Search Results

Search found 6023 results on 241 pages for 'grid computing'.

Page 226/241 | < Previous Page | 222 223 224 225 226 227 228 229 230 231 232 233  | Next Page >

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • Error installing pkgconfig via macports

    - by Greg K
    I installed Macports 1.8.2 from a DMG. That seemed to install fine. I ran sudo port selfupdate to make sure my ports tree was current. I then tried to install bindfs as I want to mount some directories in my OS X file system (like you can do with mount --bind in linux). pkgconfig and macfuse are two dependencies of bindfs. I had trouble installing bindfs due to errors installing pkgconfig, so I tried to just install pkgconfig, here's the debug output from sudo port install pkgconfig: $ sudo port -d install pkgconfig DEBUG: Found port in file:///opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: Changing to port directory: /opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: OS Platform: darwin DEBUG: OS Version: 10.3.0 DEBUG: Mac OS X Version: 10.6 DEBUG: System Arch: i386 DEBUG: setting option os.universal_supported to yes DEBUG: org.macports.load registered provides 'load', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.unload registered provides 'unload', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.distfiles registered provides 'distfiles', a pre-existing procedure. Target override will not be provided DEBUG: adding the default universal variant DEBUG: Reading variant descriptions from /opt/local/var/macports/sources/rsync.macports.org/release/ports/_resources/port1.0/variant_descriptions.conf DEBUG: Requested variant darwin is not provided by port pkgconfig. DEBUG: Requested variant i386 is not provided by port pkgconfig. DEBUG: Requested variant macosx is not provided by port pkgconfig. ---> Computing dependencies for pkgconfig DEBUG: Executing org.macports.main (pkgconfig) DEBUG: Skipping completed org.macports.fetch (pkgconfig) DEBUG: Skipping completed org.macports.checksum (pkgconfig) DEBUG: Skipping completed org.macports.extract (pkgconfig) DEBUG: Skipping completed org.macports.patch (pkgconfig) ---> Configuring pkgconfig DEBUG: Using compiler 'Mac OS X gcc 4.2' DEBUG: Executing org.macports.configure (pkgconfig) DEBUG: Environment: CFLAGS='-O2 -arch x86_64' CPPFLAGS='-I/opt/local/include' CXXFLAGS='-O2 -arch x86_64' MACOSX_DEPLOYMENT_TARGET='10.6' CXX='/usr/bin/g++-4.2' F90FLAGS='-O2 -m64' LDFLAGS='-L/opt/local/lib' OBJC='/usr/bin/gcc-4.2' FCFLAGS='-O2 -m64' INSTALL='/usr/bin/install -c' OBJCFLAGS='-O2 -arch x86_64' FFLAGS='-O2 -m64' CC='/usr/bin/gcc-4.2' DEBUG: Assembled command: 'cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig' checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... no checking for mawk... no checking for nawk... no checking for awk... awk checking whether make sets $(MAKE)... no checking whether to enable maintainer-specific portions of Makefiles... no checking build system type... i386-apple-darwin10.3.0 checking host system type... i386-apple-darwin10.3.0 checking for style of include used by make... none checking for gcc... /usr/bin/gcc-4.2 checking for C compiler default output file name... configure: error: C compiler cannot create executables See `config.log' for more details. Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 DEBUG: Backtrace: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 while executing "$procedure $targetname" Warning: the following items did not execute (for pkgconfig): org.macports.activate org.macports.configure org.macports.build org.macports.destroot org.macports.install Error: Status 1 encountered during processing. I have only recently installed Xcode 3.2.2 (prior to installing macports). Am I right in thinking this the issue here: configure: error: C compiler cannot create executables

    Read the article

  • Sharing the same `ssh-agent` among multiple login sessions

    - by intuited
    Is there a convenient way to ensure that all logins from a given user (ie me) use the same ssh-agent? I hacked out a script to make this work most of the time, but I suspected all along that there was some way to do it that I had just missed. Additionally, since that time there have been amazing advances in computing technology, like for example this website. So the goal here is that whenever I log in to the box, regardless of whether it's via SSH, or in a graphical session started from gdm/kdm/etc, or at a console: if my username does not currently have an ssh-agent running, one is started, the environment variables exported, and ssh-add called. otherwise, the existing agent's coordinates are exported in the login session's environment variables. This facility is especially valuable when the box in question is used as a relay point when sshing into a third box. In this case it avoids having to type in the private key's passphrase every time you ssh in and then want to, for example, do git push or something. The script given below does this mostly reliably, although it botched recently when X crashed and I then started another graphical session. There might have been other screwiness going on in that instance. Here's my bad-is-good script. I source this from my .bashrc. # ssh-agent-procure.bash # v0.6.4 # ensures that all shells sourcing this file in profile/rc scripts use the same ssh-agent. # copyright me, now; licensed under the DWTFYWT license. mkdir -p "$HOME/etc/ssh"; function ssh-procure-launch-agent { eval `ssh-agent -s -a ~/etc/ssh/ssh-agent-socket`; ssh-add; } if [ ! $SSH_AGENT_PID ]; then if [ -e ~/etc/ssh/ssh-agent-socket ] ; then SSH_AGENT_PID=`ps -fC ssh-agent |grep 'etc/ssh/ssh-agent-socket' |sed -r 's/^\S+\s+(\S+).*$/\1/'`; if [[ $SSH_AGENT_PID =~ [0-9]+ ]]; then # in this case the agent has already been launched and we are just attaching to it. ##++ It should check that this pid is actually active & belongs to an ssh instance export SSH_AGENT_PID; SSH_AUTH_SOCK=~/etc/ssh/ssh-agent-socket; export SSH_AUTH_SOCK; else # in this case there is no agent running, so the socket file is left over from a graceless agent termination. rm ~/etc/ssh/ssh-agent-socket; ssh-procure-launch-agent; fi; else ssh-procure-launch-agent; fi; fi; Please tell me there's a better way to do this. Also please don't nitpick the inconsistencies/gaffes ( eg putting var stuff in etc ); I wrote this a while ago and have since learned many things.

    Read the article

  • Oracle performance problem

    - by jreid42
    We are using an Oracle 11G machine that is very powerful; has redundant storage etc. It's a beast from what I have been told. We just got this DB for a tool that when I first came on as a coop had like 20 people using, now its upwards of 150 people. I am the only one working on it :( We currently have a system in place that distributes PERL scripts across our entire data center essentially giving us a sort of "grid" computing power. The Perl scripts run a sort of simulation and report back the results to the database. They do selects / inserts. The load is not very high for each script but it could be happening across 20-50 systems at the same time. We then have multiple data centers and users all hitting the same database with this same approach. Our main problem with this is that our database is getting overloaded with connections and having to drop some. We sometimes have upwards of 500 connections. These are old perl scripts and they do not handle this well. Essentially they fail and the results are lost. I would rather avoid having to rewrite a lot of these as they are poorly written, and are a headache to even look at. The database itself is not overloaded, just the connection overhead is too high. We open a connection, make a quick query and then drop the connection. Very short connections but many of them. The database team has basically said we need to lower the number of connections or they are going to ignore us. Because this is distributed across our farm we cant implement persistent connections. I do this with our webserver; but its on a fixed system. The other ones are perl scripts that get opened and closed by the distribution tool and thus arent always running. What would be my best approach to resolving this issue? The scripts themselves can wait for a connection to be open. They do not need to act immediately. Some sort of queing system? I've been suggested to set up a few instances of a tool called "SQL Relay". Maybe one in each data center. How reliable is this tool? How good is this approach? Would it work for what we need? We could have one for each data center and relay requests through it to our main database, keeping a pipeline of open persistent connections? Does this make sense? Is there any other suggestions you can make? Any ideas? Any help would be greatly appreciated. Sadly I am just a coop student working for a very big company and somehow all of this has landed all on my shoulders (there is literally nobody to ask for help; its a hardware company, everybody is hardware engineers, and the database team is useless and in India) and I am quite lost as what the best approach would be? I am extremely overworked and this problem is interfering with on going progress and basically needs to be resolved as quickly as possible; preferably without rewriting the whole system, purchasing hardware (not gonna happen), or shooting myself in the foot. HELP LOL!

