Search Results

Search found 8371 results on 335 pages for 'inline block'.

Page 250/335 | < Previous Page | 246 247 248 249 250 251 252 253 254 255 256 257  | Next Page >

  • How do I get more information on a potential network freeloader?

    - by Dov
    I have a home network set up, complete with a relatively good password. I'm in Mac OS X 10.6 (Snow Leopard) and have been noticing, on occasion, a computer showing up in my Finder's Shared section, that is not one of my own (the "pe-xpjalle" box pictured below). He has a tendency to come and go. How can I figure out his MAC address or something, so I can block him? I checked my "Logs and Statistics" in the Airport Utility, and didn't see that computer under DHCP clients. I'd rather not change my password, since I have quite a few devices I'd have to update. Is there any other reason he's show up on my network besides having guessed my password? Update: I fixed the Dropbox URL above (how embarrassing, I'm new to Dropbox. Thanks for the heads up, Doug.) Update 2: I tried clicking on "Connect as..." just for the hell of it, and got the dialog below. Now I have even less an idea what's going on than before. I don't have Parallels of VMware running, just the following: Transmission, NetNewsWire, Mail, Things, Safari, iTunes, Photoshop, Pages, Yojimbo, Preferences, AppleScript Editor, Software Update, Airport Utility, and Terminal. I don't think any of those create a virtual network machine, right? And no VMware machine of mine has ever had a name resembling "pe-xpjalle". Update 3: I just changed my passwords on both my N- and G-only networks, and I'm still seeing this, so I highly doubt that it's someone who's figured out my password (twice now). I'm really stumped.

    Read the article

  • authbind, privbind or iptables REDIRECT (port 80 to 8080)?

    - by chris_l
    Hi, I'd like to run Glassfish v3 as a non-privileged user on Linux (Debian), but make it available on port 80. I'm currently doing this with iptables: iptables -t nat -I PREROUTING -p tcp -d x.x.x.x --dport 80 -j REDIRECT --to-port 8080 This works, but I wonder: If this has any significant performance impact compared to binding directly to port 80 If I could make a similar setup also work for HTTPS (or if that must run on 443) If there's a way to avoid other users from binding to port 8080 (in case my server crashes) - maybe block that port permanently to other users somehow? ...or if I should use authbind/privbind instead? Problem: I couldn't make it work with authbind or privbind so far. For authbind, I edited asadmin's last line to: exec authbind --deep "$JAVA" -Djava.net.preferIPv4Stack=true -jar ... For privbind: exec privbind -u glassfish "$JAVA" -Djava.net.preferIPv4Stack=true -jar ... (Only) with these settings, I can successfully perform a create-domain --domainport 80. This proves, that authbind and privbind actually work (the authbind version of the script is called by the glassfish user; the privbind version is called by root of course). However, in both cases I get the following exception, when starting the domain (start-domain): [#|2010-03-20T13:25:21.925+0100|SEVERE|glassfishv3.0|javax.enterprise.system.core.com.sun.enterprise.v3.server|_ThreadID=11;_ThreadName=FelixStartLevel;|Shutting down v3 due to startup exception : Permission denied: 80=com.sun.enterprise.v3.services.impl.monitor.MonitorableSelectorHandler@1fc25e5|#] I haven't found a solution for that yet (after searching the web, it seems, that this isn't so easy?) But maybe, the solution with iptables is good enough - what do you think? Thanks, Chris

    Read the article

  • How to get the permissions right for /dev/raw1394

    - by Mark0978
    I recently upgraded one of my ubuntu machines to Karmic and I'm having trouble getting the permissions of /dev/raw1394 set to 0666. They only thing this machine is used for is recording audio from a firepod which uses /dev/raw1394 via jackd and there are no other FireWire devices connected, so security around this device is not really an issue. If I run as root, everything works as expected, but I have some folks that run the recorder that I don't want to have root access. However, I can't figure out which lines setup the perms I've tied this: /etc/udev/permissions.d/raw1394.rules:raw1394:root:root:0666 And I have this setup (default install) /lib/udev/rules.d/75-persistent-net-generator.rules:SUBSYSTEMS=="ieee1394", ENV{COMMENT}="Firewire device $attr{host_id})" /lib/udev/rules.d/75-cd-aliases-generator.rules:# the "path" of usb/ieee1394 devices changes frequently, use "id" /lib/udev/rules.d/75-cd-aliases-generator.rules:ACTION=="add", SUBSYSTEM=="block", SUBSYSTEMS=="usb|ieee1394", ENV{ID_CDROM}=="?*", ENV{GENERATED}!="?*", \ /lib/udev/rules.d/60-persistent-storage-tape.rules:KERNEL=="st*[0-9]|nst*[0-9]", ATTRS{ieee1394_id}=="?*", ENV{ID_SERIAL}="$attr{ieee1394_id}", ENV{ID_BUS}="ieee1394" /lib/udev/rules.d/50-udev-default.rules:# FireWire (deprecated dv1394 and video1394 drivers) /lib/udev/rules.d/50-udev-default.rules:KERNEL=="dv1394-[0-9]*", NAME="dv1394/%n", GROUP="video" /lib/udev/rules.d/50-udev-default.rules:KERNEL=="video1394-[0-9]*", NAME="video1394/%n", GROUP="video" /lib/udev/rules.d/60-persistent-storage.rules:KERNEL=="sd*[!0-9]|sr*", ATTRS{ieee1394_id}=="?*", SYMLINK+="disk/by-id/ieee1394-$attr{ieee1394_id}" /lib/udev/rules.d/60-persistent-storage.rules:KERNEL=="sd*[0-9]", ATTRS{ieee1394_id}=="?*", SYMLINK+="disk/by-id/ieee1394-$attr{ieee1394_id}-part%n" And I find these lines in /var/log/syslog Apr 30 09:11:30 record kernel: [ 3.284010] ieee1394: Node added: ID:BUS[0-00:1023] GUID[000a9200c7062266] Apr 30 09:11:30 record kernel: [ 3.284195] ieee1394: Host added: ID:BUS[0-01:1023] GUID[00d0035600a97b9f] Apr 30 09:11:30 record kernel: [ 18.372791] ieee1394: raw1394: /dev/raw1394 device initialized What I can't figure out, is which line actually creates that raw1394 device in the first place. How do you get /dev/raw1394 to have permissions 0666?

    Read the article

  • Chef: nested data bag data to template file returns "can't convert String into Integer"

    - by Dalho Park
    I'm creating simple test recipe with a template and data bag. What I'm trying to do is creating a config file from data bag that has simple nested information, but I receive error "can't convert String into Integer" Here are my setting file 1) recipe/default.rb data1 = data_bag_item( 'mytest', 'qa' )['test'] data2 = data_bag_item( 'mytest', 'qa' ) template "/opt/env/test.cfg" do source "test.erb" action :create_if_missing mode 0664 owner "root" group "root" variables({ :pepe1 = data1['part.name'], :pepe2 = data2['transport.tcp.ip2'] }) end 2)my data bag named "mytest" $knife data bag show mytest qa id: qa test: part.name: L12 transport.tcp.ip: 111.111.111.111 transport.tcp.port: 9199 transport.tcp.ip2: 222.222.222.222 3)template file test.erb part.name=<%= @pepe1 % transport.tcp.binding=<%= @pepe2 % Error reurns when I run chef-client on my server, [2013-06-24T19:50:38+00:00] DEBUG: filtered backtrace of compile error: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in []',/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:inblock in from_file',/var/chef/cache/cookbooks/config_test/recipes/default.rb:12:in from_file' [2013-06-24T19:50:38+00:00] DEBUG: filtered backtrace of compile error: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in[]',/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in block in from_file',/var/chef/cache/cookbooks/config_test/recipes/default.rb:12:infrom_file' [2013-06-24T19:50:38+00:00] DEBUG: backtrace entry for compile error: '/var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in `[]'' [2013-06-24T19:50:38+00:00] DEBUG: Line number of compile error: '19' Recipe Compile Error in /var/chef/cache/cookbooks/config_test/recipes/default.rb TypeError can't convert String into Integer Cookbook Trace: /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:in []' /var/chef/cache/cookbooks/config_test/recipes/default.rb:19:inblock in from_file' /var/chef/cache/cookbooks/config_test/recipes/default.rb:12:in `from_file' Relevant File Content: /var/chef/cache/cookbooks/config_test/recipes/default.rb: 12: template "/opt/env/test.cfg" do 13: source "test.erb" 14: action :create_if_missing 15: mode 0664 16: owner "root" 17: group "root" 18: variables({ 19 :pepe1 = data1['part.name'], 20: :pepe2 = data2['transport.tcp.ip2'] 21: }) 22: end 23: I tried many things and if I comment out "pepe1 = data1['part.name'],", then :pepe2 = data2['transport.tcp.ip2'] works fine. only nested data "part.name" cannot be set to @pepe1. Does anyone knows why I receive the errors? thanks,

    Read the article

  • Time drift in Cloud Server - need to mainpulate GRUB config

    - by Aditya Advani
    We are hosting a VPS on a popular host and are experiencing a regular time drift of several minutes a day forward (approx 7). Linux Kernel: 2.6.18-164.11.1.el5 GNU/Linux Distro: CentOS release 5.4 (Final) We reached out to our hosting provider and their support advised us " This is a known issue with Cloud Servers. To fix this you will need to add one line to your grub config located at: /boot/grub/menu.lst The line you need to add is: noapic nolapic divider=10 nolapic_timer This should correct this issue. You will need to restart after this is added in. " Because I am wary of manipulating grub, mostly I'm terrified that our server may fail to restart - I ask you guys, the pro *nix admins - where exactly in this file does the recommended insertion below: # line from 1&1 for time syncing issue (Case 5163) noapic nolapic divider=10 nolapic_timer go? Please specify where exactly, and whether the order of commands is or is not important. Why is the block below "title CentOS ..." indented? If someone could give me an overview of how this works or point me to a resource that's easy to follow, that's what I'm looking for immediately, a light overview or basic understanding of what I;m doing. If GRUB and bootloaders are a deep dark treasure trove of kernel hacking or something, that's great well-recommended in-depth resources are also very welcome. This is my current /boot/grub/menu.lst # grub.conf generated by anaconda # # Note that you do not have to rerun grub after making changes to this file #boot=/dev/sda # serial --unit=0 --speed=57600 terminal --timeout=5 serial console timeout=5 title CentOS (2.6.18-164.11.1.el5) root (hd0,0) kernel /boot/vmlinuz-2.6.18-164.11.1.el5 ro root=/dev/hda1 console=tty0 console=tty initrd /boot/initrd-2.6.18-164.11.1.el5.img MOST IMPORTANT: I need to know where in the file above it is appropriate to paste the suggested line so I can confidently restart my VPS after manipulating GRUB config

    Read the article

  • When using procmail with maildir, it returns error with code I found

    - by bradlis7
    I'm not an expert at procmail, but I have this code: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user, sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Thanks for the help.

    Read the article

  • iSCSI, failover and XenServer

    - by jemmille
    I have an iSCSI fail over implementation setup so if one of my storage units fails the other takes over immediately (it also runs the NFS shares). When fail over occurs, volumes are exported, the IP is switched to the other machine and the targets are reconfigured. The fail over of the storage system itself works just fine. I use NexentaStor for my filer. When I do a test (manual) fail over of my storage the following occurs: Note: I run the admin VM's on NFS and customer based VM's on iSCSI All NFS based VM's remain up and working perfectly through the failover and after All VM 's running on iSCSI eventually report the following: An error about not being able to write to a particular block An error about journaling not working Then the file system goes RO To get the VM's working again I have to do the following: Force shutdown of the "broken" VM's. Detach the iSCSI SR Re-attach the iSCSI SR Boot the VM on a different server (5 in my pool) If I don't boot on a different server I get this error "Internal error: Failure("The VDI <uuid&gt; is already attached in RW mode; it can't be attached in RO mode!")" The only way I have found to fix that error is to reboot the entire server it was running on previously which is obviously a huge pain. Currently multipathing is NOT enabled (but can be and the same thing still occurs). I have edited much of the /etc/iscsid.conf file to work with the timeout settings but to no avail. In short, my storage fails over properly but XenServer does not keep the connection alive. As a thought, the error that shows up in #4 above might be the ultimate cause and fixing that would fix everything? Any help would be appreciated more than you know.

    Read the article

  • client flips between internal and external IP addresses??

    - by jmiller-miramontes
    I have what seems like a not-particularly-complicated home network, all things considered: a DSL line comes in to a modem/router, which goes off to a switch, which supports a bunch of machines. My machines live in a 192.168.0.x address space; however, I'm running some public servers on the network, so I have a block of 8 (5, really) static IP addresses that are mapped to the servers by the router. The non-servers get 192.168.0.x addresses via NAT; some machines have static addresses and some get addresses from DHCP. Locally, I'm running a DNS server (named) to map between the domain names and the 192.168 address space. Somewhat messy, but everything basically works. Except: One of my local non-server clients occasionally switches from its internal address to its external address. That is, if I check the logs of a website I'm running internally, the hits coming from this client sometimes show up with the internal 192.168 address, and sometimes with the external (216.103...) address. It will flip back and forth for no apparent reason, without my doing anything. This can be a problem in terms of how the clients interact with the way I have some of the clients' SSH systems configured (e.g., allowing access from the internal network but not the external network), but it also Just Seems Wrong. I will confess that I'm kinda skating on the very edge of my networking competence here, but I can't for the life of me figure out what's going on. If it helps, the client in question is running Mac OS X / 10.6; its address is statically assigned, is not one of the five externally-accessible addresses, and gets its DNS from (first) the internal DNS server and (second) my ISP's DNS servers. I can't swear that none of the other NAT clients are also showing this problem; the one I'm dealing with is my everyday machine, so this is where I run into it. Does anybody out there have any advice? This is driving me crazy...

    Read the article

  • Adding Static IP's to the NIC

    - by Brett Powell
    We are currently working on migrating a lot of new machines to our network, and my job this morning was to setup all of the IP Addresses. I worked on this all morning, and when I got back tonight I was informed that they had all been setup incorrectly, and had to be removed and re-added. I am quite confused as I have been setting up IP's on machines for a long time and I am curious as to what the issue is. Just taking into account this example... 72.26.196.160/29 255.255.255.248 A /29 block is 5 usable IP's. With the script I wrote and used, the IP Addresses .162 - .166 were added to the NIC. I can't remember now what the name for .161 was, but isn't it the broadcast address or something which isn't assigned to the NIC when adding additional IP Blocks? I am curious as to where my logic is failing me. Not to mention even if .161 was to be added, there is no reason why all of the IPs would have to be removed, as .161 could just be added in addition to these.

    Read the article

  • Convert HTACCESS mod_rewrite directives to nginx format?

    - by Chris
    I'm brand new to nginx and I am trying to convert the app I wrote over from Apache as I need the ability to serve a lot of clients at once without a lot of overhead! I'm getting the hang of setting up nginx and FastCGI PHP but I can't wrap my head around nginx's rewrite format just yet. I know you have to write some simple script that goes in the server {} block in the nginx config but I'm not yet familiar with the syntax. Could anyone with experience with both Apache and nginx help me convert this to nginx format? Thanks! # ------------------------------------------------------ # # Rewrite from canonical domain (remove www.) # # ------------------------------------------------------ # RewriteCond %{HTTP_HOST} ^www.domain.com RewriteRule (.*) http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # This redirects index.php to / # # ------------------------------------------------------ # RewriteCond %{THE_REQUEST} ^[A-Z]+\ /(index|index\.php)\ HTTP/ RewriteRule ^(index|index\.php)$ http://domain.com/ [R=301,L] # ------------------------------------------------------ # # This rewrites 'directories' to their PHP files, # # fixes trailing-slash issues, and redirects .php # # to 'directory' to avoid duplicate content. # # ------------------------------------------------------ # RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)$ $1.php [L] RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^(.*)/$ http://domain.com/$1 [R=301,L] RewriteCond %{THE_REQUEST} ^[A-Z]+\ /[^.]+\.php\ HTTP/ RewriteCond %{DOCUMENT_ROOT}/$1.php -f RewriteRule ^([^.]+)\.php$ http://domain.com/$1 [R=301,L] # ------------------------------------------------------ # # If it wasn't redirected previously and is not # # a file on the server, rewrite to image generation # # ------------------------------------------------------ # RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule ^([a-z0-9_\-@#\ "'\+]+)/?([a-z0-9_\-]+)?(\.png|/)?$ generation/image.php?user=${escapemap:$1}&template=${escapemap:$2} [NC,L]

    Read the article

  • Backing up VMs to a tape drive

    - by Aljoscha Vollmerhaus
    I've got myself one of these fancy tape drives, HP LTO2 with 200/400 GB cartridges. The st driver reports it like this: scsi 1:0:0:0: Sequential-Access HP Ultrium 2-SCSI T65D I can store and retrieve files like a charm using tar, both tar cf /dev/st0 somedirectory and tar xf /dev/st0 work flawless. However, what I really would like to backup are LVM LVs. They contain entire virtual machines with varying partition layouts, so using mount and tar is not an option. I've tried using something like dd if=/dev/VG/LV bs=64k of=/dev/st0 to achieve this, but there seem to be various problems associated with this approach. Firstly, I would like to be able to store more than 1 LV on a single tape. Now I guess I could seek to concatenate the data on the tape, but I think this would not work very well in an automated scenario with many different LVs of various sizes. Secondly, I would like to store a small XML file along with the raw data that contains some information about the VM contained in the LV. I could dump everything to a directory and tar it up - not very desirable, I would have to set aside huge amounts of scratch space. Is there an easier way to achieve this? Thirdly, from googling around it seems like it would be wise to use something like mbuffer when writing to the tape, to prevent what wikipedia calls "shoe-shining" the tape. However, I can't get anything useful done with mbuffer. The mbuffer man page suggests this for writing to a tape device: mbuffer -t -m 10M -p 80 -f -o $TAPE So I've tried this: dd if=/dev/VG/LV | mbuffer -t -m 10M -p 80 -f -d 64k -o /dev/st0 Note the added "-d 64k" to account for the 64k block size of the tape. However, reading data back from a tape written in this way never seems to yield any useful results - dd has been running for ages now, and managed to transfer only 361M of data from the tape. What's wrong here?

    Read the article

  • Setup site folders on Apache and PHP

    - by Cobus Kruger
    I'm trying to set up my first Apache server on my Windows PC at home and I have real trouble finding out which configuration settings go where. I downloaded and installed XAMPP which seemed to get everything nicely set up and can see a working website on http://localhost. So far so good. The point of this is to develop a website of course, and to make my life easier (irony?), I wanted to let the web site root point to my Eclipse project folder. So I opened httpd-vhosts.conf, uncommented a VirtualHost block and changed its DocumentRoot to my local path. Now when I try to load http://localhost I get a 403 (Access denied) error. So where do I configure permissions for my folder? And is that all I need to let my site run from the folder specified or am I going to have to clear another hurdle? Update: I tried to simplify things a little, so I reinstalled XAMPP and got back to a working http://localhost. Then I confirmed that httpd-vhosts.conf is included in httpd.conf and made the following changes to httpd-vhosts.conf: Uncommented the line NameVirtualHost *:80 Added a virtual host shown below. Restarted Apache and saw the expected page on http://localhost <VirtualHost *:80> DocumentRoot "C:/xampp/htdocs/" ServerName localhost ErrorLog "logs/dummy-host2.localhost-error.log" CustomLog "logs/dummy-host2.localhost-access.log" combined </VirtualHost> I then created a new folder named C:\testweb, added an index.html file and changed the DocumentRoot line shown above. For all intents and purposes I would then expect the two configurations to be equivalent. But this setup gives me an error 403. Even though the C:\testweb folder already had the same permissions as the C:\xampp\htdocs folder, I then went further and gave the Everyone group full control of C:\testweb and got exactly the same problem. So what did I miss?

    Read the article

  • Is On-The-Fly string replacement possible using GreaseMonkey and Firefox

    - by Gary M. Mugford
    I have looked for means to stop Brightcove videos from autostarting in Firefox and have come to the conclusion it isn't possible without external programming via something like Grease Monkey. However, I'm not proficient in javascript let alone GM. So I thought I'd ask here first whether what I want to do is feasible, or whether it's a fool's errand. What I want to accomplish is have a site specific script executed to replace a string value on the run in that site's code. Specifically, what I am looking for is something GM-style that would do this: if site_domain = 'www.SiteWithAutoPlayVideos.com' then replace_all('<param name="autoStart" value="true" />', '<param name="autoStart" value="false" />'); Having looked through Super User for anything GreaseMonkey that might relate, I see notices that the sandbox GM executes scripts in has to remain separate for security reasons. So, I suspect I might be in for disappointment. BUT if it is accomplishable and somebody here can confirm it, then I will do my best to struggle through the learning curve and get this noisome little problem put to rest. Yes, I have tried Flash Block and FlashDisable in order to attack this issue with no avail. Thanks in advance for your time.

    Read the article

  • MS SQL Server slows down over time?

    - by Dave Holland
    Have any of you experienced the following, and have you found a solution: A large part of our website's back-end is MS SQL Server 2005. Every week or two weeks the site begins running slower - and I see queries taking longer and longer to complete in SQL. I have a query that I like to use: USE master select text,wait_time,blocking_session_id AS "Block", percent_complete, * from sys.dm_exec_requests CROSS APPLY sys.dm_exec_sql_text(sql_handle) AS s2 order by start_time asc Which is fairly useful... it gives a snapshot of everything that's running right at that moment against your SQL server. What's nice is that even if your CPU is pegged at 100% for some reason and Activity Monitor is refusing to load (I'm sure some of you have been there) this query still returns and you can see what query is killing your DB. When I run this, or Activity Monitor during the times that SQL has begun to slow down I don't see any specific queries causing the issue - they are ALL running slower across the board. If I restart the MS SQL Service then everything is fine, it speeds right up - for a week or two until it happens again. Nothing that I can think of has changed, but this just started a few months ago... Ideas? --Added Please note that when this database slowdown happens it doesn't matter if we are getting 100K page views an hour (busier time of day) or 10K page views an hour (slow time) the queries all take a longer time to complete than normal. The server isn't really under stress - the CPU isn't high, the disk usage doesn't seem to be out of control... it feels like index fragmentation or something of the sort but that doesn't seem to be the case. As far as pasting results of the query I pasted above I really can't do that. The Query above lists the login of the user performing the task, the entire query, etc etc.. and I'd really not like to hand out the names of my databases, tables, columns and the logins online :)... I can tell you that the queries running at that time are normal, standard queries for our site that run all the time, nothing out of the norm.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Identifying mail account used in CRAM-MD5 transaction

    - by ManiacZX
    I suppose this is one of those where the tool for identifying the problem is also the tool used for taking advantage of it. I have a mail server that I am seeing emails that spam is being sent through it. It is not an open relay, the messages in question are being sent by someone authenticating to the smtp with CRAM-MD5. However, the logs only capture the actual data passed, which has been hashed so I cannot see what user account is being used. My suspicion is a simple username/password combo or a user account's password has otherwise been compromised, but I cannot do much about it without knowing what user it is. Of course I can block the IP that is doing it, but that doesn't fix the real problem. I have both the CRAM-MD5 Base64 challenge string and the hashed client auth string containing the username, password and challenge string. I am looking for a way to either reverse this (which I haven't been able to find any information on) or otherwise I suppose I need a dictionary attack tool designed for CRAM-MD5 to run through two lists, one for username and one for password and the constant of the challenge string until it finds a matching result of the authentication string I have logged. Any information on reversing using the data I have logged, a tool to identify it or any alternative methods you have used for this situation would be greatly appreciated.

    Read the article

  • How can I erase the traces of Folder Redirection from the Default Domain Policy

    - by bruor
    I've taken over from an IT outsourcer and have found a struggle now that we're starting a migration to windows 7. Someone decided that they would setup Folder redirection in the Default Domain Policy. I've since configured redirection in another policy at an OU level. No matter what I do, the windows 7 systems pick up the Default Domain Policy folder redirection settings only. I keep getting entries in the event log showing that the previously redirected folders "need to be redirected" with a status of 0x80000004. From what I can tell this just means that it's redirecting them locally. Is there a way I can wipe that section of the GPO clean so it's no longer there? I'm hesitant to try to reset the default domain policy to complete defaults. ***UPDATE 6-26 I found that the following condition occurred and was causing the grief here. I've already implemented the new policies for clients, and for some reason, XP was working great, 7 was refusing to process. The DDP was enforced. Because of this, and the fact that the folder redirection policies were set to redirect back to the local profile upon removal, it was forcing clients to pick up it's "redirect to local" settings. Requirements for to recreate the issue. -Create a new test OU and policy. -Create some folder redirection settings, set them to redirect to local upon removal -Remove settings on that GPO -Refresh your view of the GPO and check the settings. -You'll notice that the settings show "not configured" entries for folder redirection. -Enforce this GPO -Create another sub-OU -Create a GPO linked to this sub-ou and configure some folder redirection settings. -Watch as the enforced GPOs "not configured" setting overrides the policy you just defined. I've had to relink the DDP to all OU's that have "block inheritance" enabled, and disable the "enforced" option on the DDP as a workaround. I'd love to re-enable enforcement of the DDP, but until I can erase the traces of folder redirection settings from the DDP, I think I'm stuck.

    Read the article

  • How to whitelist external access to an internal webserver via Cisco ACLs?

    - by Josh
    This is our company's internet gateway router. This is what I want to accomplish on our Cisco 2691 router: All employees need to be able to have unrestricted access to the internet (I've blocked facebook with an ACL, but other than that, full access) There is an internal webserver that should be accessible from any internal IP address, but only a select few external IP addresses. Basically, I want to whitelist access from outside the network. I don't have a hardware firewall appliance. Until now, the webserver has not needed to be accessible externally... or in any case, the occasional VPN has sufficed when needed. As such, the following config has been sufficient: access-list 106 deny ip 66.220.144.0 0.0.7.255 any access-list 106 deny ip ... (so on for the Facebook blocking) access-list 106 permit ip any any ! interface FastEthernet0/0 ip address x.x.x.x 255.255.255.248 ip access-group 106 in ip nat outside fa0/0 is the interface with the public IP However, when I add... ip nat inside source static tcp 192.168.0.52 80 x.x.x.x 80 extendable ...in order to forward web traffic to the webserver, that just opens it up entirely. That much makes sense to me. This is where I get stumped though. If I add a line to the ACL to explicitly permit (whitelist) an IP range... something like this: access-list 106 permit tcp x.x.x.x 0.0.255.255 192.168.0.52 0.0.0.0 eq 80 ... how do I then block other external access to the webserver while still maintaining unrestricted internet access for internal employees? I tried removing the access-list 106 permit ip any any. That ended up being a very short-lived config :) Would something like access-list 106 permit ip 192.168.0.0 0.0.0.255 any on an "outside-inbound" work?

    Read the article

  • How do I use a self encrypting drive?

    - by Unique_Key
    I recently purchased a Micron RealSSD c400 self encrypting drive, and I am having a few issues when trying to get it recognized by my laptop (HP Elitebook 8440p running Windows 7 x64; also tried on a custom-built desktop). When I try to initialize the drive from disk management, I get a CRC error; also, when attempting to partition it from Windows setup, the program can't create the partitions. I also tried with UBCD, nothing. I assume this is due to drive security, but I haven't been able to find much information about this online; do I need a management software or something? I'm completely stumped here. EDIT As requested, when I try partitioning the device from Windows setup I get a 0x80300024 error; when I try initializing it from disk management, I get a "Data error (cyclic redundancy check)" message, and the event log shows the following under System: Source: VDS Basic Provider, message: unexpected failure. error code 490@01010004 (2x) Source: Virtual Disk Service, message: VDS fails to write boot code on a disk during clean operation. Error code: 80070001@02070008 (1x) Source: Disk, message: The device \Device\Harddisk2\DR2 has a bad block (2x) The security logs show nothing related. Also, when attempting to configure it from UBCD (utility: HDAT2), I get an error along the lines of "can't edit partition information" or something to that tune.

    Read the article

  • How do you monitor SSD wear in Windows when the drives are presented as 'generic' devices?

    - by MikeyB
    Under Linux, we can monitor SSD wear fairly easily with smartmontools whether the drive is presented as a normal block device or a generic device (which happens when the drive has been hardware RAIDed by certain controllers such as the one on the IBM HS22). How can we do the equivalent under Windows? Does anyone actually use smartmontools? Or are there other packages out there? The problem is that SCSI Generic devices just don't show up in Windows. If the drives aren't RAIDed we can see them fine. How I'd do it in Linux: sles11-live:~ # lsscsi -g [1:0:0:0] disk SMART USB-IBM 8989 /dev/sda /dev/sg0 [2:0:0:0] disk ATA MTFDDAK256MAR-1K MA44 - /dev/sg1 [2:0:1:0] disk ATA MTFDDAK256MAR-1K MA44 - /dev/sg2 [2:1:8:0] disk LSILOGIC Logical Volume 3000 /dev/sdb /dev/sg3 sles11-live:~ # smartctl -l ssd /dev/sg1 smartctl 5.42 2011-10-20 r3458 [x86_64-linux-2.6.32.49-0.3-default] (local build) Copyright (C) 2002-11 by Bruce Allen, http://smartmontools.sourceforge.net Device Statistics (GP Log 0x04) Page Offset Size Value Description 7 ===== = = == Solid State Device Statistics (rev 1) == 7 0x008 1 26~ Percentage Used Endurance Indicator |_ ~ normalized value sles11-live:~ # smartctl -l ssd /dev/sg2 smartctl 5.42 2011-10-20 r3458 [x86_64-linux-2.6.32.49-0.3-default] (local build) Copyright (C) 2002-11 by Bruce Allen, http://smartmontools.sourceforge.net Device Statistics (GP Log 0x04) Page Offset Size Value Description 7 ===== = = == Solid State Device Statistics (rev 1) == 7 0x008 1 3~ Percentage Used Endurance Indicator |_ ~ normalized value

    Read the article

  • How to combine try_files and sendfile on Nginx?

    - by hcalves
    I need Nginx to serve a file relative from document root if it exists, then fallback to an upstream server if it doesn't. This can be accomplished with something like: server { listen 80; server_name localhost; location / { root /var/www/nginx/; try_files $uri @my_upstream; } location @my_upstream { internal; proxy_pass http://127.0.0.1:8000; } } Fair enough. The problem is, my upstream is not serving the contents of URI directly, but instead, returning X-Accel-Redirect with a location relative to document root (it generates this file on-the-fly): % curl -I http://127.0.0.1:8000/animals/kitten.jpg__100x100__crop.jpg HTTP/1.0 200 OK Date: Mon, 26 Nov 2012 20:58:25 GMT Server: WSGIServer/0.1 Python/2.7.2 X-Accel-Redirect: animals/kitten.jpg__100x100__crop.jpg Content-Type: text/html; charset=utf-8 Apparently, this should work. The problem though is that Nginx tries to serve this file from some internal default document root instead of using the one specified in the location block: 2012/11/26 18:44:55 [error] 824#0: *54 open() "/usr/local/Cellar/nginx/1.2.4/htmlanimals/kitten.jpg__100x100__crop.jpg" failed (2: No such file or directory), client: 127.0.0.1, server: localhost, request: "GET /animals/kitten.jpg__100x100__crop.jpg HTTP/1.1", upstream: "http://127.0.0.1:8000/animals/kitten.jpg__100x100__crop.jpg", host: "127.0.0.1:80" How do I force Nginx to serve the file relative to the right document root? According to XSendfile documentation the returned path should be relative, so my upstream is doing the right thing.

    Read the article

  • Error with procmail script to use Maildir format

    - by bradlis7
    I have this code in /etc/procmailrc: DROPPRIVS=yes DEFAULT=$HOME/Maildir/ :0 * ? /usr/bin/test -d $DEFAULT || /bin/mkdir $DEFAULT { } :0 E { # Bail out if directory could not be created EXITCODE=127 HOST=bail.out } MAILDIR=$HOME/Maildir/ But, when the directory already exists, sometimes it will send a return email with this error: 554 5.3.0 unknown mailer error 127. The email still gets delivered, mind you, but it sends back an error code to the sending user as well. I fixed this temporarily by commenting out the EXITCODE and HOST lines, but I'd like to know if there is a better solution. I found this block of code in multiple places across the net, but couldn't really find why this error was coming back to me. It seems to happen when I send an email to a local user. Sometimes the user has a .forward file to send it on to other users, sometimes not, but the result has been the same. I also tried removing DROPPRIVS, just in case it was messing up the forwarding, but it did not seem to affect it. Is the line starting with * ? /usr/bin/test a problem? The * signifies a regex, but the ? makes it return an integer value, correct? What is the integer being matched against? Or is it just comparing the integer return value? Do I need a space between the two blocks? Thanks for the help.

    Read the article

  • chrooting php-fpm with nginx

    - by dragonmantank
    I'm setting up a new server with PHP 5.3.9 and nginx, so I compiled PHP with the php-fpm SAPI options. By itself it works great using the following server entry in nginx: server { listen 80; server_name domain.com www.domain.com; root /var/www/clients/domain.com/www/public; index index.php; log_format gzip '$remote_addr - $remote_user [$time_local] "$request" $status $bytes_sent "$http_referer" "$http_user_agent" "$gzip_ratio"'; access_log /var/www/clients/domain.com/logs/www-access.log; error_log /var/www/clients/domain.com/logs/www-error.log error; location ~\.php$ { fastcgi_pass 127.0.0.1:9001; fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME /var/www/clients/domain.com/www/public$fastcgi_script_name; fastcgi_param PATH_INFO $fastcgi_script_name; include /etc/nginx/fastcgi_params; } } It servers my PHP files just fine. For added security I wanted to chroot my FPM instance, so I added the following lines to my conf file for this FPM instance: # FPM config chroot = /var/www/clients/domain.com and changed the nginx config: #nginx config for chroot location ~\.php$ { fastcgi_pass 127.0.0.1:9001; fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME www/public$fastcgi_script_name; fastcgi_param PATH_INFO $fastcgi_script_name; include /etc/nginx/fastcgi_params; } With those changes, nginx gives me a File not found message for any PHP scripts. Looking in the error log I can see that it's prepending the root path to my DOCUMENT_ROOT variable that's passed to fastcgi, so I tried to override it in the location block like this: fastcgi_param DOCUMENT_ROOT /www/public/; fastcgi_param SCRIPT_FILENAME $fastcgi_script_name; but I still get the same error, and the debug log shows the full, unchrooted path being sent to PHP-FPM. What am I missing to get this to work?

    Read the article

  • postgresql No space left on device

    - by pstanton
    Postgres is reporting that it is out of disk space while performing a rather large aggregation query: Caused by: org.postgresql.util.PSQLException: ERROR: could not write block 31840050 of temporary file: No space left on device at org.postgresql.core.v3.QueryExecutorImpl.receiveErrorResponse(QueryExecutorImpl.java:1592) at org.postgresql.core.v3.QueryExecutorImpl.processResults(QueryExecutorImpl.java:1327) at org.postgresql.core.v3.QueryExecutorImpl.execute(QueryExecutorImpl.java:192) at org.postgresql.jdbc2.AbstractJdbc2Statement.execute(AbstractJdbc2Statement.java:451) at org.postgresql.jdbc2.AbstractJdbc2Statement.executeWithFlags(AbstractJdbc2Statement.java:350) at org.postgresql.jdbc2.AbstractJdbc2Statement.executeUpdate(AbstractJdbc2Statement.java:304) at org.hibernate.engine.query.NativeSQLQueryPlan.performExecuteUpdate(NativeSQLQueryPlan.java:189) ... 8 more However the disk has quite a lot of space: Filesystem Size Used Avail Use% Mounted on /dev/sda1 386G 123G 243G 34% / udev 5.9G 172K 5.9G 1% /dev none 5.9G 0 5.9G 0% /dev/shm none 5.9G 628K 5.9G 1% /var/run none 5.9G 0 5.9G 0% /var/lock none 5.9G 0 5.9G 0% /lib/init/rw The query is doing the following: INSERT INTO summary_table SELECT t.a, t.b, SUM(t.c) AS c, COUNT(t.*) AS count, t.d, t.e, DATE_TRUNC('month', t.start) AS month, tt.type AS type, FALSE, tt.duration FROM detail_table_1 t, detail_table_2 tt WHERE t.trid=tt.id AND tt.type='a' AND DATE_PART('hour', t.start AT TIME ZONE 'Australia/Sydney' AT TIME ZONE 'America/New_York')>=23 OR DATE_PART('hour', t.start AT TIME ZONE 'Australia/Sydney' AT TIME ZONE 'America/New_York')<13 GROUP BY month, type, t.a, t.b, t.d, t.e, FALSE, tt.duration any tips?

    Read the article

  • How can i get more low memory with the following setup:

    - by user539484
    Modules using memory below 1 MB: Name Total = Conventional + Upper Memory -------- ---------------- ---------------- ---------------- MSDOS 14 317 (14K) 14 317 (14K) 0 (0K) HIMEM 1 120 (1K) 1 120 (1K) 0 (0K) EMM386 3 120 (3K) 3 120 (3K) 0 (0K) OAKCDROM 36 064 (35K) 36 064 (35K) 0 (0K) POWER 80 (0K) 80 (0K) 0 (0K) NLSFUNC 2 784 (3K) 2 784 (3K) 0 (0K) COMMAND 2 928 (3K) 2 928 (3K) 0 (0K) MSCDEX 15 712 (15K) 15 712 (15K) 0 (0K) SMARTDRV 30 384 (30K) 13 984 (14K) 16 400 (16K) KEYB 6 752 (7K) 6 752 (7K) 0 (0K) MOUSE 17 296 (17K) 17 296 (17K) 0 (0K) DISPLAY 8 336 (8K) 0 (0K) 8 336 (8K) SETVER 512 (1K) 0 (0K) 512 (1K) DOSKEY 4 144 (4K) 0 (0K) 4 144 (4K) POWER 4 672 (5K) 0 (0K) 4 672 (5K) Free 552 944 (540K) 539 088 (526K) 13 856 (14K) Memory Summary: Type of Memory Total = Used + Free ---------------- ---------- ---------- ---------- Conventional 653 312 114 224 539 088 Upper 47 920 34 064 13 856 Reserved 0 0 0 Extended (XMS)* 64 898 256 2 671 824 62 226 432 ---------------- ---------- ---------- ---------- Total memory 65 599 488 2 820 112 62 779 376 Total under 1 MB 701 232 148 288 552 944 Total Expanded (EMS) 33 947 648 (33 152K Free Expanded (EMS)* 33 538 048 (32 752K * EMM386 is using XMS memory to simulate EMS memory as needed. Free EMS memory may change as free XMS memory changes. Largest executable program size 538 976 (526K) Largest free upper memory block 7 488 (7K) MS-DOS is resident in the high memory area. I'm running MS-DOS 6.22 on VMWare virtual hardware. This is memory state after memmaker pass, so i'm looking for optimization beyond memmaker. Note: NLS drivers (DISPLAY, KEYB, NSLFUNC) are essential for me. Thanks to @mtone for valuable reminder about MSCDEX /E which gave me 16KiB of low memory (see the diff)!

    Read the article

< Previous Page | 246 247 248 249 250 251 252 253 254 255 256 257  | Next Page >