Search Results

Search found 7914 results on 317 pages for 'valid xhtml'.

Page 221/317 | < Previous Page | 217 218 219 220 221 222 223 224 225 226 227 228  | Next Page >

  • how to run frame one after the other

    - by user1758401
    I am developing an application where the valid user gets access to the main application. But a problem arises when I run main class. The LoginFrame and Main(Editor.java) Frame start simultaneously. I want to first validate the user and then direct the user to the main application. I am calling Loginform.java from my main application (i.e Editor.java) java.awt.EventQueue.invokeLater(new Runnable() { public void run() { new Login().setVisible(true); { Editor x = new Editor(); x.setVisible(true); } } });

    Read the article

  • How do I select only the 4th and higher LIs in each UL?

    - by KatieK
    For this XHTML: <ul class="collapse"> <li>One</li> <li>Two</li> <li>Three</li> <li>Four</li> <li>Five</li> </ul> <ul class="collapse"> <li>1</li> <li>2</li> <li>3</li> <li>4</li> </ul> Using jQuery, how do I select only the 4th and higher LIs in each UL? I've tried: $("ul.collapse li:gt(2)").css("color", "red"); But it selects the 4th and higher LIs in the whole document. "Four", "Five", and "1", "2", "3", "4" are red.

    Read the article

  • ActiveRecord bug? Or am I getting it wrong? (validates_presence_of if)

    - by Dmitriy Likhten
    Ok: User attr_accessible :name, :email, :email_confirmation validates_presence_of :email_confirmation if :email_changed? What happens in the following situation: u = User.find 1 u.name = 'Fonzi' u.name_changed? # => true u.email_changed? # => false u.valid? # => false : email_confirmation is required Basically, if I change if to unless the validates works as expected, won't validate if the email has not changed, will validate if the email changed. I thought the IF indicates "run this validation if the following function returns true. Seems to work backwards!? Am I just getting it wrong?

    Read the article

  • How should I display invalid options?

    - by mafutrct
    I've got a WinForms client-server app that displays various offers in a list. Every user (client) has a "rating". An offer consists of various data including a minimum and maximum rating. If a user's rating does not fall in that interval, he should not be able to take the offer. Of course I could just perform some server filtering and send a list of offers prefiltered for each user to the client application. But that would surely, and rightfully, lead to confused requests "Why isn't this offer showing up? I know it exists, it shows up on [other user]'s screen." How should I handle this? My favorite solution so far is to grey out the offer and add a tooltip "You can't take this offer because your rating is too high/low" while displaying greyed-out offers at the bottom of the list to leave the actually valid offers easily visible on top of the list.

    Read the article

  • C++ - Efficient container for large amounts of searchable data?

    - by Francisco P.
    Hello, everybody! I am implementing a text-based version of Scrabble for a College project. My dictionary is quite large, weighing in at around 400.000 words (std::string). Searching for a valid word will suck, big time, in terms of efficiency if I go for a vector<string> ( O(n) ). Are there any good alternatives? Keep in mind, I'm enrolled in freshman year. Nothing TOO complex! Thanks for your time! Francisco

    Read the article

  • Conditional Branching Issues

    - by Zack
    Here is the code: def main_menu print_main_menu user_selected = gets.chomp if user_selected.downcase == "no" main_menu elsif user_selected == "1" || "2" || "3" || "4" || "5" || "6" || "7" user_selected = user_selected.to_i call_option(user_selected) else main_menu end end This code uses calls to allow a user to make a selection from a main menu. Depending on the input, be it a certain number, a certain word, or something else, the respective method is called (in the case of a valid input) or the main menu is printed again (in the case of an invalid input or "no"). My questions are twofold. 1) Is there an efficient way to get rid of the literal string error that appears as a result of this redundant or statement on the elsif line? (the code itself works fine, but this error appears and is frustrating). 2) When an alternate/unspecified input is made by the user, the else branch doesn't execute and main_method doesn't start over. I have no idea why this is happening. Is there something I'm missing here? Thanks

    Read the article

  • MultiThreading question

    - by TiGer
    Hi, I am developing on Android but the question might be just as valid on any other Java platform. I have developed a multi-threaded app. Lets say I have a first class that needs to do a time-intensive task, thus this work is done in another Thread. When it's done that same Thread will return the time-intensive task result to another (3rd) class. This last class will do something and return it's result to the first-starting class. I have noticed though that the first class will be waiting the whole time, maybe because this is some kind of loop ? Also I'd like the Thread-class to stop itself, as in when it has passed it's result to the third class it should simply stop. The third class has to do it's work without being "incapsulated" in the second class (the Thread one). Anyone knows how to accomplish this ? right now the experience is that the first one seems to be waiting (hanging) till the second and the third one are done :(

    Read the article

  • How do I use a graphics method to pass parameters? Example is below.

    - by sonny5
    private static void getCorners(out float Wx, out float Wy, out float Vx, out float Vy) { // note-- I don't know how to flip the Y axis using this method... this is not a "graphics" method // In other words, I should use something like: // flipY(object sender, System.EventArgs e); // but don't know the syntax or whatever // I tried to do this: //Graphics g = this.CreateGraphic //Matrix myMatrix2 = new Matrix(1, 0, 0, -1, 0, 0); // flip Y axis //g.Transform = myMatrix2; //g.TranslateTransform(0, 480, MatrixOrder.Append); // ...but I get the error: // error CS0026: Keyword 'this' is not valid in a static property, static method, or // static field initializer Wx = 1.00F; Wy = 1.00F; // make this 1.00 (not 3.00F) down from the TOP since cannot get Y flipped Vx = ((Wx- WXmin)*((VXmax-VXmin)+VXmin)/(WXmax-WXmin)); Vy = ((Wy-WYmin)*(VYmax-VYmin)/(WYmax-WYmin)+VYmin); } thanks, Sonny5

    Read the article

  • set the size of the tooltip dialog box depending on the text

    - by xrx215
    How do i set the size of the tooltip dialog box. the tooltip text must be displayed in one line rather than wrapping the text to other line. in firefox tooltip text is showed in one line but in IE the tooltip text is wrapped . i.e text is displayed in 2 lines. asp:Image runat="server" ID="iUrl" Visible="false" ImageUrl="~/Widgets/FMP_Printers/images/status icons/icon_Fault_Enabled.gif" / if (txtUrl.Text.ToUpper().IndexOf("HTTP://") < 0 && txtUrl.Text.ToUpper().IndexOf("HTTPS://") < 0) { iUrl.Visible = true; iUrl.ToolTip = "ghghghghghghghghghghghghghghghghghghghghghghghghghghghghghghghgh"; valid = false; }

    Read the article

  • Yet another URL prefix regex question (to be used in C#).

    - by Hamish Grubijan
    Hi, I have seen many regular expressions for Url validation. In my case I want the Url to be simpler, so the regex should be tighter: Valid Url prefixes look like: http[s]://[www.]addressOrIp[.something]/PageName.aspx[?] This describe a prefix. I will be appending ?x=a&y=b&z=c later. I just want to check if the web page is live before accessing it, but even before that I want to make sure that it is properly configured. I want to treat bad url and host is down conditions differently, although when in doubt, I'd rather give a host is down message, because that is an ultimate test anyway. Hopefully that makes sense. I guess what I am trying to say - the regex does not need be too aggressive, I just want it to cover say 95% of the cases. This is C# - centric, so Perl regex extensions are not helpful to me; let's stick to the lowest common denominator. Thanks!

    Read the article

  • problem with sql statement using vb.net

    - by newBie
    hi i got some problem i got this 3 line statement: Dim infoID As Integer = objCommand1.ExecuteScalar() Dim strSQL2 As String = "insert into feedBackHotel (infoID, feedBackView) values(" + infoID + ",'" + FeedBack + "')" Dim objCommand2 As New SqlCommand(strSQL2, conn) objCommand2.ExecuteNonQuery() the problem here is..the strSQL2 can capture the infoID from previous statement, but it didnt insert into the database. it will pop out this error "Conversion from string "insert into feedBackHotel (infoI" to type 'Double' is not valid." in both table related, use same data type (int) but for the feedBackHotel's infoID i allow it to be null..bcoz if i make it not null, it will show another error.. im using vb.net ..can anyone help?

    Read the article

  • In a shared .iml file, what should the jdkName be for an IntelliJ IDEA Plugin SDK?

    - by bolinfest
    I work on a team where we commit our .iml files in version control so that everyone can use them. We have an .iml file for a plugin module, which includes the following: <orderEntry type="jdk" jdkName="IDEA IC-117.798" jdkType="IDEA JDK" /> however, that only works for people who are using that version (IC-117.798) of IntelliJ (some are on 12, some are using the ultimate edition, etc.) Is there any sort of variable like $INTELLIJ_SDK that could be used for the value of jdkName so that the .iml file is valid regardless of which version of IntelliJ you are using?

    Read the article

  • How do i view the index version of a file before it is committed?

    - by lsiden
    I have just performed add --interactive, so the index version of some files is different than the working-directory versions. Instead of doing diff --cached, I want to actually dump the contents of each file in the index, but I can't find a command to do that. I should think that there would be something like "git show INDEX:filename...", but "INDEX" is not a valid object name. I was able to do git ls --cached, then git show , but there should be a more straightforward method to see what you are committing.

    Read the article

  • .NET Regex - need matching string for parsing...

    - by TomTom
    Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

    Read the article

  • About Attributes member of LUID_AND_ATTRIBUTES used in TOKEN_PRIVILEGES structure

    - by Astaroth
    MSDN article, Enabling and Disabling Privileges in C++, provided the a code example to show how to enable or disable a privilege in an access token. I quote the part in questioned: tp.PrivilegeCount = 1; tp.Privileges[0].Luid = luid; if (bEnablePrivilege) tp.Privileges[0].Attributes = SE_PRIVILEGE_ENABLED; else tp.Privileges[0].Attributes = 0; What is the meaning of zero value for Attributes member? According to the documentation of TOKEN_PRIVILEGES structure, the attributes of a privilege can be a combination of the following values: SE_PRIVILEGE_ENABLED  (it is 0x00000002L in WinNT.h) SE_PRIVILEGE_ENABLED_BY_DEFAULT  (it is 0x00000001L in WinNT.h) SE_PRIVILEGE_REMOVED  (it is 0x00000004L in WinNT.h) SE_PRIVILEGE_USED_FOR_ACCESS  (it is 0x80000000L in WinNT.h) So, we don't see any valid constant with a value of zero. I guess, the zero is equal to SE_PRIVILEGE_REMOVED. Anybody here could explain what the zero value really does?

    Read the article

  • Create set of random JPGs

    - by Kylar
    Here's the scenario, I want to create a set of random, small jpg's - anywhere between 50 bytes and 8k in size - the actual visual content of the jpeg is irrelevant as long as they're valid. I need to generate a thousand or so, and they all have to be unique - even if they're only different by a single pixel. Can I just write a jpeg header/footer and some random bytes in there? I'm not able to use existing photos or sets of photos from the web. The second issue is that the set of images has to be different for each run of the program. I'd prefer to do this in python, as the wrapping scripts are in Python. I've looked for python code to generate jpg's from scratch, and didn't find anything, so pointers to libraries are just as good.

    Read the article

  • How can I filter out the "My Computer"-option in a SWT DirectoryDialog?

    - by Superfisi
    Hello *, in our Eclipse RCP application running on Windows XP we use a DirectoryDialog, in which the user should... ahmm... choose a directory! :D The problem is: If the user selects the "My Computer"-option (in German Windows "Arbeitsplatz") the Dialog returns null. The DirectoryDialog provides a method setFilterPath(String path) in which I put the File.pathSeparatorChar (to remain OS-independant). My suggestion was that if there has to be a file separator in the directory the "My Computer"-option would be ignored cause it is null - for example the "OK"-button would be greyed out or sth. like that... but it is also valid to klick "OK". Any suggestions from your side? :D Thanks in advance! Alex

    Read the article

  • mysql fetch error

    - by Luke
    <? $res = $database->userLatestStatus($u); while($row=mysql_fetch_assoc($res)){ $status=$row['status']; echo "$status"; } ?> This is the code on my page, which is throwing up the following error: Warning: mysql_fetch_assoc(): supplied argument is not a valid MySQL result resource.... The database function: function userLatestStatus($u) { $q = "SELECT status FROM ".TBL_STATUS." WHERE userid = '$u' DESC LIMIT 1"; return mysql_query($q, $this->connection); } Any ideas what the problem is?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Implementing an iterator over binary tree using C++ 11

    - by user1459339
    I would like to create an iterator over the binary tree so as to be able to use range-based for loop. I understand I ought to implement the begin() and end() function first. Begin should probably point to the root. According to the specification, however, the end() functions returns "the element following the last valid element". Which element (node) is that? Would it not be illegal to point to some "invalid" place? The other thing is the operator++. What is the best way to return "next" element in tree? I just need some advice to begin with this programming.

