Search Results

Search found 60072 results on 2403 pages for 'application performance'.

Page 246/2403 | < Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >

  • How to add some Spring attributes when the application starts

    - by user198147
    I am new to Spring framework and I am working on a web application that must be multilanguage. The tanslated values are in the database and I don't want that each time I am rendering a view to pick the values from the database. The idea is to get them somewhere from the application. So, I want to load this values when my application starts and I don't know where exactly and where to put them. Thank you for your help!

    Read the article

  • Problem running application on windows server 2008 instance using amazon ec2 service and WAMP

    - by Siddharth
    I have a basic (small type) windows server 2008 instance running on amazon ec2. I've installed WAMP server on to it, and have also loaded my application. I did this using Remote desktop Connection from my windows machine. I'm able to run my application locally on the instance, however when I try to access it using the public DNS given to it by amazon, from my browser, I'm unable to do so. My instance has a security group that is configured to allow HTTP, HTTPS, RDP, SSH and SMTP requests on different ports. In fact I have the exact same security group as the one used in this blog, http://howto.opml.org/dave/ec2/ I did almost everything same as the blog, except for using a different Amazon Machine Image. This is my first time using amazon ec2, and i can't figure out what I'm doing wrong here

    Read the article

  • how to create a custom application in twitter?

    - by monish
    Hi guys, I’m trying to register a custom application in twitter can any one give some suggestions how to register a custom application in twitter? As I am new to twitter I didn’t found any controls to create to register for creating a custom application. Anyone's help will be much appreciated. Thank you, Monish.

    Read the article

  • Have parameters in Dao methods to get entities the most efficient way for read-only access

    - by Blankman
    Allot of my use of hibernate, at least for that data that is presented on many parts of the web application, is for read-only purposes. I want to add some parameters to my Dao methods so I can modify the way hibernate pulls the data and how it handles transactions etc. Example usage: Data on the front page of my website is displayed to the users, it is read-only, so I want to avoid any session/entity tracking that hibernate usually does. This is data that is read-only, will not be changed in this transaction, etc. What would be the most performant way to pull the data? (the code below is c#/nhibernate, I'm implementing this in java as I learn it) public IList<Article> GetArticles() { return Session.CreateCriteria(typeof(Article)) // some where cluase }

    Read the article

  • Fastest implementation of the frac function in C#

    - by user349937
    I would like to implement a frac function in C# (just like the one in hsl here http://msdn.microsoft.com/en-us/library/bb509603%28VS.85%29.aspx) but since it is for a very processor intensive application i would like the best version possible. I was using something like public float Frac(float value) { return value - (float)Math.Truncate(value); } but I'm having precision problems, for example for 2.6f it's returning in the unit test Expected: 0.600000024f But was: 0.599999905f I know that I can convert to decimal the value and then at the end convert to float to obtain the correct result something like this: public float Frac(float value) { return (float)((decimal)value - Decimal.Truncate((decimal)value)); } But I wonder if there is a better way without resorting to decimals...

    Read the article

  • SetParent() on a VB6 application from a C# app

    - by JD
    Aloha all! I am trying to use the win32 API to set the parent of an application to a panel in my C# application. I can get most applications to work... However I have one application which was written in VB6 which I am having problems with... When I inspect it using spy++ the application loads in 2 main forms 'ThunderRT6Main' and 'ThunderRT6MDIForm' both with the same title. I have found the handle of both of these and tried to call SetParent on them both but the window does nothing and does not move anywhere... Is there something funky I need to do when invoking SetParent() on a VB6 app?

