the input size plus the size of one block. //That's why we need to add the size of one block here size_t bufferSize = dataLength + kCCBlockSizeAES128; void* buffer = malloc(bufferSize); size_t numBytesEncrypted = 0; CCCryptorStatus cryptStatus = CCCrypt(kCCEncrypt, kCCAlgorithmAES128, kCCOptionPKCS7Padding, keyPtr, kCCKeySizeAES256, NULL /* initialization vector (optional) */, [myMessage bytes], dataLength, /* input */ buffer, bufferSize, /* output */ &numBytesEncrypted); if (cryptStatus == kCCSuccess) { //the returned NSData takes ownership of the buffer and will free it on deallocation return [NSData dataWithBytesNoCopy:buffer length:numBytesEncrypted]; } free(buffer); //free the buffer; return nil; } However the following code chunk returns null if I tried to print the encryptmessage variable. Same thing applies to decryption as well. What am I doing wrong here? NSData *encrData = [self AES256EncryptWithKey:theKey theMsg:myMessage]; NSString *encryptmessage = [[NSString alloc] initWithData:encrData encoding:NSUTF8StringEncoding]; Thank you

    Read the article

  • Perl, Net::Traceroute::PurePerl return value

    - by John R
    This is a sub routine that I copied from CPAN. It works fine as it is when I run it from the command line. I have a similar function from Net::Traceroute that also works fine AND allows me to return the string with a SOAP call. The problem comes when I try to return the ~string(?) from the function below with a SOAP call. sub tr { use Net::Traceroute::PurePerl; my $t = new Net::Traceroute::PurePerl( backend => 'PurePerl', # this optional host => 'www.whatever.com', debug => 0, max_ttl => 30, query_timeout => 2, packetlen => 40, protocol => 'udp', # Or icmp ); $t->traceroute; $t->pretty_print; return $t; #print $t; } The output looks like a string except the last part of the string looks like this: 28 * * * 29 * * * 30 * * * Net::Traceroute::PurePerl=HASH(0x11fa6bf0) I don't know what is different about Net::Traceroute::PurePerl that won't allow me to return the value with SOAP since the Net::Traceroute version does allow me to return it with SOAP.

    Read the article

  • What are the first steps in C#/.NET development?

    - by paxdiablo
    Okay, I'm biting the bullet and deciding to get into the whole Microsoft/C#/.NET culture and I'm going to do this by putting together a simple (hah!) application. It will basically be an application in which I want to store images and associate with them other optional things. It must be able to import images from the filesystem (and hopefully camera/scanner) then allow the user to add text, audio and other information. I plan to store the images and auxillary information into a database. What the application will do with said data isn't important (yet). Keep in mind I know absolutely nothing about C# or .NET although, as an old codger, I know a great deal about many other things and will regale you with stories and anecdotes until you quietly slip away :-) What are the first steps to take in developing such an application? I've already set out UI layouts and likely process flows although it may be that the development environment dictates changes. Development environment is currently XP SP3 + VS2008 (though I can upgrade if absolutely necessary). What should I be looking at as the first step? Are there any gotchas I should be looking out for?

    Read the article

< Previous Page | 213 214 215 216 217 218 219 220 221 222 223 224  | Next Page >