    Read the article

  • Do not want Form to display over other application windows

    - by Cat
    I am displaying a Form from one process by passing the Show method a window handle from another process. I only want this new Form to display above the passed Form, like a MessageBox. However, this newly launched Form appears above other application windows, despite: Setting Process.WindowStyle.Hidden to the Form-displaying process Overriding the ShowWithoutActivation and CreateParams properties of the Form. Making sure Form.TopMost is not true I have checked that the window handle is valid from the second process. Focus is not stolen, however. Process A: Pass (Form) window handle to a new Process B via the command line Process B: Display a new Form using Form.Show(anotherProcessWindowHandle)

    Read the article

  • VC++ to C# migration guidelines/approaches/Issues

    - by KSH
    Hi all, We are planning to move few of our VC++ Legacy products to C# with .NET platform.. I am in the process of collecting the relavent information before making the proposal to give optimistic and effective approach to clients. Am looking for the following details. Any general guidelines in migration of VC++ to C#.NET What are the issues that a team can face when we take up this activity Are there any existing approaches available ? I believe many might have tried but may not have detailed information, but consolidating this under this would help not only me but anyone who look for these information. Any good / valid resources available on internet? Any suggestions from Microsoft team if any Microsoft people in this group? Architecture, components design approaches, etc. Please help me in getting these information, each penny would help me to gain good understanding.. Thanks in advance to those who will share their wisdom thorough this query.

    Read the article

  • ruby on rails w/ SQLServer

    - by jaydel
    I've heard from some people that RoR doesn't marry cleanly with SQLServer. We have a series of historical, standardization to use SQLServer but if we can push back with valid reasons we can move to another db. One person on the team wants MySql and another wants Postgres, etc. I'm trying to stay out of the religious wars and really understand what the pain point is with SQLServer. We're running the app server on a linux box, and the database will be on a windows box and the SQLServer that we're supposed to standardize on is 2008, if those details help any... thanks in advance!

    Read the article

  • SQL Server 2003: how can I assign a name to the SUM column ?

    - by Patrick
    hi, how can I assign a column name to the SUM column ? i.e. select OwnerUserId, SUM(PostScore) INTO Experts from ... I get this error: An object or column name is missing or empty. For SELECT INTO statements, verify each column has a name. For other statements, look for empty alias names. Aliases defined as "" or [] are not allowed. Change the alias to a valid name. I guess because the column containing the results of SUM has not name. thanks

    Read the article

  • The page at [ Page URL ] could not be reached. (Urgent)

    - by Danial Sabagh
    I want to add the like button on my website, but it does not work because whenever I click on Like button it says: The page at could not be reached. You can also check the url to see the error: My Facebook page Here is what I did to use the code: <html xmlns="http://www.w3.org/1999/xhtml" xmlns:fb="http://ogp.me/ns/fb#"> <head> <meta property="og:title" content="ALEXA BEAUTY" /> <meta property="og:type" content="company" /> <meta property="og:url" content="http://alexasalon.co.uk/" /> <meta property="og:image" content="http://alexasalon.co.uk/images/logo.png" /> <meta property="og:site_name" content="ALEXA BEAUTY" /> <meta property="fb:admins" content="100002556535323" /> </head> <body> <div id="fb-root"></div> <script>(function(d, s, id) { var js, fjs = d.getElementsByTagName(s)[0]; if (d.getElementById(id)) {return;} js = d.createElement(s); js.id = id; js.src = "//connect.facebook.net/en_US/all.js#xfbml=1&appId=220687968005095"; fjs.parentNode.insertBefore(js, fjs); }(document, 'script', 'facebook-jssdk'));</script> <div> <fb:like href="http://www.facebook.com/pages/Alexa-Beauty/205401152839187" send="true" width="450" show_faces="false" font="lucida grande"></fb:like> </div> Is the code wrong? Is the page URL correct? I checked the website on Object Debugger and seems there is no error, check link please. I really do not know what is wrong? Does anyone know?!

    Read the article

< Previous Page | 217 218 219 220 221 222 223 224 225 226 227 228  | Next Page >