Search Results

Search found 48264 results on 1931 pages for 'text search'.

Page 227/1931 | < Previous Page | 223 224 225 226 227 228 229 230 231 232 233 234  | Next Page >

  • Server Bash Line Wrapping Over Text & In Wrong Place

    - by Pez Cuckow
    This is quite a hard problem to explain, when connecting to one of my servers using the bash shell, under any user the line wrapping is broken and has all sorts of problems. Once of which I detail in screenshots below: Other problems I experience include nano getting very confused about which line and or letter I am on, as shown by typing the same message into nano: These problems only occur when connecting as I previously mentioned to one of my servers which runs CentOs. Do you know why this is occurring and what I can do to fix it? On other servers the message works fine! Thanks for your time, Output of requested commands: Server that doesn't work properly: Working server: Could it perhaps be the custom prompt on the non working server? In .bashrc PS1='\e[1;32m\u@\h\e[m:\e[1;34m\w\e[m$ ' Commenting this out appeared to resolve the problem. Google says line wrapping errors can occur if you don't conform to these rules use the \[ escape to begin a sequence of non-printing characters, and the \] escape to signal the end of such a sequence I am not sure where this would fit in on my prompt?

    Read the article

  • Trouble retrieving inner text from XML node using JavaScript

    - by Jack Roscoe
    I'm reading an XML document using JavaScript & jQuery, and need to extract some text from inside a node to save into an array. The structure of the XML is as such: <C> <I> <TEXTFORMAT> <P> <FONT>Here's the text I want</FONT> </P> </TEXTFORMAT> </I> </C> Everything I've tried so far returns nothing so I must be incorrectly referencing the contents of the FONT tag. What XML path should I be using?

    Read the article

  • Search XDocument with LINQ with out knowing the Namespace

    - by BarDev
    Is there a way to search a XDocument without knowing the Namespace. I have a process that logs all soap requests and encrypts the sensitive data. I want to find any elements based on name. Something like, give me all elements where the name is CreditCard. I don't care what the namespace is. My problem seems to be with LINQ and requiring a xml namespace. I have other processes that retrieve values from XML, but I know the namespace for these other process. XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); XNamespace xNamespace = "http://CompanyName.AppName.Service.Contracts"; var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == xNamespace + "CreditCardNumber"); But what I really want, is to have the ability to search xml without knowing about namespaces, something like this: XDocument xDocument = XDocument.Load(@"C:\temp\Packet.xml"); var elements = xDocument.Root.DescendantsAndSelf().Elements().Where(d = d.Name == "CreditCardNumber") But of course this will not work be cause I do no have a namespace. BarDev

    Read the article

  • Capture Highlighted Text from any window using C#

    - by dineshrekula
    How to read the highlighted/Selected Text from any window using c#. i tried 2 approaches. Send "^c" whenever user selects some thing. But in this case my clipboard is flooded with lots of unnecessary data. Sometime it copied passwords also. so i switched my approach to 2nd method, send message method. see this sample code [DllImport("user32.dll")] static extern int GetFocus(); [DllImport("user32.dll")] static extern bool AttachThreadInput(uint idAttach, uint idAttachTo, bool fAttach); [DllImport("kernel32.dll")] static extern uint GetCurrentThreadId(); [DllImport("user32.dll")] static extern uint GetWindowThreadProcessId(int hWnd, int ProcessId); [DllImport("user32.dll") ] static extern int GetForegroundWindow(); [DllImport("user32.dll", CharSet = CharSet.Auto, SetLastError = false)] static extern int SendMessage(int hWnd, int Msg, int wParam, StringBuilder lParam); // second overload of SendMessage [DllImport("user32.dll")] private static extern int SendMessage(IntPtr hWnd, uint Msg, out int wParam, out int lParam); const int WM_SETTEXT = 12; const int WM_GETTEXT = 13; private string PerformCopy() { try { //Wait 5 seconds to give us a chance to give focus to some edit window, //notepad for example System.Threading.Thread.Sleep(5000); StringBuilder builder = new StringBuilder(500); int foregroundWindowHandle = GetForegroundWindow(); uint remoteThreadId = GetWindowThreadProcessId(foregroundWindowHandle, 0); uint currentThreadId = GetCurrentThreadId(); //AttachTrheadInput is needed so we can get the handle of a focused window in another app AttachThreadInput(remoteThreadId, currentThreadId, true); //Get the handle of a focused window int focused = GetFocus(); //Now detach since we got the focused handle AttachThreadInput(remoteThreadId, currentThreadId, false); //Get the text from the active window into the stringbuilder SendMessage(focused, WM_GETTEXT, builder.Capacity, builder); return builder.ToString(); } catch (System.Exception oException) { throw oException; } } this code working fine in Notepad. But if i try to capture from another applications like Mozilla firefox, or Visual Studio IDE, it's not returning the text. Can anybody please help me, where i am doing wrong? First of all, i have chosen the right approach?