    Read the article

  • Block all other input to an application and control it from a wrapper in Java

    - by Oren
    I have a windows application which has a complex GUI that I would like to hide from users. In order to do this, I would like to create a wrapper with an extremely simple interface that overlays this application and automates a number of actions when a user clicks a single button on the wrapper. (I hope "wrapper" is the proper term.) Is it possible to use Java to block input to the underlying application so that users cannot inadvertently mess up the automation? How would I go about this? Also, how can I automate key presses and clicks to the application without hijacking the mouse? Is this possible in Java? I have looked at java.awt.Robot, but it appears to hijack the mouse. I have also looked at AutoIT, but it too hijacks the mouse and does not integrate with Java. Neither of these options seem powerful enough for what I need, but I do not know how else to proceed.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Interactive mode of PSExec not working for console application

    - by Focker
    I am trying to use PSExec to kick off a console application on a remote computer in an interactive state. When I run something like this: PsExec.exe -s -d -i 1 \\MyServer notepad.exe It launches Notepad just fine. If I then run this: PsExec.exe -s -d -i 1 \\MyServer C:\Temp\MyConsoleApp.exe It launches the command windows but doesn't do anything as far as I can tell. As in, when I run my console application locally, it displays a "heartbeat" every 5 seconds, but when I run it remotely, nothing is displayed in the command window. The .exe does show up as a process in Task Manager. Any ideas?

    Read the article

  • Application outside document root in Apache/CentOS

    - by liz
    I have a PHP application running in Apache on CentOS 6. The document root is pointed to a specific app folder: /var/www/my-project/app I'm trying to get phpMyAdmin running on the same server but I don't want to put it in the application folder. Instead I'd like to put it here /var/www/apps/phpmyadmin I'm using a sub domain for the server. What's the easiest way for me to get access to phpMyAdmin? Another subdomain? sub subdomain? Re-direct a folder?

    Read the article

  • Retrieving Spotlight query used to open document in application

    - by vicvicvic
    If you search for something that opens Preview.app (e.g. a PDF file) in Spotlight, the application not only opens the file but actually copies the Spotlight query into the application's search field (for deeper search). iPhoto and Mail.app also do this. This is a really nice feature. Unfortunately, Apple does not document how it's implemented. Opening a document from Spotlight appears to simply send application:openFile to the application delegate. Is it possible to retrieve the user's Spotlight query somehow? Or is this a hardcoded feature of Spotlight?

    Read the article

  • air application fullscreen trouble

    - by tsemer
    Hi there, I am working on an adobe AIR application and having trouble with fullscreen. When I set the application in fullscreen (stage.displayState = StageDisplayState.FULL_SCREEN;) the display freezes and nothing is being rendered. When I set it back to normal (by pressing esc) the application works fine. thanks

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • ValidatorResources not found in application

    - by jojolapin
    I had been told to deploy a *.war file within tomcat and this application should be working fine. But for an unknown reason all I get is: System Exception: javax.servlet.jsp.JspException: ValidatorResources not found in application scope under key "org.apache.commons.validator.VALIDATOR_RESOURCES" I know that this application has been developed with STRUTS and I can obtain the source. But as I am not a specialist in this field, I come to ask for some help. Could you tell me what file could generate this exception please?

    Read the article

  • Programmatically add an application to Windows Firewall

    - by RichieACC
    I have an application that is installed and updated via ClickOnce. The application downloads files via FTP, and therefore needs to be added as an exception to the windows firewall. Because of the way that ClickOnce works, the path to the EXE changes with every update, so the exception needs to change also. What would be the best way to have the changes made to the firewall so that it's invisible to the end user? (The application is written in C#)

    Read the article

  • DOS application to allow remote management of files over serial link

    - by tomlogic
    Harken back to the days of DOS. I have an embedded DOS handheld device, and I'm looking for a tool to manage the files stored on it. I picture an application I can launch on the device that opens COM1 up for commands to get a directory listing, send/receive files via x/y/zmodem, move/delete files, and create/move/delete directories. A Windows application can then download a recursive file listing and then manage those files (for example, synchronizing with a local directory). Keep in mind that this is DOS -- 8.3 filenames, 640K of RAM and a 19200bps serial link (yuk!). I'd prefer something with source in case we need to add additional features (for example, the ability to get a checksum of a file for change detection). Now that I've written this description, I realize I'm asking for something like LapLink or pcAnywhere. Norton no longer sells DOS versions of pcAnywhere and LapLink V for DOS seems pricy at $50. Are you aware of any similar apps from those good old days?

    Read the article

  • limit of connections with database and number of java threads in an application

    - by Jyoti
    Hi, I am working to develop a JMS application(stand alone multithreaded java application) which can receive 100 messages at a time , they need to be processed and database procedures need to be called for inserting/updating data. Procedures are very heavy as validations are also performed in them. Each procedure is taking about 30 to 50 seconds of time to execute and they are capable to run concurrently. My concern is to execute 100 procedures for all 100 messages and also send reply within time limit of 90 seconds by jms application. No application server to be used(requirement) and database is Teradata (RDBMS) I am using connection pool and thread pool in java code and testing code with 90 connections. Question is : (1) What should be the limit on number of connections with database at a time? (2) How many threads at a time are recommended? Thanks, Jyoti

    Read the article

  • Compute jvm heap size to host web application

    - by Enrique
    Hello, I want to host a web application on a private JVM they offer 32, 64, 128, 256 MB plans. My web application uses Spring. And I store some objects for every logged in user session. My question is: How can I profile my web app to see how much heap size it needs so I can choose a plan?, How can I simulate hundreds of users logged in at the same time? I'm developing the application using Netbeans 6.7 Java 1.6 Tomcat 6.0.18 Thank you.

    Read the article

  • How to increase query speed without using full-text search?

    - by andre matos
    This is my simple query; By searching selectnothing I'm sure I'll have no hits. SELECT nome_t FROM myTable WHERE nome_t ILIKE '%selectnothing%'; This is the EXPLAIN ANALYZE VERBOSE Seq Scan on myTable (cost=0.00..15259.04 rows=37 width=29) (actual time=2153.061..2153.061 rows=0 loops=1) Output: nome_t Filter: (nome_t ~~* '%selectnothing%'::text) Total runtime: 2153.116 ms myTable has around 350k rows and the table definition is something like: CREATE TABLE myTable ( nome_t text NOT NULL, ) I have an index on nome_t as stated below: CREATE INDEX idx_m_nome_t ON myTable USING btree (nome_t); Although this is clearly a good candidate for Fulltext search I would like to rule that option out for now. This query is meant to be run from a web application and currently it's taking around 2 seconds which is obviously too much; Is there anything I can do, like using other index methods, to improve the speed of this query?

    Read the article

  • UnauthorizedAccessException when running desktop application from shared folder

    - by Atara
    I created a desktop application using VS 2008. When I run it locally, all works well. I shared my output folder (WITHOUT allowing network users to change my files) and ran my exe from another Vista computer on our intranet. When running the shared exe, I receive "System.UnauthorizedAccessException" when trying to read a file. How can I give permission to allow reading the file? Should I change the code? Should I grant permission to the application\folder on the Vista computer? how? Notes: I do not use ClickOnce. the application should be distributed using xcopy. My application target framework is ".Net Framework 2.0" On the Vista computer, "controlPanel | UninstallOrChangePrograms" it says it has "Microsoft .Net Framework 3.5 SP1" I also tried to map the folder drive, but got the same errors, only now the fileName is "T:\my.ocx" ' ---------------------------------------------------------------------- ' my code: Dim src As String = mcGlobals.cmcFiles.mcGetFileNameOcx() Dim ioStream As New System.IO.FileStream(src, IO.FileMode.Open) ' ---------------------------------------------------------------------- Public Shared Function mcGetFileNameOcx() As String ' ---------------------------------------------------------------------- Dim dirName As String = Application.StartupPath & "\" Dim sFiles() As String = System.IO.Directory.GetFiles(dirName, "*.ocx") Dim i As Integer For i = 0 To UBound(sFiles) Debug.WriteLine(System.IO.Path.GetFullPath(sFiles(i))) ' if found any - return the first: Return System.IO.Path.GetFullPath(sFiles(i)) Next Return "" End Function ' ---------------------------------------------------------------------- ' The Exception I receive: System.UnauthorizedAccessException: Access to the path '\\computerName\sharedFolderName\my.ocx' is denied. at System.IO._Error(Int32 errorCode, String maybeFullPath) at System.IO.FileStream.Init(...) at System.IO.FileStream..ctor(...) at System.IO.FileStream..ctor(String path, FileMode mode) ' ----------------------------------------------------------------------

    Read the article

< Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >