Search Results

Search found 72722 results on 2909 pages for 'file processing'.

Page 247/2909 | < Previous Page | 243 244 245 246 247 248 249 250 251 252 253 254  | Next Page >

  • Write to file depending on minSdkVersion - android

    - by Simon Rosenqvist
    Hi, I have written a filewriter for my android application. It is to function on a Galaxy Tab, so my minSdkVersion has to be at least 4, so it will fill the screen. I originally started out with SdkVersion = 2 and at that point my filewriter worked perfectly. Changing the SdkVersion to 4 introduced the problem. My filewriter doesn't work anymore! The application runs fine, but a file doesn't get created. My .java file looks like this: public class HelloAndroid extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); TextView tv = new TextView(this); tv.setText("Hello, Android"); setContentView(R.layout.main); //definerer en knap kaldet button1 og sætter en listener på denne. Button button1 = (Button)findViewById(R.id.btnClickMe); button1.setOnClickListener(btnListener); //definerer en knap kaldet button2 og sætter en listener på denne. Button button2 = (Button)findViewById(R.id.btnClickMe2); button2.setOnClickListener(btnListener2); } //en variabel af typen 'long' deklæres og kaldes tid1. public long time1; private OnClickListener btnListener = new OnClickListener() { public void onClick(View v) { //Når der klikkes på button1 gemmes et tal i variablen tid1. time1 = System.currentTimeMillis(); } }; //en variabel af typen 'long' deklæres og kaldes tid2. public long time2; // en variabel af typen 'string' deklæres og kaldes tid: public String string1 = "time:"; private OnClickListener btnListener2 = new OnClickListener() { public void onClick(View v) { //Når der klikkes på button2 gemmes et tal i variablen tid2. time2 = System.currentTimeMillis(); // Herefter oprettes en fil kaldet "file.txt". try{ File file = new File(Environment.getExternalStorageDirectory(), "file.txt"); file.createNewFile(); BufferedWriter writer = new BufferedWriter(new FileWriter(file,true)); //string1 og tid2-tid1 skrives til filen. tid2-tid1 giver den tid der går fra der er trykket på den ene knap til den anden i millisekunder. writer.write(string1 + "\t" + (time2-time1)); writer.newLine(); writer.flush(); writer.close(); } catch (IOException e) { e.printStackTrace(); } } }; } And my manifest.xml looks like this: <?xml version="1.0" encoding="utf-8"?> <application android:icon="@drawable/icon" android:label="@string/app_name"> <activity android:name=".HelloAndroid" android:label="@string/app_name"> <intent-filter> <action android:name="android.intent.action.MAIN" /> <category android:name="android.intent.category.LAUNCHER" /> </intent-filter> </activity> </application> Why does my filewriter not work with minSdkVersion 2? Do i have to make a new filewriter? or what to do? Sorry for the messy code, i'm quite new to programming :)

    Read the article

  • How to parse the XML file in RapidXML.

    - by user337891
    I have to parse a xml file in C++. I was researching and found rapidxml library for this. I have doubt about "doc.parse<0(xml)" can xml be .xml file or it needs to be a string or char *? If can take only string or char * then I guess I need to read the whole file and store it in a char array and pass the pointer of it to the function? Is there a way to directly use file because I would need to change the xml file inside the code also. If it is not possible in RapidXML then please suggest some other xml libraries in C++. Thanks!!! Ashd

    Read the article

  • SSAS processing error: Client unable to establish connection; 08001; Encryption not supported on the client.; 08001

    - by Kevin Shyr
    After getting the cube to successfully deploy and process on Friday, I was baffled on Monday that the newly added dimension caused the cube processing to break.  I then followed the first instinct, discarded all my changes to reverted back to the version on Friday, and had no luck.  The error message (attached below) did not help as I was looking for some kind of SQL service error.  After examining the windows server log and the SQL server log, I just couldn't see anything wrong with it.After swearing for some time, and with the help of going off and working on something else for a while.  I came back to the solution and looked at the data source.  Even though I know I have never changed the provider (the default setup gave me SQL native client), I decided to change it and give OLE DB a try.This simple change allows my cube to process successfully again.  While I don't understand why the same settings that worked last week doesn't work this week, I don't have all the information to say with certainty that nothing has changed in the environment (firewall changes, server updates, etc.).SSAS processing error:<Batch >  <Parallel>    <Process xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:ddl2="http://schemas.microsoft.com/analysisservices/2003/engine/2" xmlns:ddl2_2="http://schemas.microsoft.com/analysisservices/2003/engine/2/2" xmlns:ddl100_100="http://schemas.microsoft.com/analysisservices/2008/engine/100/100" xmlns:ddl200="http://schemas.microsoft.com/analysisservices/2010/engine/200" xmlns:ddl200_200="http://schemas.microsoft.com/analysisservices/2010/engine/200/200">      <Object>        <DatabaseID>DWH Sales Facts</DatabaseID>        <CubeID>DWH Sales Facts</CubeID>      </Object>      <Type>ProcessFull</Type>      <WriteBackTableCreation>UseExisting</WriteBackTableCreation>    </Process>  </Parallel></Batch>                Processing Dimension 'Date' completed.                                Errors and Warnings from Response                OLE DB error: OLE DB or ODBC error: A network-related or instance-specific error has occurred while establishing a connection to SQL Server. Server is not found or not accessible. Check if instance name is correct and if SQL Server is configured to allow remote connections. For more information see SQL Server Books Online.; 08001; Client unable to establish connection; 08001; Encryption not supported on the client.; 08001.                Errors in the high-level relational engine. A connection could not be made to the data source with the DataSourceID of 'DWH Sales Facts', Name of 'DWH Sales Facts'.                Errors in the OLAP storage engine: An error occurred while the dimension, with the ID of 'Currency', Name of 'Currency' was being processed.                Errors in the OLAP storage engine: An error occurred while the 'Currency Dim ID' attribute of the 'Currency' dimension from the 'DWH Sales Facts' database was being processed.                Internal error: The operation terminated unsuccessfully.                Server: The operation has been cancelled.

    Read the article

  • Java POI 3.6 XWPF usage guidelines (reading content of docx file)

    - by Mr CooL
    I assume the following objects should be used to read contents of DOCX file: XWPFDocument XWPFWordExtractor However, somewhere the compiler warns me from not including the correct libraries needed in classpath. I think I'm kinda lost for not knowing which jar file is the right one to include for this since there are so many jar files (POI libraries). My project so far involve in reading doc and docx files as part of the project. I've managed to read the contents of doc file. However, for docx file, I'm still having problem with that. Can anyone show the guidelines in terms of the codes and libraries needed (jar files) to read the content of docx file? I'm trying to limit the libraries need to be added on into project since I need to read doc and docx only. The following works for doc: fs = new POIFSFileSystem(new FileInputStream(fileName)); HWPFDocument doc = new HWPFDocument(fs); WordExtractor we = new WordExtractor(doc); String[] p = we.getParagraphText();

    Read the article

  • Cannot install mysql-server (5.5.22) on clean ubuntu 12.04 LTS server

    - by Christian
    I have a clean minimal install of Ubuntu 12.04 LTS server 64-bit (just a root user and nothing alse installed). I tried to install the mysql-server with the following command: apt-get install mysql-server The installation aborts with the following error: The following NEW packages will be installed: libdbd-mysql-perl{a} libmysqlclient18{a} mysql-client mysql-client-5.5{a} mysql-client-core-5.5{a} mysql-common{a} mysql-server mysql-server-5.5{a} mysql-server-core-5.5{a} 0 packages upgraded, 9 newly installed, 0 to remove and 0 not upgraded. Need to get 11.7 kB/26.2 MB of archives. After unpacking 94.5 MB will be used. Do you want to continue? [Y/n/?] y Get: 1 http://mirror.eu.oneandone.net/ubuntu/ubuntu/ precise/main mysql-client all 5.5.22-0ubuntu1 [11.7 kB] Fetched 11.7 kB in 0s (567 kB/s) Preconfiguring packages ... Selecting previously unselected package mysql-common. (Reading database ... 54008 files and directories currently installed.) Unpacking mysql-common (from .../mysql-common_5.5.22-0ubuntu1_all.deb) ... Selecting previously unselected package libmysqlclient18. Unpacking libmysqlclient18 (from .../libmysqlclient18_5.5.22-0ubuntu1_amd64.deb) ... Selecting previously unselected package libdbd-mysql-perl. Unpacking libdbd-mysql-perl (from .../libdbd-mysql-perl_4.020-1build2_amd64.deb) ... Selecting previously unselected package mysql-client-core-5.5. Unpacking mysql-client-core-5.5 (from .../mysql-client-core-5.5_5.5.22-0ubuntu1_amd64.deb) ... Selecting previously unselected package mysql-client-5.5. Unpacking mysql-client-5.5 (from .../mysql-client-5.5_5.5.22-0ubuntu1_amd64.deb) ... Selecting previously unselected package mysql-server-core-5.5. Unpacking mysql-server-core-5.5 (from .../mysql-server-core-5.5_5.5.22-0ubuntu1_amd64.deb) ... Processing triggers for man-db ... Setting up mysql-common (5.5.22-0ubuntu1) ... Selecting previously unselected package mysql-server-5.5. (Reading database ... 54189 files and directories currently installed.) Unpacking mysql-server-5.5 (from .../mysql-server-5.5_5.5.22-0ubuntu1_amd64.deb) ... Selecting previously unselected package mysql-client. Unpacking mysql-client (from .../mysql-client_5.5.22-0ubuntu1_all.deb) ... Selecting previously unselected package mysql-server. Unpacking mysql-server (from .../mysql-server_5.5.22-0ubuntu1_all.deb) ... Processing triggers for ureadahead ... Processing triggers for man-db ... Setting up libmysqlclient18 (5.5.22-0ubuntu1) ... Setting up libdbd-mysql-perl (4.020-1build2) ... Setting up mysql-client-core-5.5 (5.5.22-0ubuntu1) ... Setting up mysql-client-5.5 (5.5.22-0ubuntu1) ... Setting up mysql-server-core-5.5 (5.5.22-0ubuntu1) ... Setting up mysql-server-5.5 (5.5.22-0ubuntu1) ... 120502 10:17:41 [Note] Plugin 'FEDERATED' is disabled. 120502 10:17:41 InnoDB: The InnoDB memory heap is disabled 120502 10:17:41 InnoDB: Mutexes and rw_locks use GCC atomic builtins 120502 10:17:41 InnoDB: Compressed tables use zlib 1.2.3.4 120502 10:17:41 InnoDB: Initializing buffer pool, size = 128.0M 120502 10:17:41 InnoDB: Completed initialization of buffer pool 120502 10:17:41 InnoDB: highest supported file format is Barracuda. 120502 10:17:41 InnoDB: Waiting for the background threads to start 120502 10:17:42 InnoDB: 1.1.8 started; log sequence number 1595675 120502 10:17:42 InnoDB: Starting shutdown... 120502 10:17:42 InnoDB: Shutdown completed; log sequence number 1595675 start: Job failed to start invoke-rc.d: initscript mysql, action "start" failed. dpkg: error processing mysql-server-5.5 (--configure): subprocess installed post-installation script returned error exit status 1 No apport report written because MaxReports is reached already Setting up mysql-client (5.5.22-0ubuntu1) ... dpkg: dependency problems prevent configuration of mysql-server: mysql-server depends on mysql-server-5.5; however: Package mysql-server-5.5 is not configured yet. dpkg: error processing mysql-server (--configure): dependency problems - leaving unconfigured No apport report written because MaxReports is reached already Processing triggers for libc-bin ... ldconfig deferred processing now taking place Errors were encountered while processing: mysql-server-5.5 mysql-server E: Sub-process /usr/bin/dpkg returned an error code (1) A package failed to install. Trying to recover: Setting up mysql-server-5.5 (5.5.22-0ubuntu1) ... start: Job failed to start invoke-rc.d: initscript mysql, action "start" failed. dpkg: error processing mysql-server-5.5 (--configure): subprocess installed post-installation script returned error exit status 1 dpkg: dependency problems prevent configuration of mysql-server: mysql-server depends on mysql-server-5.5; however: Package mysql-server-5.5 is not configured yet. dpkg: error processing mysql-server (--configure): dependency problems - leaving unconfigured Errors were encountered while processing: mysql-server-5.5 mysql-server I am completely lost because I have tried everything on the web to solve my problem (clearning the install, reconfiguring with dpkg, manually editing the my.cnf). I also set up a new clean install but nothing helped. What am I doing wrong? New information: The file /var/log/upstart/mysql.log contains the following error after the installation: AppArmor parser error for /etc/apparmor.d/usr.sbin.mysqld in /etc/apparmor.d/tunables/global at line 17: Could not open 'tunables/proc'

    Read the article

  • Uploading a zip file to a jsp and extract the content in another jsp

    - by sunnyj
    I want to upload a zip file in a jsp page and the user is sent to another jsp page after he selects and uploads the file. In this second page I want to 1.)extract the uploaded zip file. 2.)read some content from the extracted file(s) and allow the user to change/edit them 3.)save the user changes in the files. 4.)zip the files again and save it in another destination. Please suggest me a rough outline of a solution as I am stuck in the phase in which I get the uploaded file and re-direct the user to the second jsp.

    Read the article

  • MSBuild task to execute an external MSBuild file

    - by Slace
    I'm trying to set up a MSBuild file which will invoke another MSBuild file and I'm wondering what's the best way to achieve this. We're using it in the scenario of where a build server downloads a MSBuild file which then depending on the parameters it'll execute the appropriate 2nd file. I know I can just use the <Exec Command="msbuild.exe ..." /> task, but that seems to be a bit of a hacky way to do it. Is there an easier way to use MSBuild to execute another MSBuild file?

    Read the article

  • Convert byte array to wav file in C#

    - by Eyla
    Greetings, I'm trying to play a wav sound that stored in byte array called bytes. I know that I should convert the byte array to wav file and save it in my local drive then called the saved file but I was not able to convert the byte array to wav file. please help me to give sample code to convert byte arrary of wav sound to wav file. here is my code: protected void Button1_Click(object sender, EventArgs e) { byte[] bytes = GetbyteArray(); //missing code to convert the byte array to wav file ..................... System.Media.SoundPlayer myPlayer = new System.Media.SoundPlayer(myfile); myPlayer.Stream = new MemoryStream(); myPlayer.Play(); }

    Read the article

  • apt-get install was interrupted

    - by user3475299
    I am new to Ubuntu. I got the following lines after an interrupted apt-get install. Running depmod. update-initramfs: deferring update (hook will be called later) Examining /etc/kernel/postinst.d. run-parts: executing /etc/kernel/postinst.d/apt-auto-removal 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic run-parts: executing /etc/kernel/postinst.d/initramfs-tools 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic update-initramfs: Generating /boot/initrd.img-3.13.0-29-generic run-parts: executing /etc/kernel/postinst.d/pm-utils 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic run-parts: executing /etc/kernel/postinst.d/update-notifier 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic run-parts: executing /etc/kernel/postinst.d/zz-update-grub 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic /usr/sbin/grub-mkconfig: 14: /etc/default/grub: nouveau.modeset=0: not found run-parts: /etc/kernel/postinst.d/zz-update-grub exited with return code 127 Failed to process /etc/kernel/postinst.d at /var/lib/dpkg/info/linux-image-3.13.0-29-generic.postinst line 1025. No apport report written because the error message indicates its a followup error from a previous failure. No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already dpkg: error processing package linux-image-3.13.0-29-generic (--configure): subprocess installed post-installation script returned error exit status 2 dpkg: dependency problems prevent configuration of linux-image-extra-3.13.0-29-generic: linux-image-extra-3.13.0-29-generic depends on linux-image-3.13.0-29-generic; however: Package linux-image-3.13.0-29-generic is not configured yet. dpkg: error processing package linux-image-extra-3.13.0-29-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-image-generic: linux-image-generic depends on linux-image-3.13.0-29-generic; however: Package linux-image-3.13.0-29-generic is not configured yet. linux-image-generic depends on linux-image-extra-3.13.0-29-generic; however: Package linux-image-extra-3.13.0-29-generic is not configured yet. dpkg: error processing package linux-image-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-generic: linux-generic depends on linux-image-generic (= 3.13.0.29.35); however: Package linux-image-generic is not configured yet. dpkg: error processing package linux-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-image-extra-3.13.0-27-generic: linux-image-extra-3.13.0-27-generic depends on linux-image-3.13.0-27-generic; however: Package linux-image-3.13.0-27-generic is not configured yet. dpkg: error processing package linux-image-extra-3.13.0-27-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-signed-image-3.13.0-29-generic: linux-signed-image-3.13.0-29-generic depends on linux-image-3.13.0-29-generic (= 3.13.0-29.53); however: Package linux-image-3.13.0-29-generic is not configured yet. linux-signed-image-3.13.0-29-generic depends on linux-image-extra-3.13.0-29-generic (= 3.13.0-29.53); however: Package linux-image-extra-3.13.0-29-generic is not configured yet. dpkg: error processing package linux-signed-image-3.13.0-29-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-signed-image-generic: linux-signed-image-generic depends on linux-signed-image-3.13.0-29-generic; however: Package linux-signed-image-3.13.0-29-generic is not configured yet. dpkg: error processing package linux-signed-image-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-signed-generic: linux-signed-generic depends on linux-signed-image-generic (= 3.13.0.29.35); however: Package linux-signed-image-generic is not configured yet. dpkg: error processing package linux-signed-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-signed-image-3.13.0-27-generic: linux-signed-image-3.13.0-27-generic depends on linux-image-3.13.0-27-generic (= 3.13.0-27.50); however: Package linux-image-3.13.0-27-generic is not configured yet. linux-signed-image-3.13.0-27-generic depends on linux-image-extra-3.13.0-27-generic (= 3.13.0-27.50); however: Package linux-image-extra-3.13.0-27-generic is not configured yet. dpkg: error processing package linux-signed-image-3.13.0-27-generic (--configure): dependency problems - leaving unconfigured Setting up libxkbcommon-x11-0:amd64 (0.4.1-0ubuntu1) ... Setting up libqt5gui5:amd64 (5.2.1+dfsg-1ubuntu14.2) ... Processing triggers for libc-bin (2.19-0ubuntu6) ... Errors were encountered while processing: linux-image-3.13.0-27-generic linux-image-3.13.0-29-generic linux-image-extra-3.13.0-29-generic linux-image-generic linux-generic linux-image-extra-3.13.0-27-generic linux-signed-image-3.13.0-29-generic linux-signed-image-generic linux-signed-generic linux-signed-image-3.13.0-27-generic E: Sub-process /usr/bin/dpkg returned an error code (1)