    Read the article

  • Generating a text file in MYSQL stored procedure

    - by Pablo
    Hi, I'm new to MySQL, I am trying to create a text file using a stored procedure. I'm currently at the stage where I have a temporary table that contains all of the records that I want to output to a text file. I have the following line at the end of my SP, it works in PHPMYAdmin's query but it does not work when part of a stored procedure the code is as follows: SELECT * into outfile '../../htdocs/VIP/Temp/temp.txt' from tmp_Menu2; note that tmp_Menu2 is a table that only includes one field of type VARCHAR(1000) Any help would be greathly appreciated. Thank you,

    Read the article

  • Catch enter key press in input text field in AS3

    - by Jonathan Barbero
    Hello, I want to catch the enter key press when the user is filling an input text field in AS3. I think I have to do something like this: inputText.addEventListener(Event. ? , func); function func(e:Event):void{ if(e. ? == "Enter"){ doSomething(); } } But I can't find the best way to do this. By the way, the input text has a restriction: inputText.restrict = "0-9"; Should I add the enter key to the restrictions? inputText.restrict = "0-9\n"; Thanks in advance.

    Read the article

  • Override tooltip text for Titlebar buttons (Close, Maximize, Minimize, Help)

    - by Tim
    I have been trying without luck to change the text of the tooltip that appears for the buttons on the main title bar of a form. In a nutshell, we have harnessed the 'Help' button for Windows Forms to have some other purpose. This is working fine. The issue is that when hovering the mouse over that button, a 'Help' tooltip appears, which doesn't make any sense for the application. Ideally, there would be some way to change the text of that tooltip for my application; however, at this point I would be satisfied just finding a way to disable the tooltips altogether. I know that you can disable the tooltips for the entire OS by modifying the 'UserPreferencesMask' key in regedit, but I would really like a way to have this only affect my application. Again, ideally there would be some way to do this with managed code, but I would not be opposed to linking into the Windows API or the like. Thanks for any suggestions for resolving this issue!

    Read the article

  • printing foreign text for PHP on UBUNTU and CENTOS

    - by hao
    Hey guys, I am using domdocuments and using things like $div-nodeValue to obtain certain info from a web page. On my ubuntu machine when i do php crawl.php everything is displayed properly in Chinese (the page is in UTF-8). However on my CENTOS machine using the same code I get æ´å¤åå¸ when I print in the terminal. and when I save it to the database, the characters are also messed up. One thing I noticed is that when I do print $content, both systems display them properly.

