Search Results

Search found 20569 results on 823 pages for 'long press'.

Page 237/823 | < Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >

  • Data adapter not filling my dataset

    - by Doug Ancil
    I have the following code: Imports System.Data.SqlClient Public Class Main Protected WithEvents DataGridView1 As DataGridView Dim instForm2 As New Exceptions Private Sub Button1_Click_1(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles startpayrollButton.Click Dim ssql As String = "select MAX(payrolldate) AS [payrolldate], " & _ "dateadd(dd, ((datediff(dd, '17530107', MAX(payrolldate))/7)*7)+7, '17530107') AS [Sunday]" & _ "from dbo.payroll" & _ " where payrollran = 'no'" Dim oCmd As System.Data.SqlClient.SqlCommand Dim oDr As System.Data.SqlClient.SqlDataReader oCmd = New System.Data.SqlClient.SqlCommand Try With oCmd .Connection = New System.Data.SqlClient.SqlConnection("Initial Catalog=mdr;Data Source=xxxxx;uid=xxxxx;password=xxxxx") .Connection.Open() .CommandType = CommandType.Text .CommandText = ssql oDr = .ExecuteReader() End With If oDr.Read Then payperiodstartdate = oDr.GetDateTime(1) payperiodenddate = payperiodstartdate.AddSeconds(604799) Dim ButtonDialogResult As DialogResult ButtonDialogResult = MessageBox.Show(" The Next Payroll Start Date is: " & payperiodstartdate.ToString() & System.Environment.NewLine & " Through End Date: " & payperiodenddate.ToString()) If ButtonDialogResult = Windows.Forms.DialogResult.OK Then exceptionsButton.Enabled = True startpayrollButton.Enabled = False End If End If oDr.Close() oCmd.Connection.Close() Catch ex As Exception MessageBox.Show(ex.Message) oCmd.Connection.Close() End Try End Sub Private Sub Button2_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles exceptionsButton.Click Dim connection As System.Data.SqlClient.SqlConnection Dim adapter As System.Data.SqlClient.SqlDataAdapter = New System.Data.SqlClient.SqlDataAdapter Dim connectionString As String = "Initial Catalog=mdr;Data Source=xxxxx;uid=xxxxx;password=xxxxx" Dim ds As New DataSet Dim _sql As String = "SELECT [Exceptions].Employeenumber,[Exceptions].exceptiondate, [Exceptions].starttime, [exceptions].endtime, [Exceptions].code, datediff(minute, starttime, endtime) as duration INTO scratchpad3" & _ " FROM Employees INNER JOIN Exceptions ON [Exceptions].EmployeeNumber = [Exceptions].Employeenumber" & _ " where [Exceptions].exceptiondate between @payperiodstartdate and @payperiodenddate" & _ " GROUP BY [Exceptions].Employeenumber, [Exceptions].Exceptiondate, [Exceptions].starttime, [exceptions].endtime," & _ " [Exceptions].code, [Exceptions].exceptiondate" connection = New SqlConnection(connectionString) connection.Open() Dim _CMD As SqlCommand = New SqlCommand(_sql, connection) _CMD.Parameters.AddWithValue("@payperiodstartdate", payperiodstartdate) _CMD.Parameters.AddWithValue("@payperiodenddate", payperiodenddate) adapter.SelectCommand = _CMD Try adapter.Fill(ds) If ds Is Nothing OrElse ds.Tables.Count = 0 OrElse ds.Tables(0).Rows.Count = 0 Then 'it's empty MessageBox.Show("There was no data for this time period. Press Ok to continue", "No Data") connection.Close() Exceptions.saveButton.Enabled = False Exceptions.Hide() Else connection.Close() End If Catch ex As Exception MessageBox.Show(ex.ToString) connection.Close() End Try Exceptions.Show() End Sub Private Sub payrollButton_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles payrollButton.Click Payrollfinal.Show() End Sub End Class and when I run my program and press this button Private Sub Button2_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles exceptionsButton.Click I have my date range within a time that I know that my dataset should produce a result, but when I put a line break in my code here: adapter.Fill(ds) and look at it in debug, I show a table value of 0. If I run the same query that I have to produce these results in sql analyser, I see 1 result. Can someone see why my query on my form produces a different result than the sql analyser does? Also here is my schema for my two tables: Exceptions employeenumber varchar no 50 yes no no SQL_Latin1_General_CP1_CI_AS exceptiondate datetime no 8 yes (n/a) (n/a) NULL starttime datetime no 8 yes (n/a) (n/a) NULL endtime datetime no 8 yes (n/a) (n/a) NULL duration varchar no 50 yes no no SQL_Latin1_General_CP1_CI_AS code varchar no 50 yes no no SQL_Latin1_General_CP1_CI_AS approvedby varchar no 50 yes no no SQL_Latin1_General_CP1_CI_AS approved varchar no 50 yes no no SQL_Latin1_General_CP1_CI_AS time timestamp no 8 yes (n/a) (n/a) NULL employees employeenumber varchar no 50 no no no SQL_Latin1_General_CP1_CI_AS name varchar no 50 no no no SQL_Latin1_General_CP1_CI_AS initials varchar no 50 no no no SQL_Latin1_General_CP1_CI_AS loginname1 varchar no 50 yes no no SQL_Latin1_General_CP1_CI_AS

