Search Results

Search found 20336 results on 814 pages for 'connection strings'.

Page 258/814 | < Previous Page | 254 255 256 257 258 259 260 261 262 263 264 265  | Next Page >

• Get the top nth values from a rectangular array

  - by user355925

  I am reading a txt file for strings that represent integers. The file is space delimited. I have created an array[10,2]. Everytime the strings 1~10 is found in the file I increment array[n,0] by 1. I also feed array[n,1] with numbers 1~10. i.e. txt file contents: 1/1/1 10/1/2001 1 1 10 2 2 3 1 5 10 word word 3 3 etc.. streamreader reads 1/1/1 and determines that is is not 1~10 streamreader reads 10/1/2001 and determines that it is not 1~10 streamreader reads 1 and ++array[0,0] streamreader reads 1 and ++array[0,0] streamreader reads 10 and ++array[9,0] etc.. The result will be: '1' was found 3 times '2' was found 2 times '3' was found 3 times '5' was found 1 time '10' was found 2 times My problem is that I need this array placed in order(sorted) by value of column 0 so that it would be: 1 3 2 10 5

  Read the article

• What's the most efficient way to check for duplicates in an array of data using Perl?

  - by teukkam

  I need to see if there are duplicates in an array of strings, what's the most time-efficient way of doing it?

  Read the article

• Pass variable number of variables to a class in PHP

  - by user325282

  I need to pass a variable number of strings to instantiate different classes. I can always do a switch on the size of the array: switch(count($a)) { case 1: new Class(${$a[0]}); break; case 2: new Class(${$a[0]}, ${$a[1]}); break; etc... There has to be a better way to do this. If I have an array of strings ("variable1", "variable2", 'variable3", ...), how can I instantiate a Class without manually accounting for every possibility?

  Read the article

• Map a property in the entity framework to a different type

  - by Tom

  I have a SQL Server 2008 database. I have a bunch of fields in TableA that are just strings that corresponds to booleans. So every value is either true or false. The edmx I generated using Entity Framework 4.0 has them as strings. This is technically correct but I would like to have them mapped as Booleans instead. Is this possible? If so how can I accomplish this? Thanks much!

  Read the article

• In-memory data structure that supports boolean querying

  - by sanity

  I need to store data in memory where I map one or more key strings to an object, as follows: "green", "blue" -> object1 "red", "yellow" -> object2 I need to be able to efficiently receive a list of objects, where the strings match some boolean criteria, such as: ("red" OR "green") AND NOT "blue" I'm working in Java, so the ideal solution would be an off-the-shelf Java library. I am, however, willing to implement something from scratch if necessary. Anyone have any ideas? I'd rather avoid the overhead of an in-memory database if possible, I'm hoping for something comparable in speed to a HashMap (or at least the same order of magnitude).

  Read the article

• What's the most efficient way to check for duplicates in and array of data, using Perl?

  - by teukkam

  I need to see if there are duplicates in an array of strings, what's the most time-efficient way of doing it?

  Read the article

• How to convert string to integer?

  - by user1260584

  So I'm having a hard time with my situation and need some advice. I'm trying to convert my two Strings that I have into integers, so that I can use them in math equations. Here is what I tried, however it brings me an error in the app. ' equals.setOnClickListener(new View.OnClickListener() { public void onClick(View arg0) { // TODO Auto-generated method stub num1 = edit.getText().toString(); num2 = edit.getText().toString(); int first = Integer.parseInt(num1); int second = Integer.parseInt(num2); edit.setText(first + second); } }); Is there something that I am doing wrong? Thank you for any help. EDIT: Yes this is Java. num1 and num2 are strings that I have previously named. What do you mean by trim?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• Using varible in re.match in python

  - by screwuphead

  I am trying to create an array of things to match in a description line. So I cant ignore them later on in my script. Below is a sample script that I have been working on, on the side. Basically I am trying to take a bunch of strings and match it against a bunch of other strings. AKA: asdf or asfs or wrtw in string = true continue with script if not print this. import re ignorelist = ['^test', '(.*)set'] def guess(a): for ignore in ignorelist: if re.match(ignore, a): return('LOSE!') else: return('WIN!') a = raw_input('Take a guess: ') print guess(a) Thanks

  Read the article

• Selecting dictionary items by key efficiently in Python

  - by user248237

  suppose I have a dictionary whose keys are strings. How can I efficiently make a new dictionary from that which contains only the keys present in some list? for example: # a dictionary mapping strings to stuff mydict = {'quux': ..., 'bar': ..., 'foo': ...} # list of keys to be selected from mydict keys_to_select = ['foo', 'bar', ...] The way I came up with is: filtered_mydict = [mydict[k] for k in mydict.keys() \ if k in keys_to_select] but I think this is highly inefficient because: (1) it requires enumerating the keys with keys(), (2) it requires looking up k in keys_to_select each time. at least one of these can be avoided, I would think. any ideas? I can use scipy/numpy too if needed.