    Read the article

  • Wordpress nav not visible in pages like articles, blog & search

    - by kwek-kwek
    My wordpress*(a custom template)* nav is all working on all of the pages but now I found out that the Main nav doesn't show on this pages All pages e.g. search.php, single.php, index.php, page.php all has <?php get_header(); ?> I really don't know whats wrong. Here is the code for my header.php <?php /** * @package WordPress * @subpackage Default_Theme */ ?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" <?php language_attributes() ?>> <head> <meta http-equiv="Content-Type" content="<?php bloginfo('html_type'); ?>; charset=<?php bloginfo('charset'); ?>" /> <title><?php bloginfo('name'); ?> <?php wp_title(); ?></title> <link rel="stylesheet" href="<?php bloginfo('stylesheet_url'); ?>" type="text/css" media="screen,projection" /> <link rel="stylesheet" href="<?php bloginfo('template_url'); ?>/css/sifr.css" type="text/css" /> <script src="<?php bloginfo('template_url'); ?>/js/sifr.js" type="text/javascript"></script> <script src="<?php bloginfo('template_url'); ?>/js/sifr-config.js" type="text/javascript"></script> <script src="http://cdn.jquerytools.org/1.1.2/jquery.tools.min.js"></script> <?php wp_head(); ?> </head> <?php $current_page = $post->ID; $parent = 1; while($parent) { $page_query = $wpdb->get_row("SELECT post_name, post_parent FROM $wpdb->posts WHERE ID = '$current_page'"); $parent = $current_page = $page_query->post_parent; if(!$parent) $parent_name = $page_query->post_name; } ?> <body id="<?php echo (is_page()) ? "$parent_name" : ((is_home()) ? "blog" : ((is_search()) ? "other" : ((is_single()) ? "blog" : "blog"))); ?>"> <div id="BGtie"> <!--HEAD WRAPPER--> <div id="headwrapper"> <!--HEADER--> <div id="headContainer"> <div id="nameTag"> <a href="<?php echo get_option('home'); ?>/"><?php bloginfo('name'); ?></a> </div> <!--TOP NAV--> <div id="topNav"> <ul> <li><a href="<?php bloginfo('url'); ?>home">Home</a></li> <li><a href="#">Request info</a></li> <li><a href="#">Contact us</a></li> <?php do_action('icl_language_selector'); ?> </ul> </div> <!--END TOP NAV--> <!--MAIN NAV--> <?php if ( is_page() AND (strtolower(ICL_LANGUAGE_CODE) == 'fr') ) {include("main-nav-fr.php");} ?> <?php if (is_page() AND (strtolower(ICL_LANGUAGE_CODE) == 'en')) include("main-nav-en.php") ?> <!--END MAIN NAV--> </div> <!--END HEADER--> </div> <!--END HEAD WRAPPER--> </div>

    Read the article

  • DataBinding: ComboBox.Text not updating when SelectedValue changes?

    - by Rob
    This is the relevant designer code for the ComboBox: Me.ProbationComboBox.DataBindings.Add(New System.Windows.Forms.Binding("Enabled", Me.RegistrationBindingSource, "IsRegistered", True)) Me.ProbationComboBox.DataBindings.Add(New System.Windows.Forms.Binding("SelectedValue", Me.RegistrationBindingSource, "ProbationID", True)) Me.ProbationComboBox.DataSource = Me.ProbationBindingSource Me.ProbationComboBox.DisplayMember = "probation" Me.ProbationComboBox.ValueMember = "id" The problem is that when I call RegistrationBindingSource.ResetCurrentItem(), the SelectedValue property is refreshed with the correct value from RegistrationBindingSource.ProbationID(). However, the Text property is not updated. Until I can figure out the problem with my binding, I've been doing this as a fix: Me.ProbationComboBox.Text = CType(CType(Me.ProbationBindingSource.Current, DataRowView).Row, RootNamespace.DataSet.probationRow).probation Any ideas? Your assistance is appreciated!

    Read the article

  • Text formatting within textarea

    - by musoNic80
    Variations on my problem have been discussed elsewhere, so I hope I'm not duplicating! I'm implementing a simple Private Messaging System as part of a web app. I've got an annoying problem though when dynamically inserting text into a textarea box in order to make a reply. Getting the content and displaying it is fine, but I can't work out how to format it correctly. Obviously, I can't use html tags, but plain text formatting like line breaks and carriage returns seem to be ignored too. This happens when an existing message is being displayed either as part of a reply or as a thread in a new message. How do I check what formatting is being saved in my db? Or indeed what formatting is being sent back from my db?!

    Read the article

  • MFC CTreeCtrl max visible item text length

    - by Steven smethurst
    Hello I have an application that outputs large amounts of text data to an MFC tree control. When I call SetItemText() with a long string (larger then 1000+ char) only the first ~250 chars are displayed in the control. But when I call GetItemText() on the item the entire string is returned (1000+ chars) My questions are; Is there a MAX visible string length for a MFC tree control? Is there any way to increase the visible limit? I have included example text code below // In header CTreeCtrl m_Tree; // In .cpp file void CTestDlg::OnDiagnosticsDebug() { CString csText; CString csItemText; csText.Format( _T("0123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789") ); for( int i = 0 ; i < 10 ; i ++ ) { csItemText += csText ; } bool b = m_Tree.SetItemText( m_Tree.GetRootItem(), csItemText ); return ; }

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Is it possible to use ContainsTable to get results for more than one column?

    - by LockeCJ
    Consider the following table: People FirstName nvarchar(50) LastName nvarchar(50) Let's assume for the moment that this table has a full-text index on it for both columns. Let's suppose that I wanted to find all of the people named "John Smith" in this table. The following query seems like a perfectly rational way to accomplish this: SELECT * from People p INNER JOIN CONTAINSTABLE(People,*,'"John*" AND "Smith*"') Unfortunately, this will return no results, assuming that there is no record in the People table that contains both "John" and "Smith" in either the FirstName or LastName columns. It will not match a record with "John" in the FirstName column, and "Smith" in the LastName column, or vice-versa. My question is this: How does one accomplish what I'm trying to do above? Please consider that the example above is simplified. The real table I'm working with has ten columns and the input I'm receiving is a single string which is split up based on standard word breakers (space, dash, etc.)

    Read the article

  • Setting HTML Text Element value

    - by Gpx
    Hi, in my C# WPF prog i´am trying to set a value of a HTML Text Element which is defined like: <input name="tbBName" type="text" id="tbBName" tabindex="1" /> What i found about it and tried is: mshtml.HTMLDocument doc = (mshtml.HTMLDocument)webBrowser1.Document; mshtml.HTMLInputTextElement tbName = (mshtml.HTMLInputTextElement)doc.getElementsByName("tbBName"); tbName.value = "Test"; But i got the exception: Unable to cast COM object of type 'System.__ComObject' to interface type 'mshtml.HTMLInputTextElement'. This operation failed because the QueryInterface call on the COM component for the interface with IID '{3050F520-98B5-11CF-BB82-00AA00BDCE0B}' failed due to the following error: No such interface supported (Exception from HRESULT: 0x80004002 (E_NOINTERFACE)). I know what it says but i dont know which object i can use to access the Texbox. Thanks for any answers.

    Read the article

  • Scrolling png with text & alpha on top of a static UIImageView

    - by heymon
    I have a view controller that has a view structure as follows: FilesOwner FirstResponder View ImageView (.jpg) ScrollView ImageView (.png) The text in the innermost imageview has white text and clear (alpha) all around. I want to scroll the innermost imageview, and see the background image (the .jpg) behind it. Its not working. Its acting like the scrollview background obscures the underneath .jpg. I say this because if I change the background color of the scrollview, that's what I see i.e. if I set it black, I see black behind my .png, if I set it white, I see white. If I change the alpha of the scrollview that doesn't seem to work either. The one other thing I tried was unchecking drawing: Opaque, but that doesn't get it either.

    Read the article

  • How to update the InnoSetup Wizard GUI status text from PascalScript code

    - by mkva
    Hi I execute a lot of custom actions in my InnoSetup script in the CurStepChanged(ssPostInstall) PascalScripting event handler. As these actions take some time to finish, I'd like to update the InnoSetup Wizard GUI status text and tell the user what is going on behind the scenes. Something similar that is possible in the [Run] section using the "StatusMsg" parameter. I know that I could use the TOutputProgressWizardPage/CreateOutputProgressPage(), and I did in a previous project, but it's a bit too much overkill to my liking... Is there a simpler possibility to update the InnoSetup Wizard GUI status text from PascalScripting code with the same effect as the StatusMsg parameter?

