Search Results

Search found 21960 results on 879 pages for 'program termination'.

Page 237/879 | < Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Installing Office Customization

    - by user187229
    Name: From: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto ********** Exception Text ********** Microsoft.VisualStudio.Tools.Applications.Deployment.AddInAlreadyInstalledException: The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.VerifySolutionCodebaseIsUnchanged(Uri uri, String subscriptionId, Boolean previouslyInstalled) at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.InstallAddIn()

    Read the article

  • VS2010 - Add template to New Project window

    - by gbogumil
    I am trying to add a new project template for an often used pattern. Starting from the class library template I have done the following (it still does not show up in the new project window): opened the .vstemplate file changed name and description to 'hard coded' values (my template). The values in there pulled from the csharpui.dll resources. changed the TemplateID, DefaultName, and ProjectItems included. saved these to the ProjectemplatesCache folder and as a zip in the ProjectTemplates folder. restarted VS2010 and checked the new project location which should have shown my new template. specifically, the folders I saved to were.. C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplatesCache\CSharp\Windows\1033\HostComm.zip (the zip is the folder name, not a zip file) and C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplates\CSharp\Windows\1033 (this folder has a HostComm.zip file in it) Has anyone else done this? Can it be done? If it can then what did I miss?

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • Windows Workflow and sql script in declarative config like InRule

    - by Satish
    We have been using InRule for our Rule needs we have found that it does not scale well and so are investigating the Windows Work Flow. Within InRule we could configure pretty much have any task for example our sql scripts and stored procedures where all part of a separate rule config file, I am wondering if there is a similar functionality within windows work flow where I could just call a declarative task and pass it a bunch of parameters – This task should contain the sql script I would be executing , we should be able to change the script at runtime without recompilation to the WF code. Is this possible in Windows Work flow – How can I accomplish this within work flow. Additionally for sql execution within Work Flow, how does it get the connection string. Should it be passed from the calling program – is passing it as input parameter from the Calling app via the Dictionary object the best way or can the work flow code have visibility to my calling program app.config and get the connection string ?

    Read the article

  • How do you run PartCover with spaces in the path?

    - by nportelli
    I have a msbuild file that I'm trying to run from Hudson CI. It outputs like this "C:\Program Files\Gubka Bob\PartCover .NET 2\PartCover.exe" --target "C:\Program Files\Microsoft Visual Studio 9.0\Common7\IDE\MSTest.exe" --target-args "/noisolation" "/testcontainer:C:\CI\Hudson\jobs\Video Raffle\workspace\Source\VideoRaffleCaller\Source\VideoRaffleCaller.Test.Unit\bin\Debug\VideoRaffleCaller.Test.Unit.dll" --include "[VideoRaffleCaller*]*" --output "Coverage\partcover.xml" I get this error Invalid switch "raffle\workspace\source\videorafflecaller\source\videorafflecall er.test.unit\bin\debug\videorafflecaller.test.unit.dll". For switch syntax, type "MSTest /help" WTF? Looks like PartCover doesn't handle spaces in the --target-args well. Or am I missing some quotes somewhere? Has anyone gotten something like to to work?

    Read the article

  • C# SerialPort - Problems mixing ports with different baud rates.

    - by GrandAdmiral
    Greetings, I have two devices that I would like to connect over a serial interface, but they have incompatible connections. To get around this problem, I connected them both to my PC and I'm working on a C# program that will route traffic on COM port X to COM port Y and vice versa. The program connects to two COM ports. In the data received event handler, I read in incoming data and write it to the other COM port. To do this, I have the following code: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); } } } That code worked fine as long as the outgoing COM port operated at a higher baud rate than the incoming COM port. If the incoming COM port was faster than the outgoing COM port, I started missing data. I had to correct the code like this: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); while (outPort.BytesToWrite > 0); //<-- Change to fix problem } } } I don't understand why I need that fix. I'm new to C# (this is my first program), so I'm wondering if there is something I am missing. The SerialPort defaults to a 2048 byte write buffer and my commands are less than ten bytes. The write buffer should have the ability to buffer the data until it can be written to a slower COM port. In summary, I'm receiving data on COM X and writing the data to COM Y. COM X is connected at a faster baud rate than COM Y. Why doesn't the buffering in the write buffer handle this difference? Why does it seem that I need to wait for the write buffer to drain to avoid losing data? Thanks!

    Read the article

  • BufferedReader.readLine() gives error java.net.SocketException: Software caused connection abort: re

    - by javatcp
    I am trying to code my program such that until the buffered reader gets something in readLine() from my tcp client it should keep running in the while loop checking but I get this error as soon as the program executes Mar 31, 2010 11:03:36 PM deswash.DESWashView$5 run SEVERE: null java.net.SocketException: Software caused connection abort: recv failed at java.net.SocketInputStream.socketRead0(Native Method) at java.net.SocketInputStream.read(SocketInputStream.java:129) at sun.nio.cs.StreamDecoder.readBytes(StreamDecoder.java:264) at sun.nio.cs.StreamDecoder.implRead(StreamDecoder.java:306) at sun.nio.cs.StreamDecoder.read(StreamDecoder.java:158) at java.io.InputStreamReader.read(InputStreamReader.java:167) at java.io.BufferedReader.fill(BufferedReader.java:136) at java.io.BufferedReader.readLine(BufferedReader.java:299) at java.io.BufferedReader.readLine(BufferedReader.java:362) at deswash.DESWashView$5.run(DESWashView.java:448) the second line in the following code throws the error while(running){ String temp = in.readLine(); if(!(temp.equals(null))){ int inid = Integer.parseInt(temp); stationList.add(inid); } }

    Read the article

  • ASN1 out of memory. during a signedCMS.decode

    - by JL
    I am having a problem using the signedCMS.decode routine. See the code below. The error seems to occur when the file size is too big in this case 11MB. private static void RemoveZfoSignature(string zfoFileName) { byte[] fileContents = File.ReadAllBytes(zfoFileName); var contentInfo = new ContentInfo(fileContents); var signedCms = new SignedCms(contentInfo); // This line throws the error 100% of the time signedCms.Decode(fileContents); signedCms.RemoveSignature(0); byte[] outfile = signedCms.ContentInfo.Content; string outFileName = zfoFileName.Replace(".zfo", "_tmp.zfo"); File.WriteAllBytes(outFileName, outfile); } Here is the exact error: "System.Security.Cryptography.CryptographicException: ASN1 out of memory. at System.Security.Cryptography.Pkcs.SignedCms.OpenToDecode(Byte[] encodedMessage, ContentInfo contentInfo, Boolean detached) at System.Security.Cryptography.Pkcs.SignedCms.Decode(Byte[] encodedMessage) at ConsoleApplication2.Program.RemoveZfoSignature(String zfoFileName) in C:\\Users\\\\Documents\\Visual Studio 2008\\Projects\\ConsoleApplication2\\ConsoleApplication2\\Program.cs:line 30" Any idea on how to fix this?

    Read the article

  • RAR password recovery on GPU using ATI Stream processor

    - by Wajdy Essam
    Hello, I'm newbie in GPU programming , and i work on brute force RAR Password Recovery on ATI Stream Processor using brook+ language, but i see that the kernel written in brook+ language doesn't allow any calling to normal functions (except kernel functions) , my questions is : 1) how to use unrar.dll (to unrar archive files) API in this situation? and is this the only way to program RAR password recovery? 2) what about crack and ElcomSoft software that use GPU , how they work ? 3) what exactly the role for the function work inside GPU (ATI Stream processor or CUDA) in this program? 4) is nVidia/CUDA technology is easier/more flexible than ATI/brook+ language ?

    Read the article

  • C# timer won't tick

    - by Andrej
    hi, i have a strange problem... I've been going out of my mind for the past couple of hours... the timer i put in my winform code (from the toolbar) won't tick... I have timers on a couple of forms in my program, they all work fine... I try to do exactly the same it this it won't tick... I select it, drag it on to a form, enable it, set interval and handle the tick event... and nothing happens... i even tried putting random code like messagebox.show in the tick event just to see if anything happens, and nothing!!! as I said, a have a couple of more timer in my program (on other forms, not in the one i'm trying to put this timer) and they all work fine... any suggestions? thanks in advance!

    Read the article

  • Service and Web Reference crashes Visual Studio

    - by CatZ
    When I move the mouse over any of these two or right click any of them Visual Studio crashes with the following message in the event log: Felet uppstod i programmet med namn: devenv.exe, version 9.0.30729.1, tidsstämpel 0x488f2b50 , felet uppstod i modulen med namn: ntdll.dll, version 6.1.7600.16385, tidsstämpel 0x4a5bdb3b Undantagskod: 0xc0000374 Felförskjutning: 0x000cdcbb Process-ID: 0xef4 Programmets starttid: 0x01cb07b7f1bd036d Sökväg till program: C:\Program Files (x86)\Microsoft Visual Studio 9.0\Common7\IDE\devenv.exe Sökväg till modul: C:\Windows\SysWOW64\ntdll.dll Rapport-ID: 46c92fc7-73ab-11df-b110-002481038dc3 Unfortunately it's the same thing in Visual Studio 2010 as it is in Visual Studio 2008. I have tried to repair the installation, reset all settings to default and Uninstall all plugins I have without any noticable results. Does anyone have any clue to what is going on? Salient part in English: Faulting application devenv.exe, version 9.0.30729.1, time stamp 0x488f2b50, faulting module ntdll.dll, version 6.1.7600.16385, time stamp 0x4a5bdb3b, exception code 0xc0000374, fault offset 0x000cdcbb, process id 0xef4, application start time 0x01cb07b7f1bd036d.

    Read the article

  • java cosine similarity problem

    - by agazerboy
    Hi again :) I developed some java program to calculate cosine similarity on the basis of TF*IDF. It worked very well. But there is one problem.... :( for example: If I have following two matrix and I want to calculate cosine similarity it does not work as rows are not same in length doc 1 1 2 3 4 5 6 doc 2 1 2 3 4 5 6 7 8 5 2 4 9 if rows and colums are same in length then my program works very well but it does not if rows and columns are not in same length. Any tips ???

    Read the article

  • Using Python to call Mencoder with some arguments

    - by Manu
    Hello, I'll start by saying that I am very, very new to Python. I used to have a Windows/Dos batch file in order to launch Mencoder with the right set of parameters, without having to type them each time. Things got messy when I tried to improve my script, and I decided that it would be a good opportunity to try coding something in python. I've come up with that : #!/usr/bin/python import sys, os #Path to mencoder mencoder = "C:\Program Files\MPlayer-1.0rc2\mencoder.exe" infile = "holidays.avi" outfile = "holidays (part1).avi" startTime = "00:48:00" length = "00:00:15" commande = "%s %s -ovc copy -oac copy -ss %s -endpos %s -o %s" os.system(commande % (mencoder, infile, startTime, length, outfile)) #Pause raw_input() But that doesn't work, windows complains that "C:\Program" is not recognized command. I've trying putting some "\"" here and there, but that didn't help.

    Read the article

  • vim filters and stdout/stderr

    - by ahe
    When I use :%! to run the contents of a file through a filter and the filter fails (it returns another code than 0) and prints an error message to stderr I get my file replaced with this error message. Is there a way to tell vim to skip the filtering if the filter returns an status code that indicates an error and/or ignore output the filter program writes to stderr? There are cases where you want your file to replaced with the output of the filter but most often this behavior is wrong. Of course I can just undo the filtering with one keypress but it isn't optimal. Also I have a similar problem when writing a custom vim script to do the filtering. I have a script that calls a filter program with system() and replaces the file in the buffer with its output but there doesn't seem to be a way to detect if the lines returned by system() where written to stdout or to stderr. Is there a way to tell them apart in vim script?

    Read the article

  • interaction between javascript (desktop application) and C#

    - by Roman Dorevich
    Hello. I am writing for my desktop some application for handling some services. I wrote in C# an application that calculates something (lets call it cl.exe) I created a .bat file that starts the cl.exe. I want to call that .bat file from my javascript so I WShell.Run(**.bat). 2 question: The javascript program will not continue till the cl.exe will end ? (It is synchronized ?) The cl.exe returns a value. How can the javascript take it (It is a javascript program that call .bat file that wrapp the execution of the cl.exe) ? Thanks

    Read the article

  • How to include text files with Executable Jar

    - by Jake
    Hi guys rookie Java question. I have a Java project and I want to include a text file with the executable jar. Right now the text file is in the default package. InputFlatFile currentFile = new InputFlatFile("src/theFile.txt"); I grab the file with that line as you can see using src. However this doesn't work with the executable jar. Can someone please let me know how to keep this file with the executable jar so someone using the program can just click a single icon and run the program. Thanks!

    Read the article

  • Redirect console input and output to a textbox.

    - by Peter
    Hi there and thanking in advance I am trying (very hard) to redirect Console input and output into a textbox. So far output is working fine but the trouble is with input. For example I cannot execute a simple program that will do the following: Console.WriteLine("Please enter your name: "); string name = Console.ReadLine(); Console.WriteLine("Hi there " + name); The reason I can't achieve this is because that the program has to stop while waiting for user to type his/her name and press enter. If I wait for user input on a new thread then the main GUI thread freezes and the textbox can never receive the KeyPress. This thing has me totally stumped. Any advice (or better still code) would be greatly appreciated. Cheers

    Read the article

  • Bacula windows client could not connect to Bacula director

    - by pr0f-r00t
    I have a Bacula server on my Linux Debian squeeze host (Bacula version 5.0.2) and a Bacula client on Windows XP SP3. On my network each client can see each other, can share files and can ping. On my local server I could run bconsole and the server responds but when I run bconsole or bat on my windows client the server does not respond. Here are my configuration files: bacula-dir.conf: # # Default Bacula Director Configuration file # # The only thing that MUST be changed is to add one or more # file or directory names in the Include directive of the # FileSet resource. # # For Bacula release 5.0.2 (28 April 2010) -- debian squeeze/sid # # You might also want to change the default email address # from root to your address. See the "mail" and "operator" # directives in the Messages resource. # Director { # define myself Name = nima-desktop-dir DIRport = 9101 # where we listen for UA connections QueryFile = "/etc/bacula/scripts/query.sql" WorkingDirectory = "/var/lib/bacula" PidDirectory = "/var/run/bacula" Maximum Concurrent Jobs = 1 Password = "Cv70F6pf1t6pBopT4vQOnigDrR0v3L" # Console password Messages = Daemon DirAddress = 127.0.0.1 # DirAddress = 72.16.208.1 } JobDefs { Name = "DefaultJob" Type = Backup Level = Incremental Client = nima-desktop-fd FileSet = "Full Set" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = File Priority = 10 Write Bootstrap = "/var/lib/bacula/%c.bsr" } # # Define the main nightly save backup job # By default, this job will back up to disk in /nonexistant/path/to/file/archive/dir Job { Name = "BackupClient1" JobDefs = "DefaultJob" } #Job { # Name = "BackupClient2" # Client = nima-desktop2-fd # JobDefs = "DefaultJob" #} # Backup the catalog database (after the nightly save) Job { Name = "BackupCatalog" JobDefs = "DefaultJob" Level = Full FileSet="Catalog" Schedule = "WeeklyCycleAfterBackup" # This creates an ASCII copy of the catalog # Arguments to make_catalog_backup.pl are: # make_catalog_backup.pl <catalog-name> RunBeforeJob = "/etc/bacula/scripts/make_catalog_backup.pl MyCatalog" # This deletes the copy of the catalog RunAfterJob = "/etc/bacula/scripts/delete_catalog_backup" Write Bootstrap = "/var/lib/bacula/%n.bsr" Priority = 11 # run after main backup } # # Standard Restore template, to be changed by Console program # Only one such job is needed for all Jobs/Clients/Storage ... # Job { Name = "RestoreFiles" Type = Restore Client=nima-desktop-fd FileSet="Full Set" Storage = File Pool = Default Messages = Standard Where = /nonexistant/path/to/file/archive/dir/bacula-restores } # job for vmware windows host Job { Name = "nimaxp-fd" Type = Backup Client = nimaxp-fd FileSet = "nimaxp-fs" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = Default Write Bootstrap = "/var/bacula/working/rsys-win-www-1-fd.bsr" #Change this } # job for vmware windows host Job { Name = "arg-michael-fd" Type = Backup Client = nimaxp-fd FileSet = "arg-michael-fs" Schedule = "WeeklyCycle" Storage = File Messages = Standard Pool = Default Write Bootstrap = "/var/bacula/working/rsys-win-www-1-fd.bsr" #Change this } # List of files to be backed up FileSet { Name = "Full Set" Include { Options { signature = MD5 } # # Put your list of files here, preceded by 'File =', one per line # or include an external list with: # # File = <file-name # # Note: / backs up everything on the root partition. # if you have other partitions such as /usr or /home # you will probably want to add them too. # # By default this is defined to point to the Bacula binary # directory to give a reasonable FileSet to backup to # disk storage during initial testing. # File = /usr/sbin } # # If you backup the root directory, the following two excluded # files can be useful # Exclude { File = /var/lib/bacula File = /nonexistant/path/to/file/archive/dir File = /proc File = /tmp File = /.journal File = /.fsck } } # List of files to be backed up FileSet { Name = "nimaxp-fs" Enable VSS = yes Include { Options { signature = MD5 } File = "C:\softwares" File = C:/softwares File = "C:/softwares" } } # List of files to be backed up FileSet { Name = "arg-michael-fs" Enable VSS = yes Include { Options { signature = MD5 } File = "C:\softwares" File = C:/softwares File = "C:/softwares" } } # # When to do the backups, full backup on first sunday of the month, # differential (i.e. incremental since full) every other sunday, # and incremental backups other days Schedule { Name = "WeeklyCycle" Run = Full 1st sun at 23:05 Run = Differential 2nd-5th sun at 23:05 Run = Incremental mon-sat at 23:05 } # This schedule does the catalog. It starts after the WeeklyCycle Schedule { Name = "WeeklyCycleAfterBackup" Run = Full sun-sat at 23:10 } # This is the backup of the catalog FileSet { Name = "Catalog" Include { Options { signature = MD5 } File = "/var/lib/bacula/bacula.sql" } } # Client (File Services) to backup Client { Name = nima-desktop-fd Address = localhost FDPort = 9102 Catalog = MyCatalog Password = "_MOfxEuRzxijc0DIMcBqtyx9iW1tzE7V6" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # Client file service for vmware windows host Client { Name = nimaxp-fd Address = nimaxp FDPort = 9102 Catalog = MyCatalog Password = "Ku8F1YAhDz5EMUQjiC9CcSw95Aho9XbXailUmjOaAXJP" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # Client file service for vmware windows host Client { Name = arg-michael-fd Address = 192.168.0.61 FDPort = 9102 Catalog = MyCatalog Password = "b4E9FU6s/9Zm4BVFFnbXVKhlyd/zWxj0oWITKK6CALR/" # password for FileDaemon File Retention = 30 days # 30 days Job Retention = 6 months # six months AutoPrune = yes # Prune expired Jobs/Files } # # Second Client (File Services) to backup # You should change Name, Address, and Password before using # #Client { # Name = nima-desktop2-fd # Address = localhost2 # FDPort = 9102 # Catalog = MyCatalog # Password = "_MOfxEuRzxijc0DIMcBqtyx9iW1tzE7V62" # password for FileDaemon 2 # File Retention = 30 days # 30 days # Job Retention = 6 months # six months # AutoPrune = yes # Prune expired Jobs/Files #} # Definition of file storage device Storage { Name = File # Do not use "localhost" here Address = localhost # N.B. Use a fully qualified name here SDPort = 9103 Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" Device = FileStorage Media Type = File } # Definition of DDS tape storage device #Storage { # Name = DDS-4 # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # password for Storage daemon # Device = DDS-4 # must be same as Device in Storage daemon # Media Type = DDS-4 # must be same as MediaType in Storage daemon # Autochanger = yes # enable for autochanger device #} # Definition of 8mm tape storage device #Storage { # Name = "8mmDrive" # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # Device = "Exabyte 8mm" # MediaType = "8mm" #} # Definition of DVD storage device #Storage { # Name = "DVD" # Do not use "localhost" here # Address = localhost # N.B. Use a fully qualified name here # SDPort = 9103 # Password = "Cj-gtxugC4dAymY01VTSlUgMTT5LFMHf9" # Device = "DVD Writer" # MediaType = "DVD" #} # Generic catalog service Catalog { Name = MyCatalog # Uncomment the following line if you want the dbi driver # dbdriver = "dbi:sqlite3"; dbaddress = 127.0.0.1; dbport = dbname = "bacula"; dbuser = ""; dbpassword = "" } # Reasonable message delivery -- send most everything to email address # and to the console Messages { Name = Standard # # NOTE! If you send to two email or more email addresses, you will need # to replace the %r in the from field (-f part) with a single valid # email address in both the mailcommand and the operatorcommand. # What this does is, it sets the email address that emails would display # in the FROM field, which is by default the same email as they're being # sent to. However, if you send email to more than one address, then # you'll have to set the FROM address manually, to a single address. # for example, a '[email protected]', is better since that tends to # tell (most) people that its coming from an automated source. # mailcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula: %t %e of %c %l\" %r" operatorcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula: Intervention needed for %j\" %r" mail = root@localhost = all, !skipped operator = root@localhost = mount console = all, !skipped, !saved # # WARNING! the following will create a file that you must cycle from # time to time as it will grow indefinitely. However, it will # also keep all your messages if they scroll off the console. # append = "/var/lib/bacula/log" = all, !skipped catalog = all } # # Message delivery for daemon messages (no job). Messages { Name = Daemon mailcommand = "/usr/lib/bacula/bsmtp -h localhost -f \"\(Bacula\) \<%r\>\" -s \"Bacula daemon message\" %r" mail = root@localhost = all, !skipped console = all, !skipped, !saved append = "/var/lib/bacula/log" = all, !skipped } # Default pool definition Pool { Name = Default Pool Type = Backup Recycle = yes # Bacula can automatically recycle Volumes AutoPrune = yes # Prune expired volumes Volume Retention = 365 days # one year } # File Pool definition Pool { Name = File Pool Type = Backup Recycle = yes # Bacula can automatically recycle Volumes AutoPrune = yes # Prune expired volumes Volume Retention = 365 days # one year Maximum Volume Bytes = 50G # Limit Volume size to something reasonable Maximum Volumes = 100 # Limit number of Volumes in Pool } # Scratch pool definition Pool { Name = Scratch Pool Type = Backup } # # Restricted console used by tray-monitor to get the status of the director # Console { Name = nima-desktop-mon Password = "-T0h6HCXWYNy0wWqOomysMvRGflQ_TA6c" CommandACL = status, .status } bacula-fd.conf on client: # # Default Bacula File Daemon Configuration file # # For Bacula release 5.0.3 (08/05/10) -- Windows MinGW32 # # There is not much to change here except perhaps the # File daemon Name # # # "Global" File daemon configuration specifications # FileDaemon { # this is me Name = nimaxp-fd FDport = 9102 # where we listen for the director WorkingDirectory = "C:\\Program Files\\Bacula\\working" Pid Directory = "C:\\Program Files\\Bacula\\working" # Plugin Directory = "C:\\Program Files\\Bacula\\plugins" Maximum Concurrent Jobs = 10 } # # List Directors who are permitted to contact this File daemon # Director { Name = Nima-desktop-dir Password = "Cv70F6pf1t6pBopT4vQOnigDrR0v3L" } # # Restricted Director, used by tray-monitor to get the # status of the file daemon # Director { Name = nimaxp-mon Password = "q5b5g+LkzDXorMViFwOn1/TUnjUyDlg+gRTBp236GrU3" Monitor = yes } # Send all messages except skipped files back to Director Messages { Name = Standard director = Nima-desktop = all, !skipped, !restored } I have checked my firewall and disabled the firewall but it doesn't work.

    Read the article

  • Ant build.xml requires user input, but Eclipse has no tty

    - by carneades
    I'm trying to better integrate Eclipse with my build.xml. My build file calls GNU Make for the native portion of the program, and the Makefile uses sudo to movethe compiled libs into system path. Unfortunately that requires entering a password, and Eclipse's terminal doesn't accept user input. So the result from running the build in eclipse is: [exec] sudo: no tty present and no askpass program specified [exec] make: *** [install] Error 1 Any way around this problem? Can the ant build be elevated to root some other way?

    Read the article

  • PHP: Can pcntl_alarm() and socket_select() peacefully exist in the same thread?

    - by DWilliams
    I have a PHP CLI script mostly written that functions as a chat server for chat clients to connect to (don't ask me why I'm doing it in PHP, thats another story haha). My script utilizes the socket_select() function to hang execution until something happens on a socket, at which point it wakes up, processes the event, and waits until the next event. Now, there are some routine tasks that I need performed every 30 seconds or so (check of tempbanned users should be unbanned, save user databases, other assorted things). From what I can tell, PHP doesn't have very great multi-threading support at all. My first thought was to compare a timestamp every time the socket generates an event and gets the program flowing again, but this is very inconsistent since the server could very well sit idle for hours and not have any of my cleanup routines executed. I came across the PHP pcntl extensions, and it lets me use assign a time interval for SIGALRM to get sent and a function get executed every time it's sent. This seems like the ideal solution to my problem, however pcntl_alarm() and socket_select() clash with each other pretty bad. Every time SIGALRM is triggered, all sorts of crazy things happen to my socket control code. My program is fairly lengthy so I can't post it all here, but it shouldn't matter since I don't believe I'm doing anything wrong code-wise. My question is: Is there any way for a SIGALRM to be handled in the same thread as a waiting socket_select()? If so, how? If not, what are my alternatives here? Here's some output from my program. My alarm function simply outputs "Tick!" whenever it's called to make it easy to tell when stuff is happening. This is the output (including errors) after allowing it to tick 4 times (there were no actual attempts at connecting to the server despite what it says): [05-28-10 @ 20:01:05] Chat server started on 192.168.1.28 port 4050 [05-28-10 @ 20:01:05] Loaded 2 users from file PHP Notice: Undefined offset: 0 in /home/danny/projects/PHPChatServ/ChatServ.php on line 112 PHP Warning: socket_select(): unable to select [4]: Interrupted system call in /home/danny/projects/PHPChatServ/ChatServ.php on line 116 [05-28-10 @ 20:01:15] Tick! PHP Warning: socket_accept(): unable to accept incoming connection [4]: Interrupted system call in /home/danny/projects/PHPChatServ/ChatServ.php on line 126 [05-28-10 @ 20:01:25] Tick! PHP Warning: socket_getpeername() expects parameter 1 to be resource, boolean given in /home/danny/projects/PHPChatServ/ChatServ.php on line 129 [05-28-10 @ 20:01:25] Accepting socket connection from PHP Notice: Undefined offset: 1 in /home/danny/projects/PHPChatServ/ChatServ.php on line 112 PHP Warning: socket_select(): unable to select [4]: Interrupted system call in /home/danny/projects/PHPChatServ/ChatServ.php on line 116 [05-28-10 @ 20:01:35] Tick! PHP Warning: socket_accept(): unable to accept incoming connection [4]: Interrupted system call in /home/danny/projects/PHPChatServ/ChatServ.php on line 126 [05-28-10 @ 20:01:45] Tick! PHP Warning: socket_getpeername() expects parameter 1 to be resource, boolean given in /home/danny/projects/PHPChatServ/ChatServ.php on line 129 [05-28-10 @ 20:01:45] Accepting socket connection from PHP Notice: Undefined offset: 2 in /home/danny/projects/PHPChatServ/ChatServ.php on line 112

    Read the article

< Previous Page | 233 234 235 236 237 238 239 240 241 242 243 244  | Next Page >