Search Results

Search found 34668 results on 1387 pages for 'return'.

Page 255/1387 | < Previous Page | 251 252 253 254 255 256 257 258 259 260 261 262  | Next Page >

  • Getting jQuery slideshow animation to stop on click

    - by hollyb
    I have a slide show built with jQuery that pauses on hover. It has a group of thumbnails sitting on top of the image that advances the image when clicked, otherwise the slideshow just auto-rotates through all the images. There is also a +/- to expand and contract a caption related to each image. I want to have the slideshow's automatic advancing to stop if one of the thumbnails is clicked, or the +/-. Basically, just stop whenever a user clicks anywhere within the gallery (div class=".homeImg"). I'm having a major brain fart in getting this working properly and could use some advice. Here's the jQuery: $(document).ready(function() { $(".main_image .desc").show(); //Show image info $(".main_image .block").animate({ opacity: 0.85 }, 1 ); //Set Opacity //Click and Hover events for thumbnail list $(".image_thumb ul li:first").addClass('active'); // * Adds a class 'last' to the last li to let the rotator know when to return to the first $(".image_thumb ul li:last").addClass('last'); $(".image_thumb ul li").click(function(){ //Set Variables var imgAlt = $(this).find('img').attr("alt"); //Get Alt Tag of Image var imgTitle = $(this).find('a').attr("href"); //Get Main Image URL var imgDesc = $(this).find('.block').html(); //Get HTML of block var imgDescHeight = $(".main_image").find('.block').height(); //Calculate height of block if ($(this).is(".active")) { //If it's already active, then… return false; // Don't click through } else { //Animate $(".main_image img").animate({ opacity: 0}, 800 ); $(".main_image .block").animate({ opacity: 0, marginBottom: -imgDescHeight }, 800, function() { $(".main_image .block").html(imgDesc).animate({ opacity: 0.85, marginBottom: "0" }, 250 ); $(".main_image img").attr({ src: imgTitle , alt: imgAlt}).animate({ opacity: 1}, 250 ); }); } $(".image_thumb ul li").removeClass('active'); //Remove class of 'active' on all lists $(this).addClass('active'); //add class of 'active' on this list only return false; }) .hover(function(){ $(this).addClass('hover'); }, function() { $(this).removeClass('hover'); }); //Toggle teaser $("a.collapse").click(function(){ $(".main_image .block").slideToggle(); $("a.collapse").toggleClass("show"); return false; // added to remove # browser jump }); // If we are hovering over the image area, pause the clickNext function pauseClickNext = false; $(".homeImg").hover( function () { pauseClickNext = true; }, function () { pauseClickNext = false; } ); // Define function to click the next li var clickNext = function(){ if(!pauseClickNext) { /// find the next li after .active var $next_li = $("li.active").next("li"); if($("li.active").hasClass("last") ){ $(".image_thumb ul li:first").trigger("click"); } else { $next_li.trigger("click"); } } }; // Time between image transition setInterval(clickNext, 6000); });

    Read the article

  • warning: returning reference to temporary

    - by Jack
    I have a function like this const string &SomeClass::Foo(int Value) { if (Value < 0 or Value > 10) return ""; else return SomeClass::StaticMember[i]; } I get warning: returning reference to temporary. Why is that? I thought the both values the function returns (reference to const char* "" and reference to a static member) cannot be temporary.

    Read the article

  • How do I use a custom #theme function to a fieldset in a drupal module?

    - by Rob Crowell
    I have a module that builds a form that includes a fieldset. Instead of using the <legend> element to render the fieldset title, I want to place this content in a <div> element instead. But I want to change the behavior only for the form returned by my module, so I don't want to place any new functionality into my theme's template.php file. In mymod.module I have defined: // custom rendering function for fieldset elements function theme_mymod_fieldset($element) { return 'test'; } // implement hook_theme function mymod_theme() { return array( 'mymod_fieldset' => array('arguments' => array('element' => NULL)), 'mymod_form' => array('arguments' => array()) ); } // return a form that is based on the 'Basic Account Info' category of the user profile function mymod_form() { // load the user's profile global $user; $account = user_load($user->uid); // load the profile form, and then edit it $form_state = array(); $form = drupal_retrieve_form('user_profile_form', $form_state, $account, 'Basic Account Info'); // set the custom #theme function for this fieldset $form['Basic Account Info']['#theme'] = 'mymod_fieldset'; // more form manipulations // ... return $form; } When my page gets rendered, I expected to see the fieldset representing 'Basic Account Info' to be wholly replaced by my test message 'test'. Instead what happens is that the <fieldset> and <legend> elements are rendered as normal, but with the body of the fieldset replaced by the test message instead, like this: <fieldset> <legend>Basic Account Info</legend> test </fieldset> Why doesn't my #theme function have the chance to replace the entire <fieldset> element? If I wrap a textfield in this function instead, I am able to completely replace the <input> element along with its label. Furthermore, if I provide an override in my site's template.php for theme_fieldset, it works as expected and I am able to completely replace the <fieldset>, so I know it is possible. What's different about providing #theme functions to fieldsets inside a module?

    Read the article

  • Optimizing sorting container of objects with heap-allocated buffers - how to avoid hard-copying buff

    - by Kache4
    I was making sure I knew how to do the op= and copy constructor correctly in order to sort() properly, so I wrote up a test case. After getting it to work, I realized that the op= was hard-copying all the data_. I figure if I wanted to sort a container with this structure (its elements have heap allocated char buffer arrays), it'd be faster to just swap the pointers around. Is there a way to do that? Would I have to write my own sort/swap function? #include <deque> //#include <string> //#include <utility> //#include <cstdlib> #include <cstring> #include <iostream> //#include <algorithm> // I use sort(), so why does this still compile when commented out? #include <boost/filesystem.hpp> #include <boost/foreach.hpp> using namespace std; namespace fs = boost::filesystem; class Page { public: // constructor Page(const char* path, const char* data, int size) : path_(fs::path(path)), size_(size), data_(new char[size]) { // cout << "Creating Page..." << endl; strncpy(data_, data, size); // cout << "done creating Page..." << endl; } // copy constructor Page(const Page& other) : path_(fs::path(other.path())), size_(other.size()), data_(new char[other.size()]) { // cout << "Copying Page..." << endl; strncpy(data_, other.data(), size_); // cout << "done copying Page..." << endl; } // destructor ~Page() { delete[] data_; } // accessors const fs::path& path() const { return path_; } const char* data() const { return data_; } int size() const { return size_; } // operators Page& operator = (const Page& other) { if (this == &other) return *this; char* newImage = new char[other.size()]; strncpy(newImage, other.data(), other.size()); delete[] data_; data_ = newImage; path_ = fs::path(other.path()); size_ = other.size(); return *this; } bool operator < (const Page& other) const { return path_ < other.path(); } private: fs::path path_; int size_; char* data_; }; class Book { public: Book(const char* path) : path_(fs::path(path)) { cout << "Creating Book..." << endl; cout << "pushing back #1" << endl; pages_.push_back(Page("image1.jpg", "firstImageData", 14)); cout << "pushing back #3" << endl; pages_.push_back(Page("image3.jpg", "thirdImageData", 14)); cout << "pushing back #2" << endl; pages_.push_back(Page("image2.jpg", "secondImageData", 15)); cout << "testing operator <" << endl; cout << pages_[0].path().string() << (pages_[0] < pages_[1]? " < " : " > ") << pages_[1].path().string() << endl; cout << pages_[1].path().string() << (pages_[1] < pages_[2]? " < " : " > ") << pages_[2].path().string() << endl; cout << pages_[0].path().string() << (pages_[0] < pages_[2]? " < " : " > ") << pages_[2].path().string() << endl; cout << "sorting" << endl; BOOST_FOREACH (Page p, pages_) cout << p.path().string() << endl; sort(pages_.begin(), pages_.end()); cout << "done sorting\n"; BOOST_FOREACH (Page p, pages_) cout << p.path().string() << endl; cout << "checking datas" << endl; BOOST_FOREACH (Page p, pages_) { char data[p.size() + 1]; strncpy((char*)&data, p.data(), p.size()); data[p.size()] = '\0'; cout << p.path().string() << " " << data << endl; } cout << "done Creating Book" << endl; } private: deque<Page> pages_; fs::path path_; }; int main() { Book* book = new Book("/some/path/"); }

    Read the article

  • Javascript AJAX function returns undefined instead of true / false

    - by Josh K
    I have a function that issues an AJAX call (via jQuery). In the complete section I have a function that says: complete: function(XMLHttpRequest, textStatus) { if(textStatus == "success") { return(true); } else { return(false); } } However, if I call this like so: if(callajax()) { // Do something } else { // Something else } The first is never called. If I put an alert(textStatus) in the complete function I get true, but not before that function returns undefined.

    Read the article

  • Android HelloGoogleMaps to OSMdroid (Open Street Maps)

    - by birgit
    I am trying to reproduce a working HelloGoogleMaps app in Open Street Maps - but I have trouble including the itemized overlay in OSMdroid. I have looked at several resources but I cannot figure out how to fix the error on OsmItemizedOverlay - I guess I am constructing OsmItemizedOverlay wrongly or have a mixup with OsmItemizedOverlay and ItemizedOverlay? But everything I tried to change just raised more errors... "Implicit super constructor ItemizedOverlay() is undefined. Must explicitly invoke another constructor" "Cannot make a static reference to the non-static method setMarker(Drawable) from the type OverlayItem" - I hope someone can help me getting the class definition straight? Thanks so much! package com.example.osmdroiddemomap; import java.util.ArrayList; import android.app.AlertDialog; import android.content.Context; import android.graphics.Point; import android.graphics.drawable.Drawable; import org.osmdroid.api.IMapView; import org.osmdroid.views.*; import org.osmdroid.views.overlay.*; import org.osmdroid.views.overlay.OverlayItem.HotspotPlace; public class OsmItemizedOverlay extends ItemizedOverlay<OverlayItem> { Context mContext; private ArrayList<OverlayItem> mOverlays = new ArrayList<OverlayItem>(); //ERRORS are raised by the following 3 lines: public OsmItemizedOverlay(Drawable defaultMarker, Context context) { OverlayItem.setMarker(defaultMarker); OverlayItem.setMarkerHotspot(HotspotPlace.CENTER); mContext = context; } public void addOverlay(OverlayItem overlay) { mOverlays.add(overlay); populate(); } @Override protected OverlayItem createItem(int i) { return mOverlays.get(i); } @Override public int size() { return mOverlays.size(); } protected boolean onTap(int index) { OverlayItem item = mOverlays.get(index); AlertDialog.Builder dialog = new AlertDialog.Builder(mContext); dialog.setTitle(item.getTitle()); dialog.setMessage(item.getSnippet()); dialog.show(); return true; } @Override public boolean onSnapToItem(int arg0, int arg1, Point arg2, IMapView arg3) { // TODO Auto-generated method stub return false; } }

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • Why can't you call abstract functions from abstract classes in PHP?

    - by incrediman
    I've set up an abstract parent class, and a concrete class which extends it. Why can the parent class not call the abstract function? //foo.php <?php abstract class AbstractFoo{ abstract public static function foo(); public static function getFoo(){ return self::foo();//line 5 } } class ConcreteFoo extends AbstractFoo{ public static function foo(){ return "bar"; } } echo ConcreteFoo::getFoo(); ?> Error: Fatal error: Cannot call abstract method AbstractFoo::foo() in foo.php on line 5

    Read the article

  • JNI on Android, how to pass int from c to java

    - by Joaquin
    I have a C function, I simply returns an integer, as follows: JNIEXPORT jint JNICALL Java_org_project_ScreenPosition(JNIEnv* env, jobject thiz){ int i=1; return i; } I call this function in the way of an Activity onCreateContextMenu Android, as follows: public void onCreateContextMenu(ContextMenu menu, View v, ContextMenuInfo menuInfo){ menu.setHeaderTitle("TryMenu"); int a=ScreenPosition(); return; } But all crash

    Read the article

  • Good style for handling constructor failure of critical object

    - by mtlphil
    I'm trying to decide between two ways of instantiating an object & handling any constructor exceptions for an object that is critical to my program, i.e. if construction fails the program can't continue. I have a class SimpleMIDIOut that wraps basic Win32 MIDI functions. It will open a MIDI device in the constructor and close it in the destructor. It will throw an exception inherited from std::exception in the constructor if the MIDI device cannot be opened. Which of the following ways of catching constructor exceptions for this object would be more in line with C++ best practices Method 1 - Stack allocated object, only in scope inside try block #include <iostream> #include "simplemidiout.h" int main() { try { SimpleMIDIOut myOut; //constructor will throw if MIDI device cannot be opened myOut.PlayNote(60,100); //..... //myOut goes out of scope outside this block //so basically the whole program has to be inside //this block. //On the plus side, it's on the stack so //destructor that handles object cleanup //is called automatically, more inline with RAII idiom? } catch(const std::exception& e) { std::cout << e.what() << std::endl; std::cin.ignore(); return 1; } std::cin.ignore(); return 0; } Method 2 - Pointer to object, heap allocated, nicer structured code? #include <iostream> #include "simplemidiout.h" int main() { SimpleMIDIOut *myOut; try { myOut = new SimpleMIDIOut(); } catch(const std::exception& e) { std::cout << e.what() << std::endl; delete myOut; return 1; } myOut->PlayNote(60,100); std::cin.ignore(); delete myOut; return 0; } I like the look of the code in Method 2 better, don't have to jam my whole program into a try block, but Method 1 creates the object on the stack so C++ manages the object's life time, which is more in tune with RAII philosophy isn't it? I'm still a novice at this so any feedback on the above is much appreciated. If there's an even better way to check for/handle constructor failure in a siatuation like this please let me know.

    Read the article

  • Access static class variable of parent class in Python

    - by fuenfundachtzig
    I have someting like this class A: __a = 0 def __init__(self): A.__a = A.__a + 1 def a(self): return A.__a class B(A): def __init__(self): # how can I access / modify A.__a here? A.__a = A.__a + 1 # does not work def a(self): return A.__a Can I access the __astatic variable in B? It's possible writing a instead of __a, is this the only way? (I guess the answer might be rather short: yes :)

    Read the article

  • wcf message size causing permission issue

    - by Ferrell Carr
    silverlight 3.0 client wcf 3.0 VS.Net 2005 Web Site Win 2003 Server 50 column observable collection. return observable collection select top 975 * ... no problem return observable collection select * .... Issue On SL client after proxy.Get 50 col OC logon screen from win 2003 server pops up Mever makes it to the completed event.

    Read the article

  • How to match multiple substrings in jQuery combobox autocomplete

    - by John R
    I found more than a couple examples of this with a plain jquery autocomplete but not in a way that will work with the autocomplete included in the combobox code from the demo because the structure of the code is structured so differently. I want to match every item that has all of the search tokens anywhere in any word. I don't need to match the start of any word, any part of it is fine. I don't care if the search strings are highlighted in the autocomplete list if that makes things too complicated. Desired search/result combos: (please excuse the spacing) "fi th" "fi rst second th ird" "rs on" "fi rs t sec on d third" "ec rd" "first s ec ond thi rd" but not limited to any max/min length or number of tokens. EDIT I figured part of it out using the code structure from the other autocorrect I had working. source: function( requestObj, responseFunc ) { var matchArry = $("select > option").map(function(){return this.innerHTML;}).get(); var srchTerms = $.trim(requestObj.term).split(/\s+/); // For each search term, remove non-matches $.each (srchTerms, function (J, term) { var regX = new RegExp (term, "i"); matchArry = $.map (matchArry, function (item) { if( regX.test(item) ){ return{ label: item, value: item, option: HTMLOptionElement } ? item :null; } } ); }); // Return the match results responseFunc (matchArry); }, and select: function( event, ui ) { ui.item.option.selected = true; self._trigger( "selected", event, { item: ui.item.option }); $("destination").val(ui.item.value); // I added this line }, but I can't get both multiple words AND being able to click to select working at the same time. If I remove the } ? item :null; on the return in the map function I can click to select an item. If I leave it I can type multiple words, but I can't click any of the items... Is that the problem or the option: this? I've tried replacing it with HTMLOptionElement and null and I'm stuck. I am able to set the value of another field with ui.item.value within the select label but that doesn't put the value in the search box or close the dropdown menu. Fiddle of current code: http://jsfiddle.net/eY3hM/

    Read the article

  • Error in Print Function in Bubble Sort MIPS?

    - by m00nbeam360
    Sorry that this is such a long block of code, but do you see any obvious syntax errors in this? I feel like the problem is that the code isn't printing correctly since the sort and swap methods were from my textbook. Please help if you can! .data save: .word 1,2,4,2,5,6 size: .word 6 .text swap: sll $t1, $a1, 2 #shift bits by 2 add $t1, $a1, $t1 #set $t1 address to v[k] lw $t0, 0($t1) #load v[k] into t1 lw $t2, 4($t1) #load v[k+1] into t1 sw $t2, 0($t1) #swap addresses sw $t0, 4($t1) #swap addresses jr $ra #return sort: addi $sp, $sp, -20 #make enough room on the stack for five registers sw $ra, 16($sp) #save the return address on the stack sw $s3, 12($sp) #save $s3 on the stack sw $s2, 8($sp) #save Ss2 on the stack sw $s1, 4($sp) #save $s1 on the stack sw $s0, 0($sp) #save $s0 on the stack move $s2, $a0 #copy the parameter $a0 into $s2 (save $a0) move $s3, $a1 #copy the parameter $a1 into $s3 (save $a1) move $s0, $zero #start of for loop, i = 0 for1tst: slt $t0, $s0, $s3 #$t0 = 0 if $s0 S $s3 (i S n) beq $t0, $zero, exit1 #go to exit1 if $s0 S $s3 (i S n) addi $s1, $s0, -1 #j - i - 1 for2tst: slti $t0, $s1, 0 #$t0 = 1 if $s1 < 0 (j < 0) bne $t0, $zero, exit2 #$t0 = 1 if $s1 < 0 (j < 0) sll $t1, $s1, 2 #$t1 = j * 4 (shift by 2 bits) add $t2, $s2, $t1 #$t2 = v + (j*4) lw $t3, 0($t2) #$t3 = v[j] lw $t4, 4($t2) #$t4 = v[j+1] slt $t0, $t4, $t3 #$t0 = 0 if $t4 S $t3 beq $t0, $zero, exit2 #go to exit2 if $t4 S $t3 move $a0, $s2 #1st parameter of swap is v(old $a0) move $a1, $s1 #2nd parameter of swap is j jal swap #swap addi $s1, $s1, -1 j for2tst #jump to test of inner loop j print exit2: addi $s0, $s0, 1 #i = i + 1 j for1tst #jump to test of outer loop exit1: lw $s0, 0($sp) #restore $s0 from stack lw $s1, 4($sp) #resture $s1 from stack lw $s2, 8($sp) #restore $s2 from stack lw $s3, 12($sp) #restore $s3 from stack lw $ra, 16($sp) #restore $ra from stack addi $sp, $sp, 20 #restore stack pointer jr $ra #return to calling routine .data space:.asciiz " " # space to insert between numbers head: .asciiz "The sorted numbers are:\n" .text print:add $t0, $zero, $a0 # starting address of array add $t1, $zero, $a1 # initialize loop counter to array size la $a0, head # load address of print heading li $v0, 4 # specify Print String service syscall # print heading out: lw $a0, 0($t0) # load fibonacci number for syscall li $v0, 1 # specify Print Integer service syscall # print fibonacci number la $a0, space # load address of spacer for syscall li $v0, 4 # specify Print String service syscall # output string addi $t0, $t0, 4 # increment address addi $t1, $t1, -1 # decrement loop counter bgtz $t1, out # repeat if not finished jr $ra # return

    Read the article

  • Python datetime to Unix timestamp

    - by Off Rhoden
    I have to create an "Expires" value 5 minutes in the future, but I have to supply it in UNIX Timestamp format. I have this so far, but it seems like a hack. def expires(): '''return a UNIX style timestamp representing 5 minutes from now''' epoch = datetime.datetime(1970, 1, 1) seconds_in_a_day = 60 * 60 * 24 five_minutes = datetime.timedelta(seconds=5*60) five_minutes_from_now = datetime.datetime.now() + five_minutes since_epoch = five_minutes_from_now - epoch return since_epoch.days * seconds_in_a_day + since_epoch.seconds Is there a module or function that does the timestamp conversion for me?

    Read the article

  • C# Create Values in Registry Local Machine

    - by Shahmir Javaid
    This is not working for me: public bool createRegistry() { if (!registryExists()) { Microsoft.Win32.Registry.LocalMachine.CreateSubKey("Software\\xelo\\"); Microsoft.Win32.Registry.LocalMachine.OpenSubKey("Software\\xelo").SetValue("hostname", (string)hostname, Microsoft.Win32.RegistryValueKind.String); return true; } else { return updateRegistry(); } } The exception error is to do with Not Authorized to do this. Any Help would be apreaciated Exeption: System.UnauthorizedAccessException | "Cannot write to the registry key"

    Read the article

  • Calling and writing jquery/javascript functions

    - by Ankur
    I think I have not got the syntax correct for writing a javascript function and calling it to assign its return value to a variable. My function is: getObjName(objId){ var objName =""; $.ajax( { type : "GET", url : "Object", dataType: 'json', data : "objId="+objId, success : function(data) { objName = data; } }); return objName; } I am trying to call it and assign it to a variable with: var objName = getObjName(objId); However Eclipse is telling me that "the function getObjName(any) is undefined"

    Read the article

  • A* algorithm works OK, but not perfectly. What's wrong?

    - by Bart van Heukelom
    This is my grid of nodes: I'm moving an object around on it using the A* pathfinding algorithm. It generally works OK, but it sometimes acts wrongly: When moving from 3 to 1, it correctly goes via 2. When going from 1 to 3 however, it goes via 4. When moving between 3 and 5, it goes via 4 in either direction instead of the shorter way via 6 What can be wrong? Here's my code (AS3): public static function getPath(from:Point, to:Point, grid:NodeGrid):PointLine { // get target node var target:NodeGridNode = grid.getClosestNodeObj(to.x, to.y); var backtrace:Map = new Map(); var openList:LinkedSet = new LinkedSet(); var closedList:LinkedSet = new LinkedSet(); // begin with first node openList.add(grid.getClosestNodeObj(from.x, from.y)); // start A* var curNode:NodeGridNode; while (openList.size != 0) { // pick a new current node if (openList.size == 1) { curNode = NodeGridNode(openList.first); } else { // find cheapest node in open list var minScore:Number = Number.MAX_VALUE; var minNext:NodeGridNode; openList.iterate(function(next:NodeGridNode, i:int):int { var score:Number = curNode.distanceTo(next) + next.distanceTo(target); if (score < minScore) { minScore = score; minNext = next; return LinkedSet.BREAK; } return 0; }); curNode = minNext; } // have not reached if (curNode == target) break; else { // move to closed openList.remove(curNode); closedList.add(curNode); // put connected nodes on open list for each (var adjNode:NodeGridNode in curNode.connects) { if (!openList.contains(adjNode) && !closedList.contains(adjNode)) { openList.add(adjNode); backtrace.put(adjNode, curNode); } } } } // make path var pathPoints:Vector.<Point> = new Vector.<Point>(); pathPoints.push(to); while(curNode != null) { pathPoints.unshift(curNode.location); curNode = backtrace.read(curNode); } pathPoints.unshift(from); return new PointLine(pathPoints); } NodeGridNode::distanceTo() public function distanceTo(o:NodeGridNode):Number { var dx:Number = location.x - o.location.x; var dy:Number = location.y - o.location.y; return Math.sqrt(dx*dx + dy*dy); }

    Read the article

  • asp.net mvc How to test controllers correctly

    - by Simon G
    Hi, I'm having difficulty testing controllers. Original my controller for testing looked something like this: SomethingController CreateSomethingController() { var somethingData = FakeSomethingData.CreateFakeData(); var fakeRepository = FakeRepository.Create(); var controller = new SomethingController(fakeRepository); return controller; } This works fine for the majority of testing until I got the Request.IsAjaxRequest() part of code. So then I had to mock up the HttpContext and HttpRequestBase. So my code then changed to look like: public class FakeHttpContext : HttpContextBase { bool _isAjaxRequest; public FakeHttpContext( bool isAjaxRequest = false ) { _isAjaxRequest = isAjaxRequest; } public override HttpRequestBase Request { get { string ajaxRequestHeader = ""; if ( _isAjaxRequest ) ajaxRequestHeader = "XMLHttpRequest"; var request = new Mock<HttpRequestBase>(); request.SetupGet( x => x.Headers ).Returns( new WebHeaderCollection { {"X-Requested-With", ajaxRequestHeader} } ); request.SetupGet( x => x["X-Requested-With"] ).Returns( ajaxRequestHeader ); return request.Object; } } private IPrincipal _user; public override IPrincipal User { get { if ( _user == null ) { _user = new FakePrincipal(); } return _user; } set { _user = value; } } } SomethingController CreateSomethingController() { var somethingData = FakeSomethingData.CreateFakeData(); var fakeRepository = FakeRepository.Create(); var controller = new SomethingController(fakeRepository); ControllerContext controllerContext = new ControllerContext( new FakeHttpContext( isAjaxRequest ), new RouteData(), controller ); controller.ControllerContext = controllerContext; return controller; } Now its got to that stage in my controller where I call Url.Route and Url is null. So it looks like I need to start mocking up routes for my controller. I seem to be spending more time googling on how to fake/mock objects and then debugging to make sure my fakes are correct than actual writing the test code. Is there an easier way in to test a controller? I've looked at the TestControllerBuilder from MvcContrib which helps with some of the issues but doesn't seem to do everything. Is there anything else available that will do the job and will let me concentrate on writing the tests rather than writing mocks? Thanks

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • What is the best way to create related types at runtime?

    - by SniperSmiley
    How do I determine the type of a class that is related to another class at runtime? I have figured out a solution, the only problem is that I ended up having to use a define that has to be used in all of the derived classes. Is there a simpler way to do this that doesn't need the define or a copy paste? Things to note: both the class and the related class will always have their respective base class, the different classes can share a related class, and as in the example I would like the control class to own the view. #include <iostream> #include <string> class model; class view { public: view( model *m ) {} virtual std::string display() { return "view"; } }; #define RELATED_CLASS(RELATED)\ typedef RELATED relatedType;\ virtual relatedType*createRelated(){\ return new relatedType(this);} class model { public: RELATED_CLASS(view) model() {} }; class otherView : public view { public: otherView( model *m ) : view(m) {} std::string display() { return "otherView"; } }; class otherModel : public model { public: RELATED_CLASS(otherView) otherModel() {} }; class control { public: control( model *m ) : m_(m), v_( m->createRelated() ) {} ~control() { delete v_; } std::string display() { return v_->display(); } model *m_; view *v_; }; int main( void ) { model m; otherModel om; model *pm = &om; control c1( &m ); control c2( &om ); control c3( pm ); std::cout << c1.display() << std::endl; std::cout << c2.display() << std::endl; std::cout << c3.display() << std::endl; }

    Read the article

  • How to stop looking in a database after X rows are found?

    - by morningface
    I have a query to a database that returns a number X of results. I am looking to return a maximum of 10 results. Is there a way to do this without using LIMIT 0,9? I'll use LIMIT if I have to, but I'd rather use something else that will literally stop the searching, rather than look at all rows and then only return the top 10.

    Read the article

  • Postgres Stored procedure using iBatis

    - by Om Yadav
    --- The error occurred while applying a parameter map. --- Check the newSubs-InlineParameterMap. --- Check the statement (query failed). --- Cause: org.postgresql.util.PSQLException: ERROR: wrong record type supplied in RETURN NEXT Where: PL/pgSQL function "getnewsubs" line 34 at return next the function detail is as below.... CREATE OR REPLACE FUNCTION getnewsubs(timestamp without time zone, timestamp without time zone, integer) RETURNS SETOF record AS $BODY$declare v_fromdt alias for $1; v_todt alias for $2; v_domno alias for $3; v_cursor refcursor; v_rec record; v_cpno bigint; v_actno int; v_actname varchar(50); v_actid varchar(100); v_cpntypeid varchar(100); v_mrp double precision; v_domname varchar(100); v_usedt timestamp without time zone; v_expirydt timestamp without time zone; v_createdt timestamp without time zone; v_ctno int; v_phone varchar; begin open v_cursor for select cpno,c.actno,usedt from cpnusage c inner join account s on s.actno=c.actno where usedt = $1 and usedt < $2 and validdomstat(s.domno,v_domno) order by c.usedt; fetch v_cursor into v_cpno,v_actno,v_usedt; while found loop if isactivation(v_cpno,v_actno,v_usedt) IS TRUE then select into v_actno,v_actname,v_actid,v_cpntypeid,v_mrp,v_domname,v_ctno,v_cpno,v_usedt,v_expirydt,v_createdt,v_phone a.actno,a.actname as name,a.actid as actid,c.descr as cpntypeid,l.mrp as mrp,s.domname as domname,c.ctno as ctno,b.cpno,b.usedt,b.expirydt,d.createdt,a.phone from account a inner join cpnusage b on a.actno=b.actno inner join cpn d on b.cpno=d.cpno inner join cpntype c on d.ctno=c.ctno inner join ssgdom s on a.domno=s.domno left join price_class l ON l.price_class_id=b.price_class_id where validdomstat(a.domno,v_domno) and b.cpno=v_cpno and b.actno=v_actno; select into v_rec v_actno,v_actname,v_actid,v_cpntypeid,v_mrp,v_domname,v_ctno,v_cpno,v_usedt,v_expirydt,v_createdt,v_phone; return next v_rec; end if; fetch v_cursor into v_cpno,v_actno,v_usedt; end loop; return ; end;$BODY$ LANGUAGE 'plpgsql' VOLATILE; ALTER FUNCTION getnewsubs(timestamp without time zone, timestamp without time zone, integer) OWNER TO radius If i am running the function from the console it is running fine and giving me the correct response. But when using through java causing the above error. Can ay body help in it..Its very urgent. Please response as soon as possible. Thanks in advance.

    Read the article

< Previous Page | 251 252 253 254 255 256 257 258 259 260 261 262  | Next Page >