    Read the article

  • image and text in listobx

    - by Anu
    I want to inesrt one image beside one text,like this i have to include three items in listbox. in run time. If the number of items is more than 3,then the last items get removed. How can i do that in WPF,C#. And the newly added item should get added in first place. Now i did up to include text at runtime. if (listBox1.Items.Count >= 3) listBox1.Items.RemoveAt(2); listBox1.Items.Insert(0,lData); But i do nto know how to insert image(small rectangle with red colr,green color)

    Read the article

  • How to write content in a text file at the end of each line

    - by saravanan
    Hi, I am having one text file which contain following kind of data. "3P","Smith","Richard","3 Point Promotions","3P","[email protected]","IDA","Yes",,,,0,4,5,83.33,10, "A1","Ernest","Amy","TAKE 1 Promotional Products","LCOOK","[email protected]","IDA","Yes",,,,0,6,7,,0, "A2","Derek","Eaton","Advertising Edge Promotions","AE","[email protected]","IDA","Yes",,,,0,8,8,,10, "AAA","Abercrombie","Jerry","AAA Specialty Wholesale Inc","AAA","[email protected]","IDA","Yes",,,,0,9,9,,10, "AAP","Halberstam","Mendy","All About Promotions","AAP","[email protected]","IDA","Yes",,,,0,10,10,,12, Each of them are separate line.Now i want add another column in each like this "3P","Smith","Richard","3 Point Promotions","3P","[email protected]","IDA","Yes",,,,0,4,5,83.33,10,**96** "A1","Ernest","Amy","TAKE 1 Promotional Products","LCOOK","[email protected]","IDA","Yes",,,,0,6,7,,0,**97** "A2","Derek","Eaton","Advertising Edge Promotions","AE","[email protected]","IDA","Yes",,,,0,8,8,,10,**98** "AAA","Abercrombie","Jerry","AAA Specialty Wholesale Inc","AAA","[email protected]","IDA","Yes",,,,0,9,9,,10,**99** "AAP","Halberstam","Mendy","All About Promotions","AAP","[email protected]","IDA","Yes",,,,0,10,10,,12,**100** How i read content in line by line.And also how to write another value in same text file at each line.Please send solution for this problem.I am waiting for your reply.Thanks for reply. -Saravanan

    Read the article

  • How to remove lowercase sentence fragments from text?

    - by Aaron
    Hello: I'm tyring to remove lowercase sentence fragments from standard text files using regular expresions or a simple Perl oneliner. These are commonly referred to as speech or attribution tags, for example - he said, she said, etc. This example shows before and after using manual deletion: Original: "Ah, that's perfectly true!" exclaimed Alyosha. "Oh, do leave off playing the fool! Some idiot comes in, and you put us to shame!" cried the girl by the window, suddenly turning to her father with a disdainful and contemptuous air. "Wait a little, Varvara!" cried her father, speaking peremptorily but looking at them quite approvingly. "That's her character," he said, addressing Alyosha again. "Where have you been?" he asked him. "I think," he said, "I've forgotten something... my handkerchief, I think.... Well, even if I've not forgotten anything, let me stay a little." He sat down. Father stood over him. "You sit down, too," said he. All lower case sentence fragments manually removed: "Ah, that's perfectly true!" "Oh, do leave off playing the fool! Some idiot comes in, and you put us to shame!" "Wait a little, Varvara!" "That's her character," "Where have you been?" "I think," "I've forgotten something... my handkerchief, I think.... Well, even if I've not forgotten anything, let me stay a little." He sat down. Father stood over him. "You sit down, too," I've changed straight quotes " to balanced and tried: ” (...)+[.] Of course, this removes some fragments but deletes some text in balanced quotes and text starting with uppercase letters. [^A-Z] didn't work in the above expression. I realize that it may be impossible to achieve 100% accuracy but any useful expression, perl, or python script would be deeply appreciated. Cheers, Aaron

    Read the article

  • vsFTPD mixed SSL and plain text mode

    - by stan31337
    Is it possible to configure vsFTPD to use Explicit FTP over TLS for all connections except those coming from 127.0.0.1? Joomla website is being hosted on a server, and it's unable to use FTPES, so I had to set: force_local_data_ssl=NO force_local_logins_ssl=NO But I want to force content managers to use FTPES, and I am unable to control whether they have chosen FTP or FTPES in their client's connection properties. Thank you!

    Read the article

< Previous Page | 223 224 225 226 227 228 229 230 231 232 233 234  | Next Page >