Search Results

Search found 41511 results on 1661 pages for 'via point'.

Page 246/1661 | < Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

  • SharePoint: Filtering a List that has Folders

    - by Gary McGill
    I have a SharePoint document library that has a folder structure used for organizing the documents (but also for controlling access, via permissions on the folders). The documents in the library are updated every month, and we store every month's version of the document in the same folder; there's a "month" column used for filtering that will contain values like Jan 09, Feb 09, etc. It looks like this: Title Month ----- ----- SubFolder 1 SubFolder 2 [] Interesting Facts Jan 09 [] Interesting Facts Feb 09 [] Interesting Facts Mar 09 [] Fascinating Numbers Jan 09 [] Fascinating Numbers Feb 09 ... Now, because users will generally be most interested in the 'current' month, I'd like them to be able to apply a filter, and select (say) Mar 09. However, if they do this using the built-in filtering, it also filters out the folders, and they can no longer navigate the folder hierarchy. This is no good - I want them to be able to move between folders with the filter intact, so that they don't need to keep switching it off and on again. I figured I might be able to use a custom view (selecting where type=folder or month=[month]), and to an extent that does work. However, I can only get it to work for a fixed month, whereas I need the user to be able to select the month - perhaps via a drop-down control on the page (and I don't want to create 60 views for 5 years' worth of months, nor do I want to have to create a new view every month). I thought it might be possible to create a view in code (rather than via the UI), but I've not been able to figure out how to get a dynamic value (a user-specific setting) into the CAML query. Any pointers gratefully appreciated! And by the way, I am aware of the dogma that folders are bad, and that everything should just be a list. However, having considered the alternatives, I still favour using folders - if I can solve this problem. Thanks in advance.

    Read the article

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

  • Servlet receiving data both in ISO-8859-1 and UTF-8. How to URL-decode?

    - by AJPerez
    I've a web application (well, in fact is just a servlet) which receives data from 3 different sources: Source A is a HTML document written in UTF-8, and sends the data via <form method="get">. Source B is written in ISO-8859-1, and sends the data via <form method="get">, too. Source C is written in ISO-8859-1, and sends the data via <a href="http://my-servlet-url?param=value&param2=value2&etc">. The servlet receives the request params and URL-decodes them using UTF-8. As you can expect, A works without problems, while B and C fail (you can't URL-decode in UTF-8 something that's encoded in ISO-8859-1...). I can make slight modifications to B and C, but I am not allowed to change them from ISO-8859-1 to UTF-8, which would solve all the problems. In B, I've been able to solve the problem by adding accept-charset="UTF-8" to the <form>. So the <form> sends the data in UTF-8 even with the page being ISO. What can I do to fix C? Alternatively, is there any way to determine the charset on the servlet, so I can call URL-decode with the right encoding in each case?

    Read the article

  • CSS overflow detection in JavaScript

    - by ring0
    In order to display a line of text (like in a forum), and end that line with "..." if the text would overflow the line (not truncating using the CSS overflow property), there are a number of ways. I'm still seeking the best solution. For instance, Adding in CSS a "..." as a background-image is a possibility, but it would appear all the time, and this is not a good solution. Some sites just count the characters and if over - say - 100, truncates the string to keep only 100 (or 97) chars and add a "..." at the end. But fonts are usually not proportional, so the result is not pretty. For instance the space - in pixels - taken by "AAA" and "iii" is clearly different "AAA" and "iii" via a proportional font have the same width There is another idea to get the exact size in pixels of the string: create in Javascript a DIV insert the text in it (via innerHTML for instance) measure the width (via .offsetWidth) which is not implemented yet. However, I wonder if there could be any browser compatibility problem? Did any one tried this solution? Other recommendations would be welcome.

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • dynamical binding or switch/case?