    Read the article

  • I cut-to-move DCIM folder to ext SD when an auto android OS update popped up b4 I could choose target - Cannot recover 200+ photos

    - by ZeroG
    I was downloading my Exhibit II's DCIM camera folder (with month's of photos inside) to its external SD card, in order to transfer them into my laptop. In my overconfidence, I hurriedly chose cut-to-move (rather than copy-to-move) when KABOOM! —an automatic Android OS update popped up before I could choose the target!!! I figured everything was in cache & calmly tried to go through with the update. But that was not a typically seamless event. It showed downloading icon but hmm… since I rooted the phone it brought the command line up & recovery sequence. But neither Android nor I had yet downloaded any alternate custom ROM Files to internal SD to update from! So were they trying to make me unroot my phone by giving me some bogus update on the fly or just give me a hard time in trying to hand me down an unrooted ROM that I'd have to figure out how to root again? Yes, I know there was that blurb about overwriting a file of the same name but I was trying to shake the darn stubborn update being forced on my phone during this precarious moment. I thought I had frozen or turned off all those auto-updates previously. Anyway, phones are small & fingers are big (sigh)... I tried to reboot into safe mode but the resultant photo file was partially overwritten (200 files had names but Zero bytes in them). I thought maybe it was still hung in cache or deposited somewhere else but I have searched everywhere with file managers. Since I did not have Titanium backing up camera, photo folder or gallery, I cannot recover 200+ photos. Dumb. You can understand my dilemma as I am involved in the arts & although just a camera phone, most of these photos were historic & aesthetic or at least as to subject matter. Photo-ops don't reoccur. I have tried a couple of recovery apps from the market like Search Duplicates & Recover to no avail. I was only able to salvage stuff I'd sent out in messages. I've got several decades in computers & this is such a miserable beginner's piece of bad luck I can't believe it happened to me. They were precious photos! Yes, I turned on Titanium since & yes I even tried USB to laptop recoveries. Being on a MacBookPro I'm trying androidfiletransfer.dmg, but I'd have to upgrade to Peach Sunrise to get above Android 3.0 for that App to recognize the phone via USB & the programmer says installation zeros your data, so that pretty much toasts any secret hidden places where these photos may have been deposited. Don't want to do that & am still trying to find them. They certainly didn't make it to my external SD Card. If any of you techies out there know anything, please help & thanks. Despite decades of being in computing, unfamiliar & ever-changing hard or software can humble even the most seasoned veterans.

    Read the article

  • Varnish VCL - Regular Expression Evaluation

    - by Hugues ALARY
    I have been struggling for the past few days with this problem: Basically, I want to send to a client browser a cookie of the form foo[sha1oftheurl]=[randomvalue] if and only if the cookie has not already been set. e.g. If a client browser requests "/page.html", the HTTP response will be like: resp.http.Set-Cookie = "foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=ABCD;" then, if the same client request "/index.html", the HTTP response will contain a header: resp.http.Set-Cookie = "foo14fe4559026d4c5b5eb530ee70300c52d99e70d7=QWERTY;" In the end, the client browser will have 2 cookies: foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=ABCD foo14fe4559026d4c5b5eb530ee70300c52d99e70d7=QWERTY Now, that, is not complicated in itself. The following code does it: import digest; import random; ##This vmod does not exist, it's just for the example. sub vcl_recv() { ## We compute the sha1 of the requested URL and store it in req.http.Url-Sha1 set req.http.Url-Sha1 = digest.hash_sha1(req.url); set req.http.random-value = random.get_rand(); } sub vcl_deliver() { ## We create a cookie on the client browser by creating a "Set-Cookie" header ## In our case the cookie we create is of the form foo[sha1]=[randomvalue] ## e.g for a URL "/page.html" the cookie will be foo4c9ae249e9e061dd6e30893e03dc10a58cc40ee6=[randomvalue] set resp.http.Set-Cookie = {""} + resp.http.Set-Cookie + "foo"+req.http.Url-Sha1+"="+req.http.random-value; } However, this code does not take into account the case where the Cookie already exists. I need to check that the Cookie does not exists before generating a random value. So I thought about this code: import digest; import random; sub vcl_recv() { ## We compute the sha1 of the requested URL and store it in req.http.Url-Sha1 set req.http.Url-Sha1 = digest.hash_sha1(req.url); set req.http.random-value = random.get_rand(); set req.http.regex = "abtest"+req.http.Url-Sha1; if(!req.http.Cookie ~ req.http.regex) { set req.http.random-value = random.get_rand(); } } The problem is that Varnish does not compute Regular expression at run time. Which leads to this error when I try to compile: Message from VCC-compiler: Expected CSTR got 'req.http.regex' (program line 940), at ('input' Line 42 Pos 31) if(req.http.Cookie !~ req.http.regex) { ------------------------------##############--- Running VCC-compiler failed, exit 1 VCL compilation failed One could propose to solve my problem by matching on the "abtest" part of the cookie or even "abtest[a-fA-F0-9]{40}": if(!req.http.Cookie ~ "abtest[a-fA-F0-9]{40}") { set req.http.random-value = random.get_rand(); } But this code matches any cookie starting by 'abtest' and containing an hexadecimal string of 40 characters. Which means that if a client requests "/page.html" first, then "/index.html", the condition will evaluate to true even if the cookie for the "/index.html" has not been set. I found in bug report phk or someone else stating that computing regular expressions was extremely expensive which is why they are evaluated during compilation. Considering this, I believe that there is no way of achieving what I want the way I've been trying to. Is there any way of solving this problem, other than writting a vmod? Thanks for your help! -Hugues

    Read the article

  • Wordpress Permissions OS X & MAMP

    - by Matt2020
    I have installed several local versions of Wordpress for development purposes. After the install I can create posts, pages and edit admin options. However as soon as try to upload images which would be saved in wp_content/uploads I get an error: Upload Error: Unable to create directory ...../blog/wp-content/uploads/2011/05. Is its parent directory writable by the server? Looks like MAMP server runs as user _www The blog directory is owned by User1 and the group User1 _www is not in the User1 group, should it be? I do not want to chmod 777 or 765 on the directories just to get it going. Googled up a couple of references: http://codex.wordpress.org/Changing_File_Permissions in "Permission Scheme for WordPress" All files should be owned by your user (ftp) account on your web server, and should be writable by that account. On shared hosts, files should never be owned by the webserver process itself (sometimes this is www, or apache, or nobody user). Any file that needs write access from WordPress should be owned or group-owned by the user account used by the WordPress (which may be different than the server account). For example, you may have a user account that lets you FTP files back and forth to your server, but your server itself may run using a separate user, in a separate usergroup, such as dhapache or nobody. If WordPress is running as the FTP account, that account needs to have write access, i.e., be the owner of the files, or belong to a group that has write access. In the latter case, that would mean permissions are set more permissively than default (for example, 775 rather than 755 for folders, and 664 instead of 644). User and group are User1 (which is admin). Running "ps aux | grep httpd" is running as _www So I think this means Wordpress is running as user _www. So the advice seems contradictory: "files should never be owned by the webserver process" i.e. _www but then later it says "Any file that needs write access from WordPress should be owned or group-owned by the user account used by the WordPress" So isn't this _www again? Another search found this url http://dancingengineer.com/computing/2009/07/how-to-install-wordpress-on-mac-os-x-leopard States Which says: My preferred way to do this is to change the group of the wordpress directory and its contents to _www and give write permissions to the group. Keep the owner as your "username". $ cd /Users/"username"/Sites $ sudo chown -R username:_www wordpress_directory $ sudo chmod -R g+w wordpress_directory However, when I tried this, it did not work for automatic upgrades to newer versions of WordPress although it worked for automatically updating the .htaccess file for pretty permalinks. It is not entirely clear to me what should be done. This last suggestion seems to be saying change the group from User1 to _www and give the group write access, but Wordpress upgrades won't work. Is this the right solution? I would have thought there would be a clear way to set this up on OS X 10.6? Be great if there was a plugin that could run a script for each of the main OS's that Wordpress runs on.

    Read the article

  • How can I get the Terminal raster font to display alt codes in a text editor?

    - by grg-n-sox
    I am working on a project that includes making some ASCII art, except it isn't true ASCII art since I am using a far amount of Windows Alt codes to make it. Anyways, I wanted to make sure that as I am working on it, that it looks exactly how it will in a windows command prompt terminal session. So since command prompt defaults to the Terminal raster font, I figured I would use that. But I quickly noticed that when I use the Terminal typeface in a text editor, it will not render ASCII codes, either at all (as is the case most of the time) or incorrectly. Now, I understand if a font just doesn't support non-ASCII characters, but what I don't get is how the characters do show up correctly in command prompt when they don't in a text editor. I checked the output of the 'chcp' and it was set to 437 by default, which is what I need. Well, either that or 850 but preferably 437 since they got rid of some of the graphics in 437 and replaced them with other Latin characters. Command prompt terminal settings show I am using the Terminal raster font with a 8x12 glyph size. So I try using size 12 in the text editor but no good, even after switching the text encoding to either MS-DOS OEM-US (supposedly an alternative name for CP437) or UTF-8. I just don't get how I am not getting the characters to show up. Also, if it helps, the art I am making is basically modified screen shots from a game I play called Dwarf Fortress that uses characters from the Terminal/Curses typeset, or at least that is how it is reported in the forums by those who make graphics sets to replace the default character set. However, the game doesn't actually use the system's Terminal font. The game's data files includes a bitmap image that is a grid of all the characters the game uses. So it uses this bitmap to render graphics instead of the actual font file. And I basically want to get a text editor to make it so if I type up some ASCII art to look like a screenshot from Dwarf Fortress, that it will actually look like Dwarf Fortress other than the lack of color. Any help?

    Read the article

  • Google Rules for Retail

    - by David Dorf
    In the book What Would Google Do?, Jeff Jarvis outlines ten "Google Rules" that define how Google acts.  These rules help define how Web 2.0 businesses operate today and into the future.  While there's a chapter in the book on applying these rules to the retail industry, it wasn't very in-depth.  So I've decided to more directly apply the rules to retail, along with some notable examples of success.  The table below shows Jeff's Google Rule, some Industry Examples, and New Retailer Rules that I created. Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin;} table.MsoTableGrid {mso-style-name:"Table Grid"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-priority:59; mso-style-unhide:no; border:solid black 1.0pt; mso-border-themecolor:text1; mso-border-alt:solid black .5pt; mso-border-themecolor:text1; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-border-insideh:.5pt solid black; mso-border-insideh-themecolor:text1; mso-border-insidev:.5pt solid black; mso-border-insidev-themecolor:text1; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin;} Google Rule Industry Examples New Retailer Rule New Relationship Your worst customer is your friend; you best customer is your partner Newegg.com lets manufacturers respond to customer comments that are critical of the product, and their EggXpert site lets customers help other customers. Listen to what your customers are saying about you.  Convert the critics to fans and the fans to influencers. New Architecture Join a network; be a platform Tesco and BestBuy released APIs for their product catalogs so third-parties could create new applications. Become a destination for information. New Publicness Life is public, so is business Zappos and WholeFoods founders are prolific tweeters/bloggers, sharing their opinions and connecting to customers.  It's not always pretty, but it's genuine. Be transparent.  Share both your successes and failures with your customers. New Society Elegant organization Wet Seal helps their customers assemble outfits and show them off to each other.  Barnes & Noble has a community site that includes a bookclub. Communities of your customers already exist, so help them organize better. New Economy Mass market is dead; long live the mass of niches lululemon found a niche for yoga inspired athletic wear.  Threadless uses crowd-sourcing to design short-runs of T-shirts. Serve small markets with niche products. New Business Reality Decide what business you're in When Lowes realized catering to women brought the men along, their sales increased. Customers want experiences to go with the products they buy. New Attitude Trust the people and listen In 2008 Starbucks launched MyStartbucksIdea to solicit ideas from their customers. Use social networks as additional data points for making better merchandising decisions. New Ethic Be honest and transparent; don't be evil Target is giving away reusable shopping bags for Earth Day.  Kohl's has outfitted 67 stores with solar arrays. Being green earns customers' respect and lowers costs too. New Speed Life is live H&M and Zara keep up with fashion trends. Be prepared to pounce on you customers' fickle interests. New Imperatives Encourage, enable and protect innovation 1-800-Flowers was the first do sales in Facebook and an early adopter of mobile commerce.  The Sears Personal Shopper mobile app finds products based on a photo. Give your staff permission to fail so innovation won't be stifled. Jeff will be a keynote speaker at Crosstalk, our upcoming annual user conference, so I'm looking forward to hearing more of his perspective on retail and the new economy.

    Read the article

  • Scan a Windows PC for Viruses from a Ubuntu Live CD

    - by Trevor Bekolay
    Getting a virus is bad. Getting a virus that causes your computer to crash when you reboot is even worse. We’ll show you how to clean viruses from your computer even if you can’t boot into Windows by using a virus scanner in a Ubuntu Live CD. There are a number of virus scanners available for Ubuntu, but we’ve found that avast! is the best choice, with great detection rates and usability. Unfortunately, avast! does not have a proper 64-bit version, and forcing the install does not work properly. If you want to use avast! to scan for viruses, then ensure that you have a 32-bit Ubuntu Live CD. If you currently have a 64-bit Ubuntu Live CD on a bootable flash drive, it does not take long to wipe your flash drive and go through our guide again and select normal (32-bit) Ubuntu 9.10 instead of the x64 edition. For the purposes of fixing your Windows installation, the 64-bit Live CD will not provide any benefits. Once Ubuntu 9.10 boots up, open up Firefox by clicking on its icon in the top panel. Navigate to http://www.avast.com/linux-home-edition. Click on the Download tab, and then click on the link to download the DEB package. Save it to the default location. While avast! is downloading, click on the link to the registration form on the download page. Fill in the registration form if you do not already have a trial license for avast!. By the time you’ve filled out the registration form, avast! will hopefully be finished downloading. Open a terminal window by clicking on Applications in the top-left corner of the screen, then expanding the Accessories menu and clicking on Terminal. In the terminal window, type in the following commands, pressing enter after each line. cd Downloadssudo dpkg –i avast* This will install avast! on the live Ubuntu environment. To ensure that you can use the latest virus database, while still in the terminal window, type in the following command: sudo sysctl –w kernel.shmmax=128000000 Now we’re ready to open avast!. Click on Applications on the top-left corner of the screen, expand the Accessories folder, and click on the new avast! Antivirus item. You will first be greeted with a window that asks for your license key. Hopefully you’ve received it in your email by now; open the email that avast! sends you, copy the license key, and paste it in the Registration window. avast! Antivirus will open. You’ll notice that the virus database is outdated. Click on the Update database button and avast! will start downloading the latest virus database. To scan your Windows hard drive, you will need to “mount” it. While the virus database is downloading, click on Places on the top-left of your screen, and click on your Windows hard drive, if you can tell which one it is by its size. If you can’t tell which is the correct hard drive, then click on Computer and check out each hard drive until you find the right one. When you find it, make a note of the drive’s label, which appears in the menu bar of the file browser. Also note that your hard drive will now appear on your desktop. By now, your virus database should be updated. At the time this article was written, the most recent version was 100404-0. In the main avast! window, click on the radio button next to Selected folders and then click on the “+” button to the right of the list box. It will open up a dialog box to browse to a location. To find your Windows hard drive, click on the “>” next to the computer icon. In the expanded list, find the folder labelled “media” and click on the “>” next to it to expand it. In this list, you should be able to find the label that corresponds to your Windows hard drive. If you want to scan a certain folder, then you can go further into this hierarchy and select that folder. However, we will scan the entire hard drive, so we’ll just press OK. Click on Start scan and avast! will start scanning your hard drive. If a virus is found, you’ll be prompted to select an action. If you know that the file is a virus, then you can Delete it, but there is the possibility of false positives, so you can also choose Move to chest to quarantine it. When avast! is done scanning, it will summarize what it found on your hard drive. You can take different actions on those files at this time by right-clicking on them and selecting the appropriate action. When you’re done, click Close. Your Windows PC is now free of viruses, in the eyes of avast!. Reboot your computer and with any luck it will now boot up! Alternatives to avast! If avast! and a liberal amount of Googling doesn’t fix your problem, it’s possible that a different virus scanner will fix your obscure issue. Here are a list of other virus scanners available for Ubuntu that are either free or offer free trials. See their support forums for help on installing these virus scanners. Avira AntiVir Personal for Linux / Solaris Panda Antivirus for Linux Installation and usage guide from Ubuntu F-PROT Antivirus for Linux ClamAV installation and usage guide from Ubuntu NOD32 Antivirus for Linux Kaspersky Anti-Virus 2010 Bitdefender Antivirus for Unices Conclusion Running avast! from a Ubuntu Live CD can clean the vast majority of viruses from your Windows PC. This is another reason to always have a Ubuntu Live CD ready just in case something happens to your Windows installation! Similar Articles Productive Geek Tips Secure Computing: Windows Live OneCareHow To Remove Antivirus Live and Other Rogue/Fake Antivirus MalwareUse the Windows Key for the "Start" Menu in Ubuntu LinuxScan Files for Viruses Before You Download With Dr.WebAsk the Readers: Share Your Tips for Defeating Viruses and Malware TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips DVDFab 6 Revo Uninstaller Pro Registry Mechanic 9 for Windows PC Tools Internet Security Suite 2010 The Ultimate Guide For YouTube Lovers Will it Blend? iPad Edition Penolo Lets You Share Sketches On Twitter Visit Woolyss.com for Old School Games, Music and Videos Add a Custom Title in IE using Spybot or Spyware Blaster When You Need to Hail a Taxi in NYC

    Read the article

  • Week in Geek: USDA Chooses Microsoft for Cloud Services Edition

    - by Asian Angel
    This week we learned how to create geeky LED holiday lights with old bottles, dig deeper in Windows Defrag via the command prompt, use Google Chrome’s drag/drop feature to upload files easier, find great gift recommendations by looking through the How-To Geek holiday gift guide, and have fun adding Merry Christmas fonts to our computers. Photo by ntr23. Random Geek Links It has been a busy week, so we have extra news link goodness with information that is good for you to know. USDA making the move to Microsoft The U.S. Department of Agriculture has announced that it has chosen Microsoft to host things like e-mail, instant messaging, and collaboration through the software giant’s Business Productivity Online Suite. Google says it was cut off from USDA project bid Google is claiming that it was not given a chance to bid on a cloud-computing project for the U.S. Department of Agriculture, for which the contract was awarded to rival Microsoft. Apache is being forced into a Java Fork When Oracle rolled over Apache and Google’s objections to its Java plans in December, the scene was set for Apache to leave and, eventually, force a Java code fork. Tumblr explains daylong outage After experiencing an outage that started on Sunday afternoon and stretched through most of the day yesterday, Tumblr has explained what happened. Google demos Chrome OS, launches pilot program During a press briefing this week in San Francisco, Google launched the Chrome application store and demonstrated Chrome OS, its browser-centric netbook operating system. Don’t expect Spotify in U.S. this holiday season As of last week, Spotify had yet to sign a single licensing deal with a major label, after spending more than a year negotiating, multiple music sources told CNET. December 2010 Patch Tuesday will come with most bulletins ever According to the Microsoft Security Response Center, Microsoft will issue 17 Security Bulletins addressing 40 vulnerabilities on Tuesday, December 14. It will also host a webcast to address customer questions the following day. Hacker plants back door in Symbian firmware Indian hacker Atul Alex has had a look at the firmware for Symbian S60 smartphones and come up with a back door for it. PC quarantines raise tough complexities The concept of quarantining PCs to prevent widespread infection is “interesting, but difficult to implement, with far too many problems”, said security experts. Symantec: DDoS attacks hard to defend It has surfaced that the distributed denial of service (DDoS) attacks on Visa and MasterCard Web sites on Wednesday were carried out by a toolkit known as low orbit ion cannon (LOIC). Web Sockets and the risks of unfinished standards Enthusiasm for a promising new standard called Web Sockets has quickly cooled in some quarters as a potential security problem led some browser makers to hastily postpone support. Internet Explorer 9 to get tracking protection Microsoft is making changes to Internet Explorer 9’s security features that will better enable users to keep sites from tracking their activity across browsing sessions. NASA sold PCs with sensitive data NASA failed to remove sensitive data from computers that it sold, according to an audit report released this week. Cybercrooks create fake Amazon receipts The bad guys have created yet another online scam, this one involving fake Amazon receipts. World of Warcraft character move fees waived Until December 22, Blizzard will allow free realm transfers from 25 highly populated servers to alleviate log-in queues or performance issues. (The free transfers are one-way and one-time only.) SpaceX Dragon reaches orbit atop a Falcon with a fiery tail The Space Exploration Technologies corporation has become the first nongovernmental entity to put a vehicle into low Earth orbit. Geek Video of the Week If birds have wings, then why are the Angry Birds using slingshots? Photo by Dorkly Bits. Wait… Birds have Wings, Why are the Angry Ones Using Slingshots? Sysadmin Geek Tips How To Setup Email Alerts on Linux Using Gmail or SMTP Linux machines may require administrative intervention in countless ways, but without manually logging into them how would you know about it? Here’s how to setup emails to get notified when your machines want some tender love and attention. Random TinyHacker Links Red Panda Webcam Support Firefox and the Knoxville Zoo’s Red Panda program. Christmas Icons (Icons we like) Superb set of holiday icons by lgp85 at deviantArt. Download the .zip and use as .png or convert to .ico at Convertico.com or with tiny app Imagicon. Super User Questions Enjoy reading the great answers to this week’s popular questions from Super User Useful USB boot disks? DVD/CD burning .zip: is it more reliable, faster, longer lasting to burn a zip of files rather than the files as a folder? What are other ways to backup my files if I do not have an external drive? Anti virus what is the difference between these all? How can I block all Facebook elements/content? How-To Geek Weekly Article Recap Have you had a busy week between work and preparing for the holidays? Get caught up on your HTG reading with our hottest articles of the week. 20 Windows Keyboard Shortcuts You Might Not Know The 50 Best Registry Hacks that Make Windows Better LCD? LED? Plasma? The How-To Geek Guide to HDTV Technology HTG Explains: Which Linux File System Should You Choose? How to Use and Customize Google Chrome Web Apps One Year Ago on How-To Geek This week’s batch of retro geeky goodness is all about customizing Windows 7. ClassicShell Adds Classic Start Menu and Explorer Features to Windows 7 Get an Aero-Styled Classic Start Menu in Windows 7 Customize the Windows 7 Logon Screen Get the Classic Style Network Activity Indicator Back in Windows 7 How To Enable Check Boxes for Items In Windows 7 The Geek Note We would like you to join us in welcoming Jason Fitzpatrick to the writing staff here at How-To Geek. He started with us this past week, so take some time to read through his articles about the Wii, Kindle, & PlayStation 2 Peripherals and leave a friendly comment to say “Hi”! Got a great tip to share? Make sure to send it in to us at [email protected]. Photo by real00. Latest Features How-To Geek ETC The 50 Best Registry Hacks that Make Windows Better The How-To Geek Holiday Gift Guide (Geeky Stuff We Like) LCD? LED? Plasma? The How-To Geek Guide to HDTV Technology The How-To Geek Guide to Learning Photoshop, Part 8: Filters Improve Digital Photography by Calibrating Your Monitor Our Favorite Tech: What We’re Thankful For at How-To Geek Settle into Orbit with the Voyage Theme for Chrome and Iron Awesome Safari Compass Icons Set Escape from the Exploding Planet Wallpaper Move Your Tumblr Blog to WordPress Pytask is an Easy to Use To-Do List Manager for Your Ubuntu System Snowy Christmas House Personas Theme for Firefox

    Read the article

  • Ask How-To Geek: Learning the Office Ribbon, Booting to USB with an Old BIOS, and Snapping Windows

    - by Jason Fitzpatrick
    You’ve got questions and we’ve got answers. Today we highlight how to master the new Office interface, USB boot a computer with outdated BIOS, and snap windows to preset locations. Learning the New Office Ribbon Dear How-To Geek, I feel silly asking this (in light of how long the new Office interface has been out) but my company finally got around to upgrading from Windows XP and Office 2000 so the new interface it totally new to me. Can you recommend any resources for quickly learning the Office ribbon and the new changes? I feel completely lost after two decades of the old Office interface. Help! Sincerely, Where the Hell is Everything? Dear Where the Hell, We think most people were with you at some point in the last few years. “Where the hell is…” could possibly be the slogan for the new ribbon interface. You could browse through some of the dry tutorials online or even get a weighty book on the topic but the best way to learn something new is to get hands on. Ribbon Hero turns learning the new Office features and ribbon layout into a game. It’s no vigorous round of Team Fortress mind you, but it’s significantly more fun than reading a training document. Check out how to install and configure Ribbon Hero here. You’ll be teaching your coworkers new tricks in no time. Boot via USB with an Old BIOS Dear How-To Geek, I’m trying to repurpose some old computers by updating them with lightweight Linux distros but the BIOS on most of the machines is ancient and creaky. How ancient? It doesn’t even support booting from a USB device! I have a large flash drive that I’ve turned into a master installation tool for jobs like this but I can’t use it. The computers in question have USB ports; they just aren’t recognized during the boot process. What can I do? USB Bootin’ in Boise Dear USB Bootin’, It’s great you’re working to breathe life into old hardware! You’ve run into one of the limitations of older BIOSes, USB was around but nobody was thinking about booting off of it. Fortunately if you have a computer old enough to have that kind of BIOS it’s likely to also has a floppy drive or a CDROM drive. While you could make a bootable CDROM for your application we understand that you want to keep using the master USB installer you’ve made. In light of that we recommend PLoP Boot Manager. Think of it like a boot manager for your boot manager. Using it you can create a bootable floppy or CDROM that will enable USB booting of your master USB drive. Make a CD and a floppy version and you’ll have everything in your toolkit you need for future computer refurbishing projects. Read up on creating bootable media with PLoP Boot Manager here. Snapping Windows to Preset Coordinates Dear How-To Geek, Once upon a time I had a company laptop that came with a little utility that snapped windows to preset areas of the screen. This was long before the snap-to-side features in Windows 7. You could essentially configure your screen into a grid pattern of your choosing and then windows would neatly snap into those grids. I have no idea what it was called or if was anymore than a gimmick from the computer manufacturer, but I’d really like to have it on my new computer! Bend and Snap in San Francisco, Dear Bend and Snap, If we had to guess, we’d guess your company must have had a set of laptops from Acer as the program you’re describing sounds exactly like Acer GridVista. Fortunately for you the application was extremely popular and Acer released it independently of their hardware. If, by chance, you’ve since upgraded to a multiple monitor setup the app even supports multiple monitors—many of the configurations are handy for arranging IM windows and other auxiliary communication tools. Check out our guide to installing and configuring Acer GridVista here for more information. Have a question you want to put before the How-To Geek staff? Shoot us an email at [email protected] and then keep an eye out for a solution in the Ask How-To Geek column. Latest Features How-To Geek ETC How to Upgrade Windows 7 Easily (And Understand Whether You Should) The How-To Geek Guide to Audio Editing: Basic Noise Removal Install a Wii Game Loader for Easy Backups and Fast Load Times The Best of CES (Consumer Electronics Show) in 2011 The Worst of CES (Consumer Electronics Show) in 2011 HTG Projects: How to Create Your Own Custom Papercraft Toy Download the New Year in Japan Windows 7 Theme from Microsoft Once More Unto the Breach – Facebook Apps Can Now Access Your Address and Phone Number Dial Zero Speeds You Through Annoying Customer Service Menus Complete Dropquest 2011 and Receive Free Dropbox Storage Desktop Computer versus Laptop Wallpaper The Kids Have No Idea What Old Tech Is [Video]

    Read the article

  • Java Embedded @ JavaOne: Q & A

    - by terrencebarr
    There has been a lot of interest in Java Embedded @ JavaOne since it was announced a short while ago (see my previous post). As this is a new conference we did get a number of questions regarding the conference. So we put together a brief Q & A on audience focus, dates, registrations, pricing, submissions, etc. Hope this helps and, remember, the Call for Papers ends next week, Jul 18th 2012! Cheers, – Terrence    Java Embedded @ JavaOne : Q & A  Q. Where can I learn more about “Java Embedded @ JavaOne”? A. Please visit: http://oracle.com/javaone/embedded Q. What is the purpose of “Java Embedded @ JavaOne”? A. This net-new event is designed to provide business and technical decision makers, as well as Java embedded ecosystem partners, a unique occasion to come together and learn about how they can use Java Embedded technologies for new business opportunities. Q. What broad audiences would benefit by attending “Java Embedded @ JavaOne”? A. Java licensees; Government agencies; ISVs, Device Manufacturers; Service Providers such as Telcos, Utilities, Healthcare, Energy, Smart Grid/Smart Metering; Automotive/Telematics; Home/Building Automation; Factory Automation; Media/TV; and Payment vendors. Q. What business titles would benefit by attending “Java Embedded @ JavaOne”? A. The ideal audience for this event is business and technical decision makers (e.g. System Integrators, CTO, CXO, Chief Architects/Architects, Business Development Managers, Project Managers, Purchasing managers, Technical Leads, Senior Decision Makers, Practice Leads, R&D Heads, and Development Managers/Leads). Q. When is “Java Embedded @ JavaOne” taking place? A. The event takes place on Wednesday, Oct. 3th through Thursday, Oct. 4th. Q. Where is “Java Embedded @ JavaOne” taking place? A. The event takes place in the Hotel Nikko. Q. Won’t “Java Embedded @ JavaOne” impact the flagship JavaOne conference since the Hotel Nikko is one of the 3 flagship JavaOne conference’s venue hotels? A. No. Separate space in the Hotel Nikko will be used for “Java Embedded @ JavaOne” and will in no way impact scale and scope of the flagship JavaOne conference’s content mix. Q. Will there be a call for papers for “Java Embedded @ JavaOne”? A. Yes.  The call for papers has started but is ONLY for business focused submissions. Q. What type of business submissions can I make for “Java Embedded @ JavaOne”? A. We are accepting 3 types of business submissions: Best Practices: Java Embedded business solutions, methods, and techniques that consistently show results superior to those achieved with other means, as well as discussions on how Java Embedded can improve business operations, and increase competitive differentiation and profitability. Case Studies: Discussions with Oracle customers and partners that describe the unique business drivers that convinced them to implement Java Embedded as part of an infrastructure technology mix. The discussions will highlight the issues they faced, the decision making involved, and the implementation choices made to create value and improve business differentiation. Panel: Moderator-driven open discussion focused on the emerging opportunities Java Embedded offers businesses, as well as other topics such as strategy, overcoming common challenges, etc. Q. What is the call for papers timeline for “Java Embedded @ JavaOne”? A. The timeline is as follows: CFP Launched – June 18th Deadline for submissions – July 18th Notifications (Accepts/Declines) – week of July 29th Deadline for speakers to accept speaker invitation – August 10th Presentations due for review – August 31st Q. Where can I find more call for paper details for “Java Embedded @ JavaOne”? A. Please go to: http://www.oracle.com/javaone/embedded/call-for-papers/information/index.html Q. How much does it cost to attend “Java Embedded @ JavaOne”? A. The cost to attend is: $595.00 U.S. — Early Bird (Launch date – July 13, 2012) $795.00 U.S. — Pre-Registration (July 14 – September 28, 2012) $995.00 U.S. — Onsite Registration (September 29 – October 4, 2012) Q. Can an attendee of the flagship JavaOne event and Oracle OpenWorld attend “Java Embedded @ JavaOne”? ?A. Yes.  Attendees of both the flagship JavaOne event and Oracle OpenWorld can attend “Java Embedded @ JavaOne” by purchasing a $100.00 U.S. upgrade to their full conference pass. Filed under: Mobile & Embedded Tagged: Call for Papers, Java Embedded @ JavaOne, JavaOne San Francisco

    Read the article

  • Top 10 Reasons SQL Developer is Perfect for Oracle Beginners

    - by thatjeffsmith
    Learning new technologies can be daunting. If you’ve never used a Mac before, you’ll probably be a bit baffled at first. But, you’re probably at least coming from a desktop computing background (Windows), so you common frame of reference. But what if you’re just now learning to use a relational database? Yes, you’ve played with Access a bit, but now your employer or college instructor has charged you with becoming proficient with Oracle database. Here’s 10 reasons why I think Oracle SQL Developer is the perfect vehicle to help get you started. 1. It’s free No need to break into one of these… No start-up costs, no need to wrangle budget dollars from your company. Students don’t have any money after books and lab fees anyway. And most employees don’t like having to ask for ‘special’ software anyway. So avoid all of that and make sure the free stuff doesn’t suit your needs first. Upgrades are available on a regular base, also at no cost, and support is freely available via our public forums. 2. It will run pretty much anywhere Windows – check. OSX (Apple) – check. Unix – check. Linux – check. No need to start up a windows VM to run your Windows-only software in your lab machine. 3. Anyone can install it There’s no installer, no registry to be updated, no admin privs to be obtained. If you can download and extract files to your machine or USB storage device, you can run it. You can be up and running with SQL Developer in under 5 minutes. Here’s a video tutorial to see how to get started. 4. It’s ubiquitous I admit it, I learned a new word yesterday and I wanted an excuse to use it. SQL Developer’s everywhere. It’s had over 2,500,000 downloads in the past year, and is the one of the most downloaded items from OTN. This means if you need help, there’s someone sitting nearby you that can assist, and since they’re in the same tool as you, they’ll be speaking the same language. 5. Simple User Interface Up-up-down-down-Left-right-left-right-A-B-A-B-START will get you 30 lives, but you already knew that, right? You connect, you see your objects, you click on your objects. Or, you can use the worksheet to write your queries and programs in. There’s only one toolbar, and just a few buttons. If you’re like me, video games became less fun when each button had 6 action items mapped to it. I just want the good ole ‘A’, ‘B’, ‘SELECT’, and ‘START’ controls. If you’re new to Oracle, you shouldn’t have the double-workload of learning a new complicated tool as well. 6. It’s not a ‘black box’ Click through your objects, but also get the SQL that drives the GUI As you use the wizards to accomplish tasks for you, you can view the SQL statement being generated on your behalf. Just because you have a GUI, doesn’t mean you’re ceding your responsibility to learn the underlying code that makes the database work. 7. It’s four tools in one It’s not just a query tool. Maybe you need to design a data model first? Or maybe you need to migrate your Sybase ASE database to Oracle for a new project? Or maybe you need to create some reports? SQL Developer does all of that. So once you get comfortable with one part of the tool, the others will be much easier to pick up as your needs change. 8. Great learning resources available Videos, blogs, hands-on learning labs – you name it, we got it. Why wait for someone to train you, when you can train yourself at your own pace? 9. You can use it to teach yourself SQL Instead of being faced with the white-screen-of-panic, you can visually build your queries by dragging and dropping tables and views into the Query Builder. Yes, ‘just like Access’ – only better. And as you build your query, toggle to the Worksheet panel and see the SQL statement. Again, SQL Developer is not a black box. If you prefer to learn by trial and error, the worksheet will attempt to suggest the next bit of your SQL statement with it’s completion insight feature. And if you have syntax errors, those will be highlighted – just like your misspelled words in your favorite word processor. 10. It scales to match your experience level You won’t be a n00b forever. In 6-8 months, when you’re ready to tackle something a bit more complicated, like XML DB or Oracle Spatial, the tool is already there waiting on you. No need to go out and find the ‘advanced’ tool. 11. Wait, you said this was a ‘Top 10′ list? Yes. Yes, I did. I’m using this ‘trick’ to get you to continue reading because I’m going to say something you might not want to hear. Are you ready? Tools won’t replace experience, failure, hard work, and training. Just because you have the keys to the car, doesn’t mean you’re ready to head out on the race track. While SQL Developer reduces the barriers to entry, it does not completely remove them. Many experienced folks simply do not like tools. Rather, they don’t like the people that pick up tools without the know-how to properly use them. If you don’t understand what ‘TRUNCATE’ means, don’t try it out. Try picking up a book first. Of course, it’s very nice to have your own sandbox to play in, so you don’t upset the other children. That’s why I really like our Dev Days Database Virtual Box image. It’s your own database to learn and experiment with.

    Read the article

  • New Product: Oracle Java ME Embedded 3.2 – Small, Smart, Connected

    - by terrencebarr
    The Internet of Things (IoT) is coming. And, with todays launch of the Oracle Java ME Embedded 3.2 product, Java is going to play an even greater role in it. Java in the Internet of Things By all accounts, intelligent embedded devices are penetrating the world around us – driving industrial processes, monitoring environmental conditions, providing better health care, analyzing and processing data, and much more. And these devices are becoming increasingly connected, adding another dimension of utility. Welcome to the Internet of Things. As I blogged yesterday, this is a huge opportunity for the Java technology and ecosystem. To enable and utilize these billions of devices effectively you need a programming model, tools, and protocols which provide a feature-rich, consistent, scalable, manageable, and interoperable platform.  Java technology is ideally suited to address these technical and business problems, enabling you eliminate many of the typical challenges in designing embedded solutions. By using Java you can focus on building smarter, more valuable embedded solutions faster. To wit, Java technology is already powering around 10 billion devices worldwide. Delivering on this vision and accelerating the growth of embedded Java solutions, Oracle is today announcing a brand-new product: Oracle Java Micro Edition (ME) Embedded 3.2, accompanied by an update release of the Java ME Software Development Kit (SDK) to version 3.2. What is Oracle Java ME Embedded 3.2? Oracle Java ME Embedded 3.2 is a complete Java runtime client, optimized for ARM architecture connected microcontrollers and other resource-constrained systems. The product provides dedicated embedded functionality and is targeted for low-power, limited memory devices requiring support for a range of network services and I/O interfaces.  What features and APIs are provided by Oracle Java ME Embedded 3.2? Oracle Java ME Embedded 3.2 is a Java ME runtime based on CLDC 1.1 (JSR-139) and IMP-NG (JSR-228). The runtime and virtual machine (VM) are highly optimized for embedded use. Also included in the product are the following optional JSRs and Oracle APIs: File I/O API’s (JSR-75)  Wireless Messaging API’s (JSR-120) Web Services (JSR-172) Security and Trust Services subset (JSR-177) Location API’s (JSR-179) XML API’s (JSR-280)  Device Access API Application Management System (AMS) API AccessPoint API Logging API Additional embedded features are: Remote application management system Support for continuous 24×7 operation Application monitoring, auto-start, and system recovery Application access to peripheral interfaces such as GPIO, I2C, SPIO, memory mapped I/O Application level logging framework, including option for remote logging Headless on-device debugging – source level Java application debugging over IP Connection Remote configuration of the Java VM What type of platforms are targeted by Oracle Java ME 3.2 Embedded? The product is designed for embedded, always-on, resource-constrained, headless (no graphics/no UI), connected (wired or wireless) devices with a variety of peripheral I/O.  The high-level system requirements are as follows: System based on ARM architecture SOCs Memory footprint (approximate) from 130 KB RAM/350KB ROM (for a minimal, customized configuration) to 700 KB RAM/1500 KB ROM (for the full, standard configuration)  Very simple embedded kernel, or a more capable embedded OS/RTOS At least one type of network connection (wired or wireless) The initial release of the product is delivered as a device emulation environment for x86/Windows desktop computers, integrated with the Java ME SDK 3.2. A standard binary of Oracle Java ME Embedded 3.2 for ARM KEIL development boards based on ARM Cortex M-3/4 (KEIL MCBSTM32F200 using ST Micro SOC STM32F207IG) will soon be available for download from the Oracle Technology Network (OTN).  What types of applications can I develop with Oracle Java ME Embedded 3.2? The Oracle Java ME Embedded 3.2 product is a full-featured embedded Java runtime supporting applications based on the IMP-NG application model, which is derived from the well-known MIDP 2 application model. The runtime supports execution of multiple concurrent applications, remote application management, versatile connectivity, and a rich set of APIs and features relevant for embedded use cases, including the ability to interact with peripheral I/O directly from Java applications. This rich feature set, coupled with familiar and best-in class software development tools, allows developers to quickly build and deploy sophisticated embedded solutions for a wide range of use cases. Target markets well supported by Oracle Java ME Embedded 3.2 include wireless modules for M2M, industrial and building control, smart grid infrastructure, home automation, and environmental sensors and tracking. What tools are available for embedded application development for Oracle Java ME Embedded 3.2? Along with the release of Oracle Java ME Embedded 3.2, Oracle is also making available an updated version of the Java ME Software Development Kit (SDK), together with plug-ins for the NetBeans and Eclipse IDEs, to deliver a complete development environment for embedded application development.  OK – sounds great! Where can I find out more? And how do I get started? There is a complete set of information, data sheet, API documentation, “Getting Started Guide”, FAQ, and download links available: For an overview of Oracle Embeddable Java, see here. For the Oracle Java ME Embedded 3.2 press release, see here. For the Oracle Java ME Embedded 3.2 data sheet, see here. For the Oracle Java ME Embedded 3.2 landing page, see here. For the Oracle Java ME Embedded 3.2 documentation page, including a “Getting Started Guide” and FAQ, see here. For the Oracle Java ME SDK 3.2 landing and download page, see here. Finally, to ask more questions, please see the OTN “Java ME Embedded” forum To get started, grab the “Getting Started Guide” and download the Java ME SDK 3.2, which includes the Oracle Java ME Embedded 3.2 device emulation.  Can I learn more about Oracle Java ME Embedded 3.2 at JavaOne and/or Java Embedded @ JavaOne? Glad you asked Both conferences, JavaOne and Java Embedded @ JavaOne, will feature a host of content and information around the new Oracle Java ME Embedded 3.2 product, from technical and business sessions, to hands-on tutorials, and demos. Stay tuned, I will post details shortly. Cheers, – Terrence Filed under: Mobile & Embedded Tagged: "Oracle Java ME Embedded", Connected, embedded, Embedded Java, Java Embedded @ JavaOne, JavaOne, Smart

    Read the article

  • Introducing Oracle VM Server for SPARC

    - by Honglin Su
    As you are watching Oracle's Virtualization Strategy Webcast and exploring the great virtualization offerings of Oracle VM product line, I'd like to introduce Oracle VM Server for SPARC --  highly efficient, enterprise-class virtualization solution for Sun SPARC Enterprise Systems with Chip Multithreading (CMT) technology. Oracle VM Server for SPARC, previously called Sun Logical Domains, leverages the built-in SPARC hypervisor to subdivide supported platforms' resources (CPUs, memory, network, and storage) by creating partitions called logical (or virtual) domains. Each logical domain can run an independent operating system. Oracle VM Server for SPARC provides the flexibility to deploy multiple Oracle Solaris operating systems simultaneously on a single platform. Oracle VM Server also allows you to create up to 128 virtual servers on one system to take advantage of the massive thread scale offered by the CMT architecture. Oracle VM Server for SPARC integrates both the industry-leading CMT capability of the UltraSPARC T1, T2 and T2 Plus processors and the Oracle Solaris operating system. This combination helps to increase flexibility, isolate workload processing, and improve the potential for maximum server utilization. Oracle VM Server for SPARC delivers the following: Leading Price/Performance - The low-overhead architecture provides scalable performance under increasing workloads without additional license cost. This enables you to meet the most aggressive price/performance requirement Advanced RAS - Each logical domain is an entirely independent virtual machine with its own OS. It supports virtual disk mutipathing and failover as well as faster network failover with link-based IP multipathing (IPMP) support. Moreover, it's fully integrated with Solaris FMA (Fault Management Architecture), which enables predictive self healing. CPU Dynamic Resource Management (DRM) - Enable your resource management policy and domain workload to trigger the automatic addition and removal of CPUs. This ability helps you to better align with your IT and business priorities. Enhanced Domain Migrations - Perform domain migrations interactively and non-interactively to bring more flexibility to the management of your virtualized environment. Improve active domain migration performance by compressing memory transfers and taking advantage of cryptographic acceleration hardware. These methods provide faster migration for load balancing, power saving, and planned maintenance. Dynamic Crypto Control - Dynamically add and remove cryptographic units (aka MAU) to and from active domains. Also, migrate active domains that have cryptographic units. Physical-to-virtual (P2V) Conversion - Quickly convert an existing SPARC server running the Oracle Solaris 8, 9 or 10 OS into a virtualized Oracle Solaris 10 image. Use this image to facilitate OS migration into the virtualized environment. Virtual I/O Dynamic Reconfiguration (DR) - Add and remove virtual I/O services and devices without needing to reboot the system. CPU Power Management - Implement power saving by disabling each core on a Sun UltraSPARC T2 or T2 Plus processor that has all of its CPU threads idle. Advanced Network Configuration - Configure the following network features to obtain more flexible network configurations, higher performance, and scalability: Jumbo frames, VLANs, virtual switches for link aggregations, and network interface unit (NIU) hybrid I/O. Official Certification Based On Real-World Testing - Use Oracle VM Server for SPARC with the most sophisticated enterprise workloads under real-world conditions, including Oracle Real Application Clusters (RAC). Affordable, Full-Stack Enterprise Class Support - Obtain worldwide support from Oracle for the entire virtualization environment and workloads together. The support covers hardware, firmware, OS, virtualization, and the software stack. SPARC Server Virtualization Oracle offers a full portfolio of virtualization solutions to address your needs. SPARC is the leading platform to have the hard partitioning capability that provides the physical isolation needed to run independent operating systems. Many customers have already used Oracle Solaris Containers for application isolation. Oracle VM Server for SPARC provides another important feature with OS isolation. This gives you the flexibility to deploy multiple operating systems simultaneously on a single Sun SPARC T-Series server with finer granularity for computing resources.  For SPARC CMT processors, the natural level of granularity is an execution thread, not a time-sliced microsecond of execution resources. Each CPU thread can be treated as an independent virtual processor. The scheduler is naturally built into the CPU for lower overhead and higher performance. Your organizations can couple Oracle Solaris Containers and Oracle VM Server for SPARC with the breakthrough space and energy savings afforded by Sun SPARC Enterprise systems with CMT technology to deliver a more agile, responsive, and low-cost environment. Management with Oracle Enterprise Manager Ops Center The Oracle Enterprise Manager Ops Center Virtualization Management Pack provides full lifecycle management of virtual guests, including Oracle VM Server for SPARC and Oracle Solaris Containers. It helps you streamline operations and reduce downtime. Together, the Virtualization Management Pack and the Ops Center Provisioning and Patch Automation Pack provide an end-to-end management solution for physical and virtual systems through a single web-based console. This solution automates the lifecycle management of physical and virtual systems and is the most effective systems management solution for Oracle's Sun infrastructure. Ease of Deployment with Configuration Assistant The Oracle VM Server for SPARC Configuration Assistant can help you easily create logical domains. After gathering the configuration data, the Configuration Assistant determines the best way to create a deployment to suit your requirements. The Configuration Assistant is available as both a graphical user interface (GUI) and terminal-based tool. Oracle Solaris Cluster HA Support The Oracle Solaris Cluster HA for Oracle VM Server for SPARC data service provides a mechanism for orderly startup and shutdown, fault monitoring and automatic failover of the Oracle VM Server guest domain service. In addition, applications that run on a logical domain, as well as its resources and dependencies can be controlled and managed independently. These are managed as if they were running in a classical Solaris Cluster hardware node. Supported Systems Oracle VM Server for SPARC is supported on all Sun SPARC Enterprise Systems with CMT technology. UltraSPARC T2 Plus Systems ·   Sun SPARC Enterprise T5140 Server ·   Sun SPARC Enterprise T5240 Server ·   Sun SPARC Enterprise T5440 Server ·   Sun Netra T5440 Server ·   Sun Blade T6340 Server Module ·   Sun Netra T6340 Server Module UltraSPARC T2 Systems ·   Sun SPARC Enterprise T5120 Server ·   Sun SPARC Enterprise T5220 Server ·   Sun Netra T5220 Server ·   Sun Blade T6320 Server Module ·   Sun Netra CP3260 ATCA Blade Server Note that UltraSPARC T1 systems are supported on earlier versions of the software.Sun SPARC Enterprise Systems with CMT technology come with the right to use (RTU) of Oracle VM Server, and the software is pre-installed. If you have the systems under warranty or with support, you can download the software and system firmware as well as their updates. Oracle Premier Support for Systems provides fully-integrated support for your server hardware, firmware, OS, and virtualization software. Visit oracle.com/support for information about Oracle's support offerings for Sun systems. For more information about Oracle's virtualization offerings, visit oracle.com/virtualization.

    Read the article

  • Thursday Community Keynote: "By the Community, For the Community"

    - by Janice J. Heiss
    Sharat Chander, JavaOne Community Chairperson, began Thursday's Community Keynote. As part of the morning’s theme of "By the Community, For the Community," Chander noted that 60% of the material at the 2012 JavaOne conference was presented by Java Community members. "So next year, when the call for papers starts, put-in your submissions," he urged.From there, Gary Frost, Principal Member of Technical Staff, AMD, expanded upon Sunday's Strategy Keynote exploration of Project Sumatra, an OpenJDK project targeted at bringing Java to heterogeneous computing platforms (which combine the CPU and the parallel processor of the GPU into a single piece of silicon). Sumatra entails enhancing the JVM to make maximum use of these advanced platforms. Within this development space, AMD created the Aparapi API, which converts Java bytecode into OpenCL for execution on such GPU devices. The Aparapi API was open sourced in September 2011.Whether it was zooming-in on a Mandelbrot set, "the game of life," or a swarm of 10,000 Dukes in a space-bound gravitational dance, Frost's demos, using an Aparapi/OpenCL implementation, produced stunningly faster display results. He indicated that the Java 9 timeframe is where they see Project Sumatra coming to ultimate fruition, employing the Lamdas of Java 8.Returning to the theme of the keynote, Donald Smith, Director, Java Product Management, Oracle, explored a mind map graphic demonstrating the importance of Community in terms of fostering innovation. "It's the sharing and mixing of culture, the diversity, and the rapid prototyping," he said. Within this topic, Smith, brought up a panel of representatives from Cloudera, Eclipse, Eucalyptus, Perrone Robotics, and Twitter--ideal manifestations of community and innovation in the world of Java.Marten Mickos, CEO, Eucalyptus Systems, explored his company's open source cloud software platform, written in Java, and used by gaming companies, technology companies, media companies, and more. Chris Aniszczyk, Operations Engineering,Twitter, noted the importance of the JVM in terms of their multiple-language development environment. Mike Olson, CEO, Cloudera, described his company's Apache Hadoop-based software, support, and training. Mike Milinkovich, Executive Director, Eclipse Foundation, noted that they have about 270 tools projects at Eclipse, with 267 of them written in Java. Milinkovich added that Eclipse will even be going into space in 2013, as part of the control software on various experiments aboard the International Space Station. Lastly, Paul Perrone, CEO, Perrone Robotics, detailed his company's robotics and automation software platform built 100% on Java, including Java SE and Java ME--"on rat, to cat, to elephant-sized systems." Milinkovic noted that communities are by nature so good at innovation because of their very openness--"The more open you make your innovation process, the more ideas are challenged, and the more developers are focused on justifying their choices all the way through the process."From there, Georges Saab, VP Development Java SE OpenJDK, continued the topic of innovation and helping the Java Community to "Make the Future Java." Martijn Verburg, representing the London Java Community (winner of a Duke's Choice Award 2012 for their activity in OpenJDK and JCP), soon joined Saab onstage. Verburg detailed the LJC's "Adopt a JSR" program--"to get day-to-day developers more involved in the innovation that's happening around them."  From its London launching pad, the innovative program has spread to Brazil, Morocco, Latvia, India, and more.Other active participants in the program joined Verburg onstage--Ben Evans, London Java Community; James Gough, Stackthread; Bruno Souza, SOUJava; Richard Warburton, jClarity; and Cecelia Borg, Oracle--OpenJDK Onboarding. Together, the group explored the goals and tasks inherent in the Adopt a JSR program--from organizing hack days (testing prototype implementations), to managing mailing lists and forums, to triaging issues, to evangelism—all with the goal of fostering greater community/developer involvement, but equally importantly, building better open standards. “Come join us, and make your ecosystem better!" urged Verburg.Paul Perrone returned to profile the latest in his company's robotics work around Java--including the AARDBOTS family of smaller robotic vehicles, running the Perrone MAX platform on top of the Java JVM. Perrone took his "Rumbles" four-wheeled robot out for a spin onstage--a roaming, ARM-based security-bot vehicle, complete with IR, ultrasonic, and "cliff" sensors (the latter, for the raised stage at JavaOne). As an ultimate window into the future of robotics, Perrone displayed a "head-set" controller--a sensor directed at the forehead to monitor brainwaves, for the someday-implementation of brain-to-robot control.Then, just when it seemed this might be the end of the day's futuristic offerings, a mystery voice from offstage pronounced "I've got some toys"--proving to be guest-visitor James Gosling, there to explore his cutting-edge work with Liquid Robotics. While most think of robots as something with wheels or arms or lasers, Gosling explained, the Liquid Robotics vehicle is an entirely new and innovative ocean-going 'bot. Looking like a floating surfboard, with an attached set of underwater wings, the autonomous devices roam the oceans using only the energy of ocean waves to propel them, and a single actuated rudder to steer. "We have to accomplish all guidance just by wiggling the rudder," Gosling said. The devices offer applications from self-installing weather buoy, to pollution monitoring station, to marine mammal monitoring device, to climate change data gathering, to even ocean life genomic sampling. The early versions of the vehicle used C code on very tiny industrial micro controllers, where they had to "count the bytes one at a time."  But the latest generation vehicles, which just hit the water a week or so ago, employ an ARM processor running Linux and the ARM version of JDK 7. Gosling explained that vehicle communication from remote locations is achieved via the Iridium satellite network. But because of the costs of this communication path, the data must be sent in very small bursts--using SBD short burst data. "It costs $1/kb, so that rules everything in the software design,” said Gosling. “If you were trying to stream a Netflix video over this, it would cost a million dollars a movie. …We don't have a 'big data' problem," he quipped. There are currently about 150 Liquid Robotics vehicles out traversing the oceans. Gosling demonstrated real time satellite tracking of several vehicles currently at sea, noting that Java is actually particularly good at AI applications--due to the language having garbage collection, which facilitates complex data structures. To close-out his time onstage, Gosling of course participated in the ceremonial Java tee-shirt toss out to the audience…In parting, Chander passed the JavaOne Community Chairperson baton to Stephen Chin, Java Technology Evangelist, Oracle. Onstage in full motorcycle gear, Chin noted that he'll soon be touring Europe by motorcycle, meeting Java Community Members and streaming live via UStream--the ultimate manifestation of community and technology!  He also reminded attendees of the upcoming JavaOne Latin America 2012, São Paulo, Brazil (December 4-6, 2012), and stated that the CFP (call for papers) at the conference has been extended for one more week. "Remember, December is summer in Brazil!" Chin said.

    Read the article

  • Trace File Source Adapter

    The Trace File Source adapter is a useful addition to your SSIS toolbox.  It allows you to read 2005 and 2008 profiler traces stored as .trc files and read them into the Data Flow.  From there you can perform filtering and analysis using the power of SSIS. There is no need for a SQL Server connection this just uses the trace file. Example Usages Cache warming for SQL Server Analysis Services Reading the flight recorder Find out the longest running queries on a server Analyze statements for CPU, memory by user or some other criteria you choose Properties The Trace File Source adapter has two properties, both of which combine to control the source trace file that is read at runtime. SQL Server 2005 and SQL Server 2008 trace files are supported for both the Database Engine (SQL Server) and Analysis Services. The properties are managed by the Editor form or can be set directly from the Properties Grid in Visual Studio. Property Type Description AccessMode Enumeration This property determines how the Filename property is interpreted. The values available are: DirectInput Variable Filename String This property holds the path for trace file to load (*.trc). The value is either a full path, or the name of a variable which contains the full path to the trace file, depending on the AccessMode property. Trace Column Definition Hopefully the majority of you can skip this section entirely, but if you encounter some problems processing a trace file this may explain it and allow you to fix the problem. The component is built upon the trace management API provided by Microsoft. Unfortunately API methods that expose the schema of a trace file have known issues and are unreliable, put simply the data often differs from what was specified. To overcome these limitations the component uses  some simple XML files. These files enable the trace column data types and sizing attributes to be overridden. For example SQL Server Profiler or TMO generated structures define EventClass as an integer, but the real value is a string. TraceDataColumnsSQL.xml  - SQL Server Database Engine Trace Columns TraceDataColumnsAS.xml    - SQL Server Analysis Services Trace Columns The files can be found in the %ProgramFiles%\Microsoft SQL Server\100\DTS\PipelineComponents folder, e.g. "C:\Program Files\Microsoft SQL Server\100\DTS\PipelineComponents\TraceDataColumnsSQL.xml" "C:\Program Files\Microsoft SQL Server\100\DTS\PipelineComponents\TraceDataColumnsAS.xml" If at runtime the component encounters a type conversion or sizing error it is most likely due to a discrepancy between the column definition as reported by the API and the actual value encountered. Whilst most common issues have already been fixed through these files we have implemented specific exception traps to direct you to the files to enable you to fix any further issues due to different usage or data scenarios that we have not tested. An example error that you can fix through these files is shown below. Buffer exception writing value to column 'Column Name'. The string value is 999 characters in length, the column is only 111. Columns can be overridden by the TraceDataColumns XML files in "C:\Program Files\Microsoft SQL Server\100\DTS\PipelineComponents\TraceDataColumnsAS.xml". Installation The component is provided as an MSI file which you can download and run to install it. This simply places the files on disk in the correct locations and also installs the assemblies in the Global Assembly Cache as per Microsoft’s recommendations. You may need to restart the SQL Server Integration Services service, as this caches information about what components are installed, as well as restarting any open instances of Business Intelligence Development Studio (BIDS) / Visual Studio that you may be using to build your SSIS packages. Finally you will have to add the transformation to the Visual Studio toolbox manually. Right-click the toolbox, and select Choose Items.... Select the SSIS Data Flow Items tab, and then check the Trace File Source transformation in the Choose Toolbox Items window. This process has been described in detail in the related FAQ entry for How do I install a task or transform component? We recommend you follow best practice and apply the current Microsoft SQL Server Service pack to your SQL Server servers and workstations. Please note that the Microsoft Trace classes used in the component are not supported on 64-bit platforms. To use the Trace File Source on a 64-bit host you need to ensure you have the 32-bit (x86) tools available, and the way you execute your package is setup to use them, please see the help topic 64-bit Considerations for Integration Services for more details. Downloads Trace Sources for SQL Server 2005 -- Trace Sources for SQL Server 2008 Version History SQL Server 2008 Version 2.0.0.382 - SQL Sever 2008 public release. (9 Apr 2009) SQL Server 2005 Version 1.0.0.321 - SQL Server 2005 public release. (18 Nov 2008) -- Screenshots

    Read the article

< Previous Page | 222 223 224 225 226 227 228 229 230 231 232 233  | Next Page >