    Read the article

  • QFileDialog filter from mime-types

    - by Mathias
    I want the filter in a QFileDialog to match all audio file types supported by Phonon on the platform in question. 1 - However I am not able to find a way in Qt to use mime types in a filter. How can I do that? 2 - Or how can I find the corresponding file extensions for the mimetypes manually? The solution should be Qt based, or at least be cross platform and supported everywhere Qt is. Following is a short code describing my problem: #include <QApplication> #include <QFileDialog> #include <QStringList> #include <phonon/backendcapabilities.h> QString mime_to_ext(QString mime) { // WHAT TO REALLY DO ?? // NEEDLESS TO SAY; THIS IS WRONG... return mime.split("/").back().split('-').back(); } int main(int argc, char **argv) { QApplication app(argc, argv); QStringList p_audio_exts; QStringList p_mime_types = Phonon::BackendCapabilities::availableMimeTypes(); for(QStringList::iterator i = p_mime_types.begin(), ie = p_mime_types.end(); i != ie; i++) { if((*i).startsWith("audio")) p_audio_exts << mime_to_ext(*i); } QString filter = QString("All Files(*)"); if(!p_audio_exts.isEmpty()) { QString p_audio_filter = QString("Audio Files (*.%1)").arg(p_audio_exts.join(" *.")); filter = QString("%1;;%2").arg(p_audio_filter).arg(filter); } QFileDialog dialog(NULL, "Open Audio File", QString::null, filter); dialog.exec(); }

    Read the article

  • HTTPHeaders Added to Downloaded File - CocoaHTTPServer???

    - by Don
    In an iPhone app where I use cocoahttpserver and take a sqlite database file from the iPhone and download it with a browser to my PC, when I look at the downloaded file using TextEdit, I see the text (below) at the end of the file. This text has apparently no effect on use of the database file, but I would prefer to not add stuff to the database file at all. Any ideas where this header info is coming from in cocoahttpserver and how to stop it? Thanks. ------WebKitFormBoundary3RAcT2SVGhGPnoA6 Content-Disposition: form-data; name="submit.x" 26 ------WebKitFormBoundary3RAcT2SVGhGPnoA6 Content-Disposition: form-data; name="submit.y" 12 ------WebKitFormBoundary001Quvx6Efgaf23y Content-Disposition: form-data; name="submit.x" 30 ------WebKitFormBoundary001Quvx6Efgaf23y Content-Disposition: form-data; name="submit.y" 12 ------WebKitFormBoundaryfHyUUs1p31kBJ3gA Content-Disposition: form-data; name="submit.x" 52 ------WebKitFormBoundaryfHyUUs1p31kBJ3gA Content-Disposition: form-data; name="submit.y" 9

    Read the article

  • Extending Perforce to use a custom content diff tool for certain file extensions

    - by Fraser Graham
    I have various custom binary files stored in perforce and for many of the file types I have built a custom diff tool to show the content creators a diff of the actual changes to the file. E.g. If the file holds simple key value pairs as a compressed binary blob the diff tool would load each version into an in memory format and generate a list of additions, deletions and edits to the file presented in a nice clean report view. Much like the built in image diff tool in P4V i'd like to be able to use my own diff tool for certain file extensions within my depot and allow the users to use the existing P4V interface to pick revisions to diff between and examine history. So, I am aware you can write add-ins to P4V but I can't find any documentation on it and I'd like to know if this kind of extension functionality is available in P4V and how to use it?

    Read the article

  • WPF: Changing config file user settings at runtime?

    - by Poku
    Hey I'm trying to change some config file user settings values in my WPF application, but its only working partly. The value is changed correctly and the program runs fine with the value. I can even restart the program and the value is still the one i changed it to. The problem is that when i open the .exe.config file the value is still the old value. Im using this code to change the value: Properties.Settings.Default.ProjectNumber = varTestExample; Properties.Settings.Default.Save(); Where does this save code save the changes and how/where does the program read the value after i have run this code? If i run a clean version of the program the ProjectNumber value is correctly taken from the .exe.config file and if i change the value in the config file it is also change when i run the program. But as soon as i run the above code the program is not reading the value from the config file. Why?

    Read the article

  • utf8 codification problem C#, writing a tex file, and compiling with pdflatex

    - by voodoomsr
    Hi, i have the next code written in C#....it create a tex file using utf-8.....the problem is that appears that is not a real valid utf-8 file because, when i use pdflatex it doesn't recognize the characters with accents. Somebody knows a way to write a real UTF-8 file? When i use TexmakerX to create a utf8 file with the same latex code, pdflatex doesn't complaints, so the problem must be in the generation. FileInfo file = new FileInfo("hello.tex"); StreamWriter writer = new StreamWriter("hello.tex", false, Encoding.UTF8); writer.Write(@"\documentclass{article}" + "\n" + @"\usepackage[utf8]{inputenc}" + "\n" + @"\usepackage[spanish]{babel}" + "\n" + @"\usepackage{listings}" + "\n" + @"\usepackage{fancyvrb}" + "\n" + @"\begin{document}" + "\n" + @"\title{asd}" + "\n" + @"\maketitle" + "\n" + @"\section{canción}" + "\n" + @"canción" + "\n" + @"\end{document}"); writer.Close();

    Read the article

  • Batch file conversion to vbscript

    - by blademasterson
    I need to convert a batch file to vbscript but am unfamiliar with both. If I can understand what is going on in the batch file I can work out the vbscript easy enough. Problem is the batch file runs a few cscript commands which is supposed to have a syntax of cscript [script name] [host options] [script arguments] However whomever wrote the batch file doesn't use it in a standard manner so if someone could explain the use of the command I can work out the rest. Sample line: Filename and actual url's removed for safety sake cscript file.vbs -a -r url -h url -o raw

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • PGP Command Line Decryption --- How to decrypt file?

    - by whitman6732
    I was sent a public key in order to decrypt a pgp-encrypted file. I imported the key with: gpg --import publickey.asc And verified it with gpg --list-keys Now, I'm trying to decrypt the file. I put the passphrase in a file called pass.txt and ran this at the command line: gpg --passphrase-fd ../../pass.txt --decrypt encryptedfile.txt.pgp --output encryptedfile.txt All it says is: Reading passphrase from file descriptor 0 ... And doesn't seem to be doing anything else. I can't tell if it's hanging or not. Is it a relatively quick process? The file is large ( about 2 GB ). Is the syntax for it correct?

    Read the article

  • MSBuild Include Remote File 2008?

    - by ScSub
    TFS 2008, VS 2008. I have a tfsbuild.proj and tfsbuild.msp file in $/MyStuff/TeamBuildTypes/Dev folder. I have a targets file at $/MyStuff/TeamBuildTypes/IncludeFiles/Common/test.xml. test.xml contains an XML fragment that overrides the BeforeGet task. I tried to get the file into my tfsbuild.proj file like this: <Import Project="$/MyStuff/TeamBuildTypes/IncludeFiles/Common/test.xml" /> The build fails because it tries to get the file from a relative path that is way off. How can I specify external/include files from an explicit TFS "remote" path? Thanks.

    Read the article

  • Using rest-client to upload a paperclip attachment but getting no file found error

    - by Angela
    Hello, I have a paperclip attachment that I wan to upload to a web-service using rest-client. However, when I try to run it, I get an error: No such file or directory - /system/postalimages/1/original/postcard-1.png?1274635084 But the file exists for sure: I see it in my directory. How do I debug this? Here is the code in my controller which makes the upload: def upload @postalcard = Postalcard.find(:last) response = RestClient.post('http://www.postful.com/service/upload', { :upload => { :file => File.new(@postalcard.postalimage.url,'rb') #paperclip file path } }, #end payload {"Content-Type" => @postalcard.postalimage.content_type, "Content-Length" => @postalcard.postalimage.size, "Authorization" => 'Basic dGltZm9uZzg4OEBnbWFpbC5jb206ZDlQcTVKUU4='} # end headers ) #close arguments to Restclient.post return response.body end

    Read the article

  • PHP File unreadable after being downloaded

    - by Drew
    Hi I have a script that creates a file and stores it on the server. The file is encoded in UTF-8 and is a kind of xml file for the cmap software. If i open the file directly from the server then there is no problem and the file can be read. I am forcing a download of this file when a user goes to a specific url. After such a download, the file is unreadable by the cmap software. I have to go into my text editor (notepad++) and change the encoding from UTF-8 to UTF-8 without BOM. Am I sending the wrong headers? Is php doing something to the file when it is downloading it? Any advice on this would really be appreciated. Cheers Drew

    Read the article

  • How to load the App.config file?

    - by Amokrane
    Hi, I'm parsing the App.config file of a project. This config file has been loaded from a caller project. Inside the called project, I have something like: XmlDocument xmlDoc = new XmlDocument(); xmlDoc.Load("app.config"); // Some parsing... Unfortunately the app.config file is not correctly located. Apparently the Load method is browsing the ~/bin/Release directory of the caller project, but the app.config file is located in the ~ directory. Is there any way I can load this App.config file correctly? Thanks

    Read the article

  • Problem while reading the File in a eclipse Plugin application

    - by Abhishek Choudhary
    I 've developed an eclipse plugin and in that I have a java file trying to read directories and then populate result accordingly. When I try to run the file from eclipse itself through RunJava application , it gives me proper result but as soon as I try to run the same through Eclipse Application, it is throwing NullPointerException because unable to find the directory. I tried the following ways- Suppose , I have a package as - Package - com.test.abhishek.file.java.TestWork.java Directories - com.test.abhishek.file.java.Dir1 com.test.abhishek.file.java.Dir2 Now in TestWork.java- InputStream is = LGHelpContentView.class.getResourceAsStream("/"+dirName);** The above line is getting failed. How should I keep my directory and where so that it will run as an eclipse plug-in as well.

    Read the article

  • Best Practices for working with files via c#

    - by user177883
    Application I work on generates several hundreds of files in a 15 minutes period of times. and the back end of the application takes these files and process them (updates database with those values). One problem is database locks. What are the best practices on working with several thousands of files to avoid locking and efficiently processing these files? Would it be more efficient to create a single file and process it? or process single file at a time? What are so common best practices?

    Read the article

  • wkhtmltopdf - cannot convert local file

    - by user522962
    I just downloaded version 10.0 for opensuse v. 11.3. I can convert a webpage (ie www.google.com) using it but cannot convert a local file. I grant all permissions on the file (& i've even tried running under sudo to no avail). This is the error: "Loading pages (1/6) Error: Failed loading page file:///file.html". The file exists but wkhtmltopdf refuses to load it. I even tried version 9.9 w/ the same result What am I missing?

    Read the article

  • problem in opening a link to .rar file

    - by Kenneth
    Hi all, In my jsp, I have a hyperlink linking to a .rar file in the system. Somehow when I clicked on the link, it does not ask users to 'save file' or 'open file' nor using 7zip to open the .rar file. Instead, it just displays some junk characters on the web page. I thought it might be the problem with mime-mapping. So I put an mime-mapping to web.xml with mime-type=application/x-rar-compressed. But it still doesn't work. Do you have any idea what the problem is and how to solve it? Thanks a lot in advance. Other file types have no problem. Kenneth

    Read the article

< Previous Page | 243 244 245 246 247 248 249 250 251 252 253 254  | Next Page >