    - by kingkai
    A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

    Read the article

  • API-based solutions for sending payments to people without bank accounts

    - by Tauren
    I'm looking for inexpensive ways to send payments to hundreds or thousands of individual contractors, even if they do not have a bank account. Currently I only need to support payment in the USA, but may eventually be international. Here's the scenario: I offer a service that allows an organization or manager-type person to coordinate contractors for very short term jobs. These jobs are typically only an hour or two in length. A contractor may get only one job over an entire month, several jobs spread out over a month, multiple jobs on a single day, or any other combination. Thus, a single contractor could earn as little as one job's payment up to potentially payment for dozens. Payment for a month could be as little as $10 up to $1000's. Right now, the system provides payroll reports to the manager and it is the manager's responsibility to produce checks, stuff envelopes, and send mail via the US postal service. I'd like to remove this burden from the manager and have all the payments taken care of for them automatically by the system. I'm not sure where to start or what the best options would be. I'm starting to look into the following solutions, but don't know specifics yet and would like some advice before pursuing them. I'd also like to hear about other ideas or suggestions. PayPal (Send Money, Adaptive Payments, x.com, other???) Amazon (Flexible Payments System?) Fund some sort of pre-paid debit card? Web service with API that mails checks for you? Direct deposit via a bank API (for users with bank accounts)? The problem is that many of these contractors may not be able to obtain bank accounts or credit cards within the USA. I don't mind doing a hybrid of solutions, but are there any that would work well with this issue? I want the solution to be easy to use for the contractors, meaning that they can get the money easily (via check in the mail, debit card ATM withdrawal, etc.)

    Read the article

  • Two Applications using the same index file with Hibernate Search

    - by Dominik Obermaier
    Hi, I want to know if it is possible to use the same index file for an entity in two applications. Let me be more specific: We have an online Application with a frondend for the users and an application for the backend tasks (= administrator interface). Both are running on the same JBOSS AS. Both Applications are using the same database, so they are using the same entities. Of course the package names are not the same in both applications for the entities. So this is our usecase: A user should be able to search via the frondend. The user is only allowed to see results which are tagged with "visible". This tagging happens in our admin interface, so the index for the frontend should be updated every time an entity is tagged as "visible" in the backend. Of course both applications do have the same index root folder. In my index folder there are 2 index files: de.x.x.admin.model.Product de.x.x.frondend.model.Product How to "merge" this via Hibernate Search Configuration? I just did not get it via the documentation... Thanks for any help!

    Read the article

  • How do I enable mod_deflate for PHP files?

    - by DM.
    I have a Liquid Web VPS account, I've made sure that mod_deflate is installed and running/active. I used to gzip my css and js files via PHP, as well as my PHP files themselves... However, I'm now trying to do this via mod_deflate, and it seems to work fine for all files except for PHP files. (Txt files work fine, css, js, static HTML files, just nothing that is generated via a PHP file.) How do I fix this? (I used the "Compress all content" option under "Optimize Website" in cPanel, which creates an .htaccess file in the home directory (not public_html, one level higher than that) with exactly the same text as the "compress everything except images" example on http://httpd.apache.org/docs/2.0/mod/mod_deflate.html) .htaccess file: <IfModule mod_deflate.c> SetOutputFilter DEFLATE <IfModule mod_setenvif.c> # Netscape 4.x has some problems... BrowserMatch ^Mozilla/4 gzip-only-text/html # Netscape 4.06-4.08 have some more problems BrowserMatch ^Mozilla/4\.0[678] no-gzip # MSIE masquerades as Netscape, but it is fine # BrowserMatch \bMSIE !no-gzip !gzip-only-text/html # NOTE: Due to a bug in mod_setenvif up to Apache 2.0.48 # the above regex won't work. You can use the following # workaround to get the desired effect: BrowserMatch \bMSI[E] !no-gzip !gzip-only-text/html # Don't compress images SetEnvIfNoCase Request_URI .(?:gif|jpe?g|png)$ no-gzip dont-vary </IfModule> <IfModule mod_headers.c> # Make sure proxies don't deliver the wrong content Header append Vary User-Agent env=!dont-vary </IfModule> </IfModule>

    Read the article

  • Determine target architecture of binary file in Linux (library or executable)

    - by Fernando Miguélez
    We have an issue related to a Java application running under a (rather old) FC3 on a Advantech POS board with a Via C3 processor. The java application has several compiled shared libs that are accessed via JNI. Via C3 processor is suppossed to be i686 compatible. Some time ago after installing Ubuntu 6.10 on a MiniItx board with the same processor I found out that the previous statement is not 100% true. The Ubuntu kernel hanged on startup due to the lack of some specific and optional instructions of the i686 set in the C3 processor. These instructions missing in C3 implementation of i686 set are used by default by GCC compiler when using i686 optimizations. The solution in this case was to go with a i386 compiled version of Ubuntu distribution. The base problem with the Java application is that the FC3 distribution was installed on the HD by cloning from an image of the HD of another PC, this time an Intel P4. Afterwards the distribution needed some hacking to have it running such as replacing some packages (such as the kernel one) with the i383 compiled version. The problem is that after working for a while the system completely hangs without a trace. I am afraid that some i686 code is left somewhere in the system and could be executed randomly at any time (for example after recovering from suspend mode or something like that). My question is: Is there any tool or way to find out at what specific architecture is an binary file (executable or library) aimed provided that "file" does not give so much information?

    Read the article

  • Can not open ports in iptables on CentOS 5??

    - by abszero
    I am trying to open up ports in CentOS's firewall and am having a terrible go at it. I have followed the "HowTo" here: http://wiki.centos.org/HowTos/Network/IPTables as well as a few other places on the Net but I still can't get the bloody thing to work. Basically I wanted to get two things working: VNC and Apache over the internal network. The problem is that the firewall is blocking all attempts to connect to these services. Now if I issue service iptables stop and then try to access the server via VNC or hit the webserver everything works as expected. However the moment I turn iptables back on all of my access is blocked. Below is a truncated version of my iptables file as it appears in vi -A RH-Firewall-1-INPUT -p tcp -m state --state NEW -m tcp --dport 5801 -j ACCEPT -A RH-Firewall-1-INPUT -p tcp -m state --state NEW -m tcp --dport 5901 -j ACCEPT -A RH-Firewall-1-INPUT -p tcp -m state --state NEW -m tcp --dport 6001 -j ACCEPT -A RH-Firewall-1-INPUT -p tcp -m state --state NEW -m tcp --dport 5900 -j ACCEPT -A RH-Firewall-1-INPUT -p tcp -m state --state NEW -m tcp --dport 80 -j ACCEPT Really I would just be happy if I could get port 80 opened up for Apache since I can do most stuff via putty but if I could figure out VNC as well that would be cool. As far as VNC goes there is just a single/user desktop that I am trying to connect to via: [ipaddress]:1 Any help would be greatly appreciated!

    Read the article

  • how to add text in a created table in a richtextbox?

    - by francops henri
    I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

    Read the article

  • Is anyone familiar with SDPT.clsSDPT?

    - by David Stratton
    Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

    Read the article

  • MSSQL 2005 FOR XML

    - by Lima
    Hi, I am wanting to export data from a table to a specifically formated XML file. I am fairly new to XML files, so what I am after may be quite obvious but I just cant find what I am looking for on the net. The format of the XML results I need are: <data> <event start="May 28 2006 09:00:00 GMT" end="Jun 15 2006 09:00:00 GMT" isDuration="true" title="Writing Timeline documentation" image="http://simile.mit.edu/images/csail-logo.gif"> A few days to write some documentation </event> </data> My table structure is: name VARCHAR(50), description VARCHAR(255), startDate DATETIME, endDate DATETIME (I am not too interested in the XML fields image or isDuration at this point in time). I have tried: SELECT [name] ,[description] ,[startDate] ,[endTime] FROM [testing].[dbo].[time_timeline] FOR XML RAW('event'), ROOT('data'), type Which gives me: <data> <event name="Test1" description="Test 1 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> <event name="Test2" description="Test 2 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> </data> What I am missing, is the description needs to be outside of the event attributes, and there needs to be a tag. Is anyone able to point me in the correct direction, or point me to a tutorial or similar on how to accomplish this? Thanks, Matt

    Read the article

  • Dynamic width of DIV (offsetWidth issue).

    - by Tom
    Hi all, I face issue with retrieving (via javascript) width of the div which content is changed (just before reading the widht via offsetWidth) in dynamic way (via changing innerHTML or using createTextNode). Here is some sample code: var con = document.getElementById('avContent'); //content div within page var temp = document.createElement('div');<br /> var text1 = document.createTextNode('CCCCC');<br /> temp.appendChild(text1);<br /> con.appendChild(temp);<br /> var length1 = temp.offsetWidth;<br /> var text2 = document.createTextNode('CCCCC33333333vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv');<br /> temp.removeChild(text1);<br /> temp.appendChild(text2);<br /> con.removeChild(temp);<br /> con.appendChild(temp); var length2 = temp.offsetWidth;<br /> The length1 and length2 do have the same width.. (the same result I get while using innerHTML instead of createTextNode). Looks like it's the same issue like described in following discussion: http://www.webdeveloper.com/forum/showthread.php?t=187716 Does anybody have answer (work around)? Thanks much for help in advance.

    Read the article

  • IPad SQLite Push and Pull Data from external MS SQL Server DB

    - by MattyD
    This carries on from my previous post (http://stackoverflow.com/questions/4182664/ipad-app-pull-and-push-relational-data). My plan is that when the ipad application starts I am going to pull data (config data i.e. Departments, Types etc etc relational data that is used across the system) from a webhosted MS SQL Server DB via a webservice and populate it into an SQL Lite DB on the IPad. Then when I load a listing I will pull the data over the line again via a webservice and populate it into the SQL Lite db on the ipad (than just run select commands to populate the listing). My questions are: 1. What is the most efficient way to transfer data across the line via the web? Everyone seems to do it a different way. My idea is that I will have a webService for each type of data pull (e.g. RetrieveContactListing) that will query the db and than convert that data into "something" to send across the line. My question really is what is the "something" that it should be converting into? 2. Everyone talks about odata services. Is this suited for applications where complex read and writes are needed? Ive created a simple iphone app before that talked to an sql server db (i just sent my own structured xml across the line) but now with this app the data calls are going to be a lot larger so efficiency is key.

    Read the article

  • Multiple marker icons, how to add to google mashup

    - by user351189
    I have created a Google maps mashup, where with a bit of input, I have managed to have a sidebar that links to a video icon/marker that then opens up an info window showing virtual tours. I would, however, like to put different coloured marker icons on the map depending on the category that the video is in. This would be easy enough to do, but my page is made up of a mixture of J-Query and JavaScript all calling to the individual flash files. Could someone help me with the code for adding extra marker icons for different categories? Here is the code: So, after the intial 'var camera;' point, there comes this: function addMarker(point, title, video, details) { var marker = new GMarker(point, {title: title, icon:camera}); GEvent.addListener(marker, "click", function() { if (details) { marker.openInfoWindowTabsHtml([new GInfoWindowTab("Video", video), new GInfoWindowTab("More", details)]); } else { marker.openInfoWindowHtml(video); } }); Then further down, is the code for calling the individual marker image. I would like to add another image to this list - would I start out by calling the new object 'camera-red.image' or something similar? function initialize() { if (GBrowserIsCompatible()) { map = new GMap2(document.getElementById("mapDiv")); map.setCenter(new GLatLng(51.52484592590448, -0.13345599174499512), 17); map.setUIToDefault(); var uclvtSatMapType = createUclVTSatMapType() map.addMapType(uclvtSatMapType); map.setMapType(uclvtSatMapType); camera = new GIcon(G_DEFAULT_ICON); camera.image = "ucl-video.png"; camera.iconSize = new GSize(32,37); camera.iconAnchor = new GPoint(16,35); camera.infoWindowAnchor = new GPoint(16,2); addMarkersToMap(); } The actual map can be found here: link text Thanks.

    Read the article

  • Ubuntu + virtualenv = a mess? virtualenv hates dist-packages, wants site-packages

    - by lostincode
    Can someone please explain to me what is going on with python in ubuntu 9.04? I'm trying to spin up virtualenv, and the --no-site-packages flag seems to do nothing with ubuntu. I installed virtualenv 1.3.3 with easy_install (which I've upgraded to setuptools 0.6c9) and everything seems to be installed to /usr/local/lib/python2.6/dist-packages I assume that when installing a package using apt-get, it's placed in /usr/lib/python2.6/dist-packages/ ? The issue is, there is a /usr/local/lib/python2.6/site-packages as well that just sits there being empty. It would seem (by looking at the path in a virtualenv) that this is the folder virtualenv uses as backup. Thus even thought I omit --no-site-packages, I cant access my local systems packages from any of my virtualenv's. So my questions are: How do I get virtualenv to point to one of the dist-packages? Which dist-packages should I point it to? /usr/lib/python2.6/dist-packages or /usr/local/lib/python2.6/dist-packages/ What is the point of /usr/lib/python2.6/site-packages? There's nothing in there! Is it first come first serve on the path? If I have a newer version of package XYZ installed in /usr/local/lib/python2.6/dist-packages/ and and older one (from ubuntu repos/apt-get) in /usr/lib/python2.6/dist-packages, which one gets imported when I import xyz? I'm assuming this is based on the path list, yes? Why the hell is this so confusing? Is there something I'm missing here? Where is it defined that easy_install should install to /usr/local/lib/python2.6/dist-packages? Will this affect pip as well? Thanks to anyone who can clear this up!

    Read the article

  • Turn image in google maps V3?

    - by Ilrodri
    Hi, I need help with JavaScript in google map v3 I have an image and I need to be able to turn it. That works, but the real problem it's that I cant afect an marker cause I don't know how to call it and modify this marker. I show you a part of the code: Marker: sURL = 'http://www.sl2o.com/tc/picture/Fleche.PNG'; iWidth = 97; iHeight = 100; mImage = new google.maps.MarkerImage(sURL, new google.maps.Size(iWidth,iHeight), new google.maps.Point(0,0), new google.maps.Point(Math.round(iWidth/2),Math.round(iHeight/2))); var oMarker = new google.maps.Marker({ 'position': new google.maps.LatLng(iStartLat,iStartLon), 'map': map, 'title': 'mon point', 'icon': mImage }); Then I have this : onload=function(){ rotate.call(document.getElementById('im'),50); } </script> <img id="im" src="http://www.sl2o.com/tc/picture/Fleche.PNG" width="97" height="100" /> So here is it. As you can see, I'm afecting this image and I in fact I need to afect the marker. How can I do it ? Please I need this I'been working in it since hours and hours. Thank you !!

    Read the article

  • Help dealing with data dependency between two registration forms

    - by franko75
    I have a tricky issue here with a registration of both a user and his/her pet. Both the user and the pet are treated as separate entities and both require separate registration forms. However, the user's pet has to be linked to the user via a foreign key in the database. The process is basically that when a new user joins the site, firstly they register their pet, then they register themselves. The reason for this order is to check their pet's eligibility for the site (there are some criteria to be met) first, instead of getting the user to sign up only to then find out their pet is ineligible. It is this ordering of the form submissions which is causing me a bit of a headache, as follows... The site is being developed with an MVC framework, and the User registration process is managed via a method in a User_form controller, while the pet registration process is managed via a method in the Pet_form controller. The pet registration form happens first, and the pet data can be saved without the owner_id at this stage, with the user id possibly being added (e.g by retrieving pet's id from session) following user registration. However, doing it this way could potentially result in redundant data, where pet records would be created in the database, but if the user doesn't actually register themselves too, then the pets will be ownerless records in the DB. Other option is to serialize the new pet's data at the pet registration stage, don't save it to the DB until the user fills out their registration form. Once the user is created, i can pass serialised data AND the owner_id to a method in the Pet Model which can update the DB. However, I also need to set the newly created $pet to $this-pet which I then access for a sequence of other related forms. Should I just set the session variable in the model method? Then in the Pet controller constructor, do a check for pet stored in session, if yes, assign to $this-pet... If this makes any sense to anybody and you have some advice, i'd be grateful to hear it!

    Read the article

  • RPC command to initiate a software install

    - by ericmayo
    I was recently working with a product from Symantech called Norton EndPoint protection. It consists of a server console application and a deployment application and I would like to incorporate their deployment method into a future version of one of my products. The deployment application allows you to select computer workstations running Win2K, WinXP, or Win7. The selection of workstations is provided from either AD (Active Directory) or NT Domain (WINs/DNS NetBIOS lookup). From the list, one can click and choose which workstations to deploy the end point software which is Symantech's virus & spyware protection suite. Then, after selecting which workstations should receive the package, the software copies the setup.exe program to each workstation (presumable over the administrative share \pcname\c$) and then commands the workstation to execute setup.exe resulting in the workstation installing the software. I really like how their product works but not sure what they are doing to accomplish all the steps. I've not done any deep investigations into this such as sniffing the network, etc... and wanted to check here to see if anyone is familiar with what I'm talking about and if you know how it's accomplished or have ideas how it could be accomplished. My thinking is that they are using the admin share to copy the software to the selected workstations and then issuing an RPC call to command the workstation to do the install. What's interesting is that the workstations do this without any of the logged in users knowing what's going on until the very end where a reboot is necessary. At which point, the user gets a pop-up asking to reboot now or later, etc... My hunch is that the setup.exe program is popping this message. To the point: I'm looking to find out the mechanism by which one Windows based machine can tell another to do some action or run some program. My programming language is C/C++ Any thoughts/suggestions appreciated.

    Read the article

  • How To Call Javascript In Ajax Response? IE: Close a form div upon success...

    - by B.Gordon
    I have a form that when you submit it, it sends the data for validation to another php script via ajax. Validation errors are echo'd back in a div in my form. A success message also is returned if validation passes. The problem is that the form is still displayed after submit and successful validation. I want to hid the div after success. So, I wrote this simple CSS method which works fine when called from the page the form is displayed on. The problem is that I cannot seem to call the hide script via returned code. I can return html like echo "<p>Thanks, your form passed validation and is being sent</p>"; So I assumed I could simply echo another line after that echo "window.onload=displayDiv()"; inside script tags (which I cannot get to display here)... and that it would hide the form div. It does not work. I am assuming that the problem is that the javascript is being returned incorrectly and not being interpreted by the browser... How can I invoke my 'hide' script on the page via returned data from my validation script? I can echo back text but the script call is ineffective. Thanks! This is the script on the page with the form... I can call it to show/hide with something like onclick="displayDiv()" while on the form but I don't want the user to invoke this... it has be called as the result of a successful validation when I write the results back to the div... function displayDiv() { var divstyle = new String(); divstyle = document.getElementById("myForm").style.display; if(divstyle.toLowerCase()=="block" || divstyle == "") { document.getElementById("myForm").style.display = "none"; } else { document.getElementById("myForm").style.display = "block"; } } PS: I am using the mootools.js library for the form validation if this matters for the syntax..

    Read the article

  • Optimize a views drawing code

    - by xon1c
    Hi, in a simple drawing application I have a model which has a NSMutableArray curvedPaths holding all the lines the user has drawn. A line itself is also a NSMutableArray, containing the point objects. As I draw curved NSBezier paths, my point array has the following structure: linePoint, controlPoint, controlPoint, linePoint, controlPoint, controlPoint, etc... I thought having one array holding all the points plus control points would be more efficient than dealing with 2 or 3 different arrays. Obviously my view draws the paths it gets from the model, which leads to the actual question: Is there a way to optimize the following code (inside the view's drawRect method) in terms of speed? int lineCount = [[model curvedPaths] count]; // Go through paths for (int i=0; i < lineCount; i++) { // Get the Color NSColor *theColor = [model getColorOfPath:[[model curvedPaths] objectAtIndex:i]]; // Get the points NSArray *thePoints = [model getPointsOfPath:[[model curvedPaths] objectAtIndex:i]]; // Create a new path for performance reasons NSBezierPath *path = [[NSBezierPath alloc] init]; // Set the color [theColor set]; // Move to first point without drawing [path moveToPoint:[[thePoints objectAtIndex:0] myNSPoint]]; int pointCount = [thePoints count] - 3; // Go through points for (int j=0; j < pointCount; j+=3) { [path curveToPoint:[[thePoints objectAtIndex:j+3] myNSPoint] controlPoint1:[[thePoints objectAtIndex:j+1] myNSPoint] controlPoint2:[[thePoints objectAtIndex:j+2] myNSPoint]]; } // Draw the path [path stroke]; // Bye stuff [path release]; [theColor release]; } Thanks, xonic

    Read the article

  • Silverlight horizontal stretch and get position issue

    - by David
    I have a Grid (container) wich in turn has several grids(subContainers) arranged by rows. Each one of those "subContainers" has diferent columns and controls. And each of those "subContainers" has the horizontal alignment set to stretch, and it has to stay that way, since the layout this viewer depends on it. I use the "container" to set each control on it's adequate position. So far so good. Now comes my headache... I want to remove the control from the grid and put it in a canvas, at the same exact position, only, the position it returns is as if the control is set to the beggining of the grid and not it's true position. For testing purposes, I've set the "subContainters" horizontal alignment to center and (despite the layout is totally wrong) every control is in it's right position when sent to a canvas, wich it doesn't happen when HA = stretch. Here's the code I'm using to get position: GeneralTransform gt = nc.TransformToVisual(gridZoom); Point offset = gt.Transform(new Point()); So you can understand, for example, my first control should be somewhere like (80, 1090), but the point that I get is (3,3). Can anyone help me? Thanks

    Read the article

< Previous Page | 242 243 244 245 246 247 248 249 250 251 252 253  | Next Page >