    Read the article

  • How to remotely install Linux via SSH?

    - by netvope
    I need to remotely install Ubuntu Server 10.04 (x86) on a server currently running RHEL 3.4 (x86). I'll have to be very careful because no one can press the restart button for me if anything goes wrong. Have you ever remotely installed Linux? Which way would you recommend? Any advice for things to watch out? Update: Thanks for your help. I managed to "change the tires while driving"! The main components of my method are drawn from HOWTO - Install Debian Onto a Remote Linux System, grub legacy: Booting once-only, grub single boot and kernel panic reboot , and Ubuntu Community Documentation: InstallationFromKnoppix Here is the outline of what I did: Run debootstrap on an existing Ubuntu server Transfer the files to the swap partition of the RHEL 3.4 server Boot into tha swap partition (the debootstrap system) Transfer the files to the original root partition Boot into the new Ubuntu system and finish up the installation with tasksel, apt-get, etc I tested the method in a VM and then applied to the server. I was lucky enough that everything went smoothly :)

    Read the article

  • Identity.Name is disposed in a IIS7 Asp.NET MVC application Thread

    - by vIceBerg
    I have made the smallest demo project to illustrate my problem. You can download the sources Here Visual Studio 2008, .NET 3.5, IIS7, Windows 7 Ultimate 32 bits. The IIS Website is configured ONLY for Windows Authentication in an Integreated pipeline app pool (DefaultAppPool). Here's the problem. I have an Asp.NET MVC 2 application. In an action, I start a thread. The View returns. The thread is doing it's job... but it needs to access Thread.CurrentPrincipal.Identity.Name BANG The worker process of IIS7 stops. I have a window that says: "Visual Studio Just-In-Time Debugger An unhandled exception ('System.Object.DisposedException') occured in w3wp.exe [5524]" I checked with the debugger and the Thread.CurrentPrincipal.Identity is valid, but the Name property is disposed. If I put a long wait in the action before it returns the view, then the Thread can do it's job and the Identity.Name is not disposed. So I think the Name gets disposed when the view is returned. For the sake of the discussion, here's the code that the thread runs (but you can also download the demo project. The link is on top of this post): private void Run() { const int SECTOWAIT = 3; //wait SECTOWAIT seconds long end = DateTime.Now.Ticks + (TimeSpan.TicksPerSecond * SECTOWAIT); while (DateTime.Now.Ticks <= end) continue; //Check the currentprincipal. BANG!!!!!!!!!!!!! var userName = Thread.CurrentPrincipal.Identity.Name; } Here's the code that starts the thread public void Start() { Thread thread = new Thread(new ParameterizedThreadStart(ThreadProc)); thread.SetApartmentState(ApartmentState.MTA); thread.Name = "TestThread"; thread.Start(this); } static void ThreadProc(object o) { try { Builder builder = (Builder)o; builder.Run(); } catch (Exception ex) { throw; } } So... what am i doing wrong? Thanks

    Read the article

  • How can I get the type I want?

    - by Danny Chen
    There are a lot of such classes in my project (very old and stable code, I can't do many changes to them, maybe slight changes are OK) public class MyEntity { public long ID { get; set; } public string Name { get; set; } public decimal Salary { get; set; } public static GetMyEntity ( long ID ) { MyEntity e = new MyEntity(); // load data from DB and bind to this instance return e; } } For some reasons, now I need to do this: Type t = Type.GetType("XXX"); // XXX is one of the above classes' name MethodInfo staticM= t.GetMethods(BindingFlags.Public | BindingFlags.Static).FirstOrDefault();// I'm sure I can get the correct one var o = staticM.Invoke(...); //returns a object, but I want the type above! If I pass "MyEntity" at beginning, I hope I can get o as MyEntity! Please NOTE that I know the "name of the class" only. MyEntity e = staticM.Invoke(...) as MyEntity; can't be used here.

    Read the article

  • How to store unlimited characters in Oracle 11g?

    - by vicky21
    We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

    Read the article

  • SSH from Windows hangs when using insert mode in vim on Dreamhost: Why?

    - by cletus
    I have SSH set up using Cygwin on Windows XP SP3 to Dreamhost. It works fine except that when I edit a file with vi and use insert mode (eg press 'i' and type in some stuff). I then try and hit escape and ZZ to save/exit and it hangs instead. My edits aren't saved and I have to kill the session (locally) and kill the vi process on Dreamhost. This is highly annoying. It's not reliable either. Sometimes it does work. Also, this happens with PuTTY too.

    Read the article

  • Chrome: automatically redirect me to highest ranking search result, like Firefox does

    - by Siim K
    How to emulate the Firefox (I'm using v3.6) address bar search redirection in Google Chrome? For example, if I type... imdb moon ...to the address bar and press Return in Firefox then it redirects me straight to http://www.imdb.com/title/tt1182345/ (and I've not visited the page before) When I try this is Chrome then I just get the google search page http://www.google.com/search?sourceid=chrome&ie=UTF-8&q=imdb+moon So seems like Firefox redirects automatically to the highest ranking search result URL - is there a setting or add-on for Chrome to achieve the same behaviour?

    Read the article

  • JAVA Procedure Error

    - by Sam....
    java.sql.SQLException: [Microsoft][SQLServer 2000 Driver for JDBC][SQLServer]Procedure 'STP_Insert_tblReceipt' expects parameter '@CPVFlag', which was not supplied. I m getting error at This Point when trying to call procedure... Everything is perfect ,,,Count of Question marks are similar to parameter provided cs = conn.prepareCall("{call STP_Insert_tblReceipt(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?)}"); // cs = conn.prepareCall("{call STP_Receipt_Form_Insertion_Trial(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?)}"); cs.setLong(1, Long.parseLong(txtMobileNo.getText())); cs.setString(2, String.valueOf(cboDistributor.getSelectedItem())); cs.setLong(3, Long.parseLong(txtBoxNo.getText())); cs.setInt(4, Integer.parseInt(txtFileNo.getText())); cs.setString(5, pickUp_date); cs.setString(6, rec_date); cs.setString(7, String.valueOf(cmbCtrlNo.getSelectedItem())); cs.setString(8, UserName); cs.setString(9, rec_date); cs.setString(10, RegionLocation); cs.setString(11, txtRemark.getText().trim()); cs.setString(12, txtSimNo.getText().trim()); cs.setInt(13, 2); cs.setString(14, String.valueOf(cmbAryanRegion.getSelectedItem())); cs.setString(15, String.valueOf(cboPickUpType.getSelectedItem())); cs.setString(16, String.valueOf(txtCafNo.getText())); cs.setString(17, distributorId); //cs.setString(18, circleName); cs.setString(18, cboCircle.getSelectedItem().toString()); cs.registerOutParameter(19, java.sql.Types.INTEGER); cs.setString(20, auditorName); cs.setString(21, retailerName); cs.setString(22, retailerCode); cs.setInt(23, mappedFlag); //cs.setString(24, distCode); cs.setString(24, cboDistCode.getSelectedItem().toString()); //cs.setString(25, zoneName); cs.setString(25, cboZone.getSelectedItem().toString()); cs.setString(26, comment); **cs.setInt(27, 1);** **this is for CPV Flag** After this cs.execute();

    Read the article

  • How to configure mspaint on Windows Server 2008R2/ Win 7 to start up with 1-pixel canvas or auto-crop a pasted image?

    - by Fantomas
    I do a lot of screen print capturing, and I have just figured out how to use AutoHotKey to paste screen prints into MsPaint automatically. How to paste Print Screen on MS Paint automatically when press "PrtSc" button ? However, one small problem I have is that ... if I grabbed a screen with Alt-Prt Scr that is only 50x50 pixels, then there would be extra white margin around it, because MSPaint starts out with a larger canvas by default. How can I make it ALWAYS start with 1x1 instead?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Android: onListItemClick not opening up the .xml file

    - by Capsud
    Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

    Read the article

  • How can I keep an event from being delivered to the GUI until my code finished running?

    - by Frerich Raabe
    I installed a global mouse hook function like this: mouseEventHook = ::SetWindowsHookEx( WH_MOUSE_LL, mouseEventHookFn, thisModule, 0 ); The hook function looks like this: RESULT CALLBACK mouseEventHookFn( int code, WPARAM wParam, LPARAM lParam ) { if ( code == HC_ACTION ) { PMSLLHOOKSTRUCT mi = (PMSLLHOOKSTRUCT)lParam; // .. do interesting stuff .. } return ::CallNextHookEx( mouseEventHook, code, wParam, lParam ); } Now, my problem is that I cannot control how long the 'do interesting stuff' part takes exactly. In particular, it might take longer than the LowLevelHooksTimeout defined in the Windows registry. This means that, at least on Windows XP, the system no longer delivers mouse events to my hook function. I'd like to avoid this, but at the same time I need the 'do interesting stuff' part to happen before the target GUI receives the event. I attempted to solve this by doing the 'interesting stuff' work in a separate thread so that the mouseEventHookFn above can post a message to the worker thread and then do a return 1; immediately (which ends the hook function but avoids that the event is handed to the GUI). The idea was that the worker thread, when finished, performs the CallNextHookEx call itself. However, this causes a crash inside of CallNextHookEx (in fact, the crash occurs inside an internal function called PhkNextValid. I assume it's not safe to call CallNextHookEx from outside a hook function, is this true? If so, does anybody else know how I can run code (which needs to interact with the GUI thread of an application) before the GUI receives the event and avoid that my hook function blocks too long?

    Read the article

  • How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

    - by b14ck
    Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

    Read the article

  • How to use Java on Google App Engine without exceeding minute quotas?

    - by Geo
    A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

    Read the article

  • Windows undetectable after interrupted chkdsk

    - by Felthragar
    I have a computer that is running Windows XP. For some reason, the other day it wouldn't start giving me the following message: "ntoskrnl.exe is missing or corrupt" So I put the XP disc in the tray and fired up the repair console and ran the following: chkdsk /r It was on for about eight hours and it got to about 52% I believe. Then there was a power outage and the computer shut down (obviously). Today when I was booting it, it isn't even detecting there's an OS anymore. If I boot the computer with no cd in the tray it says: "Reboot and select a proper Boot device or Insert Boot Media in selected Boot device and press a key" If I run the repair console, or the xp installation program it isn't finding any OS installations. Any ideas on what to do next? Any help is appreciated. Thanks! Update: After turning boot-time diagnostics on, I got this message when booting without cd (instead of the previous one): "Couldn't open drive multi(0)disk(0)rdisk(0)partition(2)"

    Read the article

  • Packet fragmentation when sending data via SSLStream

    - by Ive
    When using an SSLStream to send a 'large' chunk of data (1 meg) to a (already authenticated) client, the packet fragmentation / dissasembly I'm seeing is FAR greater than when using a normal NetworkStream. Using an async read on the client (i.e. BeginRead()), the ReadCallback is repeatedly called with exactly the same size chunk of data up until the final packet (the remainder of the data). With the data I'm sending (it's a zip file), the segments happen to be 16363 bytes long. Note: My receive buffer is much bigger than this and changing it's size has no effect I understand that SSL encrypts data in chunks no bigger than 18Kb, but since SSL sits on top of TCP, I wouldn't think that the number of SSL chunks would have any relevance to the TCP packet fragmentation? Essentially, the data is taking about 20 times longer to be fully read by the client than with a standard NetworkStream (both on localhost!) What am I missing? EDIT: I'm beginning to suspect that the receive (or send) buffer size of an SSLStream is limited. Even if I use synchronous reads (i.e. SSLStream.Read()), no more data ever becomes available, regardless of how long I wait before attempting to read. This would be the same behavior as if I were to limit the receive buffer to 16363 bytes. Setting the Underlying NetworkStream's SendBufferSize (on the server), and ReceiveBufferSize (on the client) has no effect.

    Read the article

  • Match subpatterns in any order

    - by Yaroslav
    I have long regexp with two complicated subpatters inside. How i can match that subpatterns in any order? Simplified example: /(apple)?\s?(banana)?\s?(orange)?\s?(kiwi)?/ and i want to match both of apple banana orange kiwi apple orange banana kiwi It is very simplified example. In my case banana and orange is long complicated subpatterns and i don't want to do something like /(apple)?\s?((banana)?\s?(orange)?|(orange)?\s?(banana)?)\s?(kiwi)?/ Is it possible to group subpatterns like chars in character class? UPD Real data as requested: 14:24 26,37 Mb 108.53 01:19:02 06.07 24.39 19:39 46:00 my strings much longer, but it is significant part. Here you can see two lines what i need to match. First has two values: length (14 min 24 sec) and size 26.37 Mb. Second one has three values but in different order: size 108.53 Mb, length 01 h 19 m 02 s and date June, 07 Third one has two size and length Fourth has only length There are couple more variations and i need to parse all values. I have a regexp that pretty close except i can't figure out how to match patterns in different order without writing it twice. (?<size>\d{1,3}\[.,]\d{1,2}\s+(?:Mb)?)?\s? (?<length>(?:(?:01:)?\d{1,2}:\d{2}))?\s* (?<date>\d{2}\.\d{2}))? NOTE: that is only part of big regexp that forks fine already.

    Read the article

  • When to drop an IT job

    - by Nippysaurus
    In my career I have had two programming jobs. Both these jobs were in a field that I am most familiar with (C# / MSSQL) but I have quit both jobs for the same reason: unmanageable code and bad (loose) company structure. There was something in common with both these jobs: small companies (in one I was the only developer). Currently I am in the following position: being given written instructions which are almost impossible to follow (somewhat of a fools errand). we are given short time constraints, but seldom asked how long work will take, and when we do it is always too long and needs to be shorter (and when it ends up taking longer than they need it to take, it's always our fault). there is no time for proper documenting, but we get blamed for not documenting (see previous point). Management is constantly screwing me around, saying I'm underperforming on a given task (which is not true, and switching me to a task which is much more confusing). So I must ask my fellow developers: how bad does a job need to be before you would consider jumping ship? And what to look out for when considering taking a job. In future I will be asking about documented procedures, release control, bug management and adoption of new technologies. EDIT: Let me add some more fuel to the fire ... I have been in my current job for just over a year, and the work I am doing almost never uses any of the knowledge I have gained from the other work I have been doing here. Everything is a giant learning curve. Because of this about 30% of my time is learning what is going on with this new product (who's owner / original developer has left the company), 30% trying to find the relevant documentation that helps the whole thing make sense, 30% actually finding where to make the change, 10% actually making the change.

    Read the article

  • Spring + iBatis + Hessian caching

    - by ILya
    Hi. I have a Hessian service on Spring + iBatis working on Tomcat. I'm wondering how to cache results... I've made the following config in my sqlmap file: <sqlMap namespace="Account"> <cacheModel id="accountCache" type="MEMORY" readOnly="true" serialize="false"> <flushInterval hours="24"/> <flushOnExecute statement="Account.addAccount"/> <flushOnExecute statement="Account.deleteAccount"/> <property name="reference-type" value="STRONG" /> </cacheModel> <typeAlias alias="Account" type="domain.Account" /> <select id="getAccounts" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts; </select> <select id="getAccount" parameterClass="Long" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts where id=#id#; </select> <insert id="addAccount" parameterClass="Account"> fix all; insert into accounts (id, name, pin) values (#id#, #name#, #pin#); </insert> <delete id="deleteAccount" parameterClass="Long"> fix all; delete from accounts where id = #id#; </delete> </sqlMap> Then i've done some tests... I have a hessian client application. I'm calling getAccounts several times and after each call it's a query to DBMS. How to make my service to query DBMS only a first time (after server restart) getAccounts called and for the following calls to use a cache?

    Read the article

  • Is there a media player that allows me to group together radio streams which are just mirrors of the

    - by rakete
    I find it really annoying that for some radio stations, which have two or more servers to cope with the network load, there is not one single entry in amaroks playlist but two or more entries. This makes it hard to pick the radio station from the list I like to listen to because all the entries are always shown with the last played track as name, and even if I only have a few radio stations in my list there will eventually be many different entries. And, if I use the keyboard shortcuts to navigate the playlist I always have to remember that radio station X has for example four entries in the playlist, so I have to press the shortcut for switching tracks four times to actually switch the to the next station. Now, ideally I would like some solution for amarok, but if someone knows of another media player that does this or something I would appreciate that information as well.

    Read the article

  • Selectively delete entries from Windows 7 autocomplete history dropdown box

    - by kez
    Random question, and I'm sure it has a very simple answer, if not already asked and answered in some shape or form. How do you selectively delete entries from the autocomplete history dropdown thingy? For example, in the Run dialog box, typing a few letters will display a dropdown box with a history of matchine entries that you have previously run. I swear I used to be able to delete from the list by using the arrow keys to highlight and then press the DEL key. Regardless of whether this is true or not, is there any way to selectively delete entries from this list? Another example is the dropdown list in the Remote Desktop Connection dialog box.

    Read the article

  • VIM - how to substitute a word in-place?

    - by psihodelia
    I would like to substitute a word in-place. For example, after yanking some word by pressing yw and then I set a cursor on some other word, then I would like to press something so that substitution will happen. (e.g. SOME_KEYw where w is really w and SOME_KEY is some key). I would not like to switch into Insert Mode. I am not interested in :%s/oldword/newword/gc solution. I need interactive in-place substitution!

    Read the article

  • What's up with tab order on my Mac?

    - by biged781
    So, I just got my first Mac. It is slick, and I feel like I don't know how to do anything, but overall it is a great machine. However, I am becoming frustrated with the tab order in most web pages. For example, this site. If I am composing a comment and press tab, focus is set to the address bar. I would like the focus to shift to the button next to the text area, but no luck. Also, I cannot seem to tab into combo boxes in form pages. What is going on here exactly? This happens in FireFox as well as Safari. I don't get why the tab order of a page would not be respected. Any help is appreciated.

    Read the article

  • Windows 7 login automically puts "IIIII....." in password, so it is impossible for me to login?

    - by xaisoft
    I have no idea why this is happening. I have ran multiple malware programs, I have run anti-virus programs, I even restored to an early point in time. The keyboard letter "I" doesn't appear to be stuck, I am using an external keyboard by the way. When I reboot the computer and get to the login screen, when I press ctrl-alt-del to login, it the password textbox starts putting "IIIIIIIIIIII......", it only stops when I bang on the keyboard. I also noticed at one point that my caps lock on turned caps off and caps lock off turned caps on and some other weird behavior. I have tried search online for similar issues, but no luck.

    Read the article

  • USB keyboard not recognized by motherboard with only a legacy PS/2 header

    - by Luis
    I've bought a D945GSEJT Atom motheboard that has three usb ports available and no PS/2 connector, just a PS/2 header. I have a PS/2 keyboard with a PS/2 to USB adapter and connected it to a USB port. I tried all three USB ports. The problem is that the board seems to not recognize my keyboard. None of the keys I press are detected by the system. I've read that maybe I could try to change BIOS USB settings to solve this detection problem. But how can I do it if I can't type anything? Is there any other option other than buying a PS/2 adapter and plug it to the PS/2 header?

    Read the article

< Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >