Search Results

Search found 41095 results on 1644 pages for 'empty string'.

Page 22/1644 | < Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >

  • Can You Have "Empty" Abstract/Classes?

    - by ShrimpCrackers
    Of course you can, I'm just wondering if it's rational to design in such a way. I'm making a breakout clone and was doing some class design. I wanted to use inheritance, even though I don't have to, to apply what I've learned in C++. I was thinking about class design and came up with something like this: GameObject - base class (consists of data members like x and y offsets, and a vector of SDL_Surface* MovableObject : GameObject - abstract class + derived class of GameObject (one method void move() = 0; ) NonMovableObject : GameObject - empty class...no methods or data members other than constructor and destructor(at least for now?). Later I was planning to derive a class from NonMovableObject, like Tileset : NonMovableObject. I was just wondering if "empty" abstract classes or just empty classes are often used...I notice that the way I'm doing this, I'm just creating the class NonMovableObject just for sake of categorization. I know I'm overthinking things just to make a breakout clone, but my focus is less on the game and more on using inheritance and designing some sort of game framework.

    Read the article

  • Interpretation of empty User-agent

    - by Amit Agrawal
    How should I interpret a empty User-agent? I have some custom analytics code and that code has to analyze only human traffic. I have got a working list of User-agents denoting human traffic, and bot traffic, but the empty User-agent is proving to be problematic. And I am getting lots of traffic with empty user agent - 10%. Additionally - I have crafted the human traffic versus bot traffic user agent list by analyzing my current logs. As such I might be missing a lot of entries in there. Is there a well maintained list of user agents denoting bot traffic, OR the inverse a list of user agents denoting human traffic?

    Read the article

  • How to remove empty tables from a MySQL backup file.

    - by user280708
    I have multiple large MySQL backup files all from different DBs and having different schemas. I want to load the backups into our EDW but I don't want to load the empty tables. Right now I'm cutting out the empty tables using AWK on the backup files, but I'm wondering if there's a better way to do this. If anyone is interested, this is my AWK script: EDIT: I noticed today that this script has some problems, please beware if you want to actually try to use it. Your output may be WRONG... I will post my changes as I make them. # File: remove_empty_tables.awk # Copyright (c) Northwestern University, 2010 # http://edw.northwestern.edu /^--$/ { i = 0; line[++i] = $0; getline if ($0 ~ /-- Definition/) { inserts = 0; while ($0 !~ / ALTER TABLE .* ENABLE KEYS /) { # If we already have an insert: if (inserts > 0) print else { # If we found an INSERT statement, the table is NOT empty: if ($0 ~ /^INSERT /) { ++inserts # Dump the lines before the INSERT and then the INSERT: for (j = 1; j <= i; ++j) print line[j] i = 0 print $0 } # Otherwise we may yet find an insert, so save the line: else line[++i] = $0 } getline # go to the next line } line[++i] = $0; getline line[++i] = $0; getline if (inserts > 0) { for (j = 1; j <= i; ++j) print line[j] print $0 } next } else { print "--" } } { print }

    Read the article

  • Setting collation property in the connection string to SQL Server 2005

    - by user369745
    I have a ASP.Net web application with connection string for SQL Server 2005 in the web.config. Data Source=ABCSERVER;Network Library=DBMSSOCN;Initial Catalog=myDataBase; User ID=myUsername;Password=myPassword; I want to specify the collation property in the web.config for different languages like French like Data Source=ABCSERVER;Network Library=DBMSSOCN;Initial Catalog=myDataBase; User ID=myUsername;Password=myPassword;Collation=French_CS_AS But the Collation word is not valid in the connection string. What is the correct keyword that we need to use to specify the collation in SQL Server 2005 connection string?

    Read the article

  • Additional spaces in String having read text file to String using FileInputStream

    - by David
    Hi, I'm trying to read in a text file to a String variable. The text file has multiple lines. Having printed the String to test the "read-in" code, there is an additional space between every character. As I am using the String to generate character bigrams, the spaces are making the sample text useless. The code is try{ FileInputStream fstream = new FileInputStream(textfile); DataInputStream in = new DataInputStream(fstream); BufferedReader br = new BufferedReader(new InputStreamReader(in)); //Read corpus file line-by-line, concatenating each line to the String "corpus" while ((strLine = br.readLine()) != null) { corpus = (corpus.concat(strLine)); } in.close(); //Close the input stream } catch (Exception e) {//Catch exception if any System.err.println("Error test check: " + e.getMessage()); } I'd be grateful for any advice. Thanks.

    Read the article

  • sed: delete text between a string until first occurrence of another string

    - by Marit Hoen
    Imagine I have something like the following text: The quick brown fox jumps in 2012 and 2013 And I would wish to delete the part from "fox" including the four numbers but only in the first occurrence so I end up with: The quick brown and 2013 Something likes this...: echo "The quick brown fox jumps in 2012 and 2013" \ | sed "s/fox.*\([0-9]\{4\}\)//g" ...brings me: The quick brown So it removed everything including the last occurrence of the four numbers. Any ideas?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Best way to create SEO friendly URI string

    - by Mat Banik
    The method below allows only "0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ-" chars in URI strings. What better way is there to make nice SEO URI string? import org.apache.commons.lang.StringUtils; public static String safeChar(String input) { input = input.trim(); input = StringUtils.replace(input, " -", "-"); input = StringUtils.replace(input, "- ", "-"); input = StringUtils.replace(input, " - ", "-"); input = StringUtils.replaceChars(input, '\'', '-'); input = StringUtils.replaceChars(input, ' ', '-'); char[] allowed = "0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ-".toCharArray(); char[] charArray = input.toCharArray(); StringBuilder result = new StringBuilder(); for (char c : charArray) { for (char a : allowed) { if (c == a) result.append(a); } } return result.toString(); }

    Read the article

  • Dictionary<string,string> to Dictionary<Control,object> using IEnumerable<T>.Select()

    - by abatishchev
    I have a System.Collections.Generic.Dictionary<string, string> containing control ID and appropriate data column to data bind: var dic = new Dictionary<string, string> { { "Label1", "FooCount" }, { "Label2", "BarCount" } }; I use it that way: var row = ((DataRowView)FormView1.DataItem).Row; Dictionary<Control, object> newOne = dic.ToDictionary( k => FormView1.FindControl(k.Key)), k => row[k.Value]); So I'm using IEnumerable<T>.ToDictionary(Func<T>, Func<T>). Is it possbile to do the same using IEnumerable<T>.Select(Func<T>) ?

    Read the article

  • How to pass a very long string/file into RESTWebservice JAX-RS Jersey

    - by Sashikiran Challa
    Hello All, I am trying to write a webservice that takes in an XML string, does parsing of it using DOM and extract particular things I want. My XML string happens to be very long so I do not want to pass it as a @QueryParam or @PathParam. Say If I write that XML string into a file, How do I go about writing a RESTful service that takes in this file, extracts whatever I want and return the results. I am actually trying to extract some number of strings, so my output should probably be an ArrayList having all these strings. Could somebody please shed some light on how I should go about doing this. Thanks in advance

    Read the article

  • MATLAB: dealing with java.lang.String

    - by Jason S
    I seem to be stuck in Kafka-land, with a java.lang.String that I can't seem to use in MATLAB functions: K>> name name = Jason K>> sprintf('%s', name) ??? Error using ==> sprintf Function is not defined for 'java.lang.String' inputs. K>> ['my name is ' name] ??? Error using ==> horzcat The following error occurred converting from char to opaque: Error using ==> horzcat Undefined function or method 'opaque' for input arguments of type 'char'. how can I get a java.lang.String to convert to a regular MATLAB character array?

    Read the article

  • Convert From Custom List to List of String

    - by Paul Johnson
    Hi all I have the following code: Public Shared Function ConvertToString(ByVal list As IList) As String Dim strBuilder = New System.Text.StringBuilder() Dim item As Object For Each item In list strBuilder.Append(obj.ToString()) strBuilder.Append(",") Next Return strBuilder.ToString(strBuilder.Length - 1) End Function The intention is to convert an IList of custom objects to a string equivalent comprising each element in the Ilist. Unfortunately I can't seem to find a way to get the underlying data of the custom object, and of course as in the above example, using object simply gives me a string of types definitions, rather than access to the underlying data. Any assistance much appreciated. Paul.

    Read the article

  • Visual Studio does not flag unterminated string constant in VB.Net

    - by JoelFan
    I noticed that if I leave off the terminating double quote for a string constant in Visual Studio 2010, there is no error or even a warning, i.e. Dim foo as String = "hi However, the continuous integration tool we are using flags an error: error BC30648: String constants must end with a double quote. What's going on here? Is there some language rule in VB.NET that makes a terminating double quote optional "sometimes"? Is there some setting in Visual Studio that will make it flag this as an error?

    Read the article

  • Sending a JSON array to be received as a Dictionary<string,string>

    - by James Bond
    I have a method with the following signature: public ActionResult RenderFamilyTree(string name, Dictionary<string, string> children) I'm trying to call it from javascript using jQuery like this: $('#div_render').load( "<%= Url.Action("RenderFamilyTree") %>", { 'name': 'Raul', [ {'key':'key1','value':'value1'}, {'key':'key2','value':'value2'} ] }, function() { alert('Loaded'); } ); Am I missing something to get this to work?

    Read the article

  • Replace letters in a secret text

    - by kame
    Hello! I want to change every letter in a text to after next following letter. But this program doesnt work. Does anyone know why. Thanks in advance. There is also a minor problem with y and z. import string letters = string.ascii_lowercase text=("g fmnc wms bgblr rpylqjyrc gr zw fylb. rfyrq ufyr amknsrcpq ypc dmp. bmgle gr gl zw fylb gq glcddgagclr ylb rfyr'q ufw rfgq rcvr gq qm jmle. sqgle qrpgle.kyicrpylq() gq pcamkkclbcb. lmu ynnjw ml rfc spj. ") for x in range(1,24): text.replace(letters[x],letters[x+2]) print(text)

    Read the article

  • checking last char of string in c

    - by radar75
    If I have two types of strings as: const char *str1 = "This is a string with \"quotes escaped at the end\""; const char *str2 = "This is a \"string\" without quotes at the end"; testFn(str1); testFn(str2); int testFn(char *str) { // test & return 1 if ends on no quote // test & return 0 if ends on quote return; } I would like to test if the string ends with a quote " or not What would be a good way of testing this? Thanks

    Read the article

  • Substring and its reverse in a string

    - by christa
    My professor was talking about this in a Dynamic programming class and asked us to think over it. She gave us some examples as well. Given a string, we were to find the longest continuous subsequence whose reverse is also a subsequence present in the given string. Example: INPUT: pqrstuvtsrv OUTPUT: i=3, k=2 rst -> tsr (rst found first at i=3 and for 2 more positions) INPUT: mpqrsrqp OUTPUT: i=2, k=6 pqrsrqp in reverse INPUT: mmpqssss OUTPUT: i=5, k=3 I thought of putting the string and its reverse into 2 different arrays and comparing character by character. But I'm sure this is not the best way to do it. Any suggestions as to what could be the most efficient ?

    Read the article

  • iBatis mapping: map a string field into a List<String>

    - by Roberto
    Hi all, is it possible to map a string field with a particular format like: aaa,bbb,ccc,ddd into a List having elements [aaa, bbb, ccc, ddd] using iBatis? What I need is to have in my model something like: public class Request{ private List<String> fieldOne; public List<String> getFieldOne(){....} public void setFieldOne(){....} } even if in my table the field is a simple string. Is this possible? Thanks Roberto

    Read the article

  • Getting Dictionary<string,string> from List<Control>

    - by codymanix
    I want a dictionary containing the names and text of all controls. Is it possible with predefined framework methods/LINQ/colection initializers or do I have to make a loop and add all entries by myself? This gives me an error message: List<Control> controls; // .. initialize list .. controls.ToDictionary((Control child,string k)=>new KeyValuePair<string,string>(child.Name, child.Text));

    Read the article

  • The method split(String) is undefined for the type String

    - by pi
    I am using Pulse - the Plugin Manager for Eclipse and installed. I have the Eclipse 3.5 for mobile development(Pulsar) profile with a couple other profiles. I realized that the split() method called on a string from code such as below: String data = "one, two, three, four"; data.split(","); generates the error: "The method split(String) is undefined for the type String". I am aware that the split() method did not exist before Java's JRE 1.4 and perhaps could be the cause of the problem. The problem is I don't think I have jre/sdk versions installed. Perhaps there's one in-built with the Pulsar profile and needs editing - but I couldn't tell what settings (and where) needs tweaking. I have checked WindowsPreferencesJavaInstalled JREs and it's set to = jre1.4. Please help thanks.

    Read the article

  • Parsing a DateTime String into Custom Date and Time Format String

    - by AMissico
    With .NET, I have "Thursday, April 10, 2008 1:30:00 PM" and I want "dddd, dd MMMM, yyyy h:m:s t", "6:09:01 PM" and want ""hh:mm:ss tt", "Fri 29 Aug" and want "ddd d MMM", and so on. It seems I should be able to use DateTimeFormatInfo in some way. I figured I can format the date with each pattern returned by GetAllDateTimePatterns, and when the original date string and the formated date string match then I have the format. Yet, I want to generate custom formats, not the standard formats. I want the format string. I do not want the date. I have both the DateTime value and the formatted string value for the date. I need <formatString> as in ToString(<formatString>).

    Read the article

  • binary file to string

    - by andrew
    i'm trying to read a binary file (for example an executable) into a string, then write it back FileStream fs = new FileStream("C:\\tvin.exe", FileMode.Open); BinaryReader br = new BinaryReader(fs); byte[] bin = br.ReadBytes(Convert.ToInt32(fs.Length)); System.Text.Encoding enc = System.Text.Encoding.ASCII; string myString = enc.GetString(bin); fs.Close(); br.Close(); System.Text.ASCIIEncoding encoding = new System.Text.ASCIIEncoding(); byte[] rebin = encoding.GetBytes(myString); FileStream fs2 = new FileStream("C:\\tvout.exe", FileMode.Create); BinaryWriter bw = new BinaryWriter(fs2); bw.Write(rebin); fs2.Close(); bw.Close(); this does not work (the result has exactly the same size in bytes but can't run) if i do bw.Write(bin) the result is ok, but i must save it to a string

    Read the article

  • IsDouble check for string in Vb.net?

    - by James123
    I will get data in DataTable. I am going to iterate data in foreach. I will have all types of data in Datatable. Now I need to find Double for each item (string) in DataTable. How to find IsDouble for string? Ex: I have "21342.2121" string. I need to covert this to Double. But sometimes the data will be "TextString". So I can't use Double.Parse(). How to handle this?

    Read the article

  • Hyphenate a random string to an exact format

    - by chrissygormley
    Hello, I am creating a random ID using the below code: from random import * import string # The characters to make up the random password chars = string.ascii_letters + string.digits def random_password(): return "".join(choice(chars) for x in range(32)) This will output something like: 60ff612332b741508bc4432e34ec1d3e I would like the format to be in this format: 60ff6123-32b7-4150-8bc4-432e34ec1d3e I was looking at the .split() method but can't see how to do this with a random id, also the hyphen's must be at these places so splitting them by a certain amount of digits is out. I'm asking is there a way to split these random id's by 8 number's then 4 etc. Thanks

    Read the article

< Previous Page | 18 19 20 21 22 23 24 25 26 27 28 29  | Next Page >