  Read the article

• How to test Language DLLs?

  - by EKI

  Our application offer the user to display different languages if they have the approppriate Language DLL (say German.DLL, French.DLL, even Chinese.DLL). We have functional test to verify that those DLLs enable the right options in a Combobox and that choosing them will actually translate strings in the UI. I would like to know options to test this translation dll's more in depth, maybe ensuring that all the characters in the selected langauge (and in the file) can be correctly displayed, or that the internal structure of the DLL is consistent, there are no strings exceeding the limits that are expected of them, etc... Any suggestions on what to test and how to test it? Does anyone know specific problems that may arise and we should check? Thanks in advance.

  Read the article

• .NET Regex - need matching string for parsing...

  - by TomTom

  Hello, I am a regex idiot and never found a good tutorial (links welcome, as well as a pointer to an interactive VS2010 integrated editor). I need to parse strings in the following form: [a/b]:c/d a, b: double with "." as possible separator. CAN be empty c: double with "." as separator d: integer, positive I.e. valid strings are: [/]:0.25/2 [-0.5/0.5]:0.05/2 [/0.1]:0.05/2 ;) Anyone can help? Thanks

  Read the article

• Is there a way to create a string that matches a given C# regex?

  - by Chris Phillips

  My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

  Read the article

• C#: Resource file refactoring

  - by Svish

  Does anyone know of a good tool for refactoring resources in a visual studio 2008 solution? We have a number of resource files with translated text in an assembly used for localizing our application. But they have gotten a bit messy... I would like to rename some of the keys, and move some of them into other resource files. And I would like those changes be done in my code, and the translated versions of the resource files as well. Maybe a some analysis on what strings are missing in the translated versions, and what strings have been removed from the original as well... Does anyone know of a good visual studio extension or ReSharper plugin that can help me with this? Right now it is kind of a pain, because I have to first rename the key in the base resource file, then in the localized versions. And then compile to get all the compile errors resulting from the key which now have a different name, and then go through and fix them all... very annoying =/

  Read the article

• construct a unique number for a string in java

  - by praveen

  We have a requirement of reading/writing more than 10 million strings into a file. Also we do not want duplicates in the file. Since the strings would be flushed to a file as soon as they are read we are not maintaining it in memory. We cannot use hashcode because of collisions in the hash code due to which we might miss a string as duplicate. Two other approaches i found in my googling: 1.Use a message digest algorithm like MD5 - but it might be too costly to calculate and store. 2.Use a checksum algorithm. [i am not sure if this produces a unique key for a string- can someone please confirm] Is there any other approach avaiable. Thanks.

  Read the article

• RESTful enums. string or Id?

  - by GazTheDestroyer

  I have a RESTful service that exposes enums. Should I expose them as localised strings, or plain integers? My leaning is toward integers for easy conversion at the service end, but in that case the client needs to grab a list of localised strings from somewhere in order to know what the enums mean. Am I just creating extra steps for nothing? There seems to be little information I can find about which is commonly done in RESTful APIs. EDIT: OK. Let's say I'm writing a website that stores information about people's pets. I could have an AnimalType enum 0 Dog 1 Cat 2 Rabbit etc. When people grab a particular pet resource, say /pets/1, I can either provide a meaningful localised string for the animal type, or just provide the ID and force them to do another look up via a /pets/types resource. Or should I provide both?

  Read the article

• StringArray and StringBuilder Class

  - by picnic4u

  can we append StringBuilder class Strings in String Array's string in asp.net?

  Read the article

• foreach statement (get string values)

  - by nhoyti

  Can someone please help me out? My code for splitting the strings is working however, i still need to use the splitted string my page. How can i achieve this? Here's my current code private void SplitStrings() { List<string> listvalues = new List<string>(); listvalues = (List<string>)Session["mylist"]; string[] strvalues = listvalues.ToArray(); if (listvalues != null) { foreach (string strElement in listvalues) { string[] prods = strElement.ToString().Split("|".ToCharArray()); string prodName = prods[0].ToString(); Response.Write(prodName); } } } link text how can i replace the response.write with any label or literal? when i tried to use a literal on the code it displays one single string not all of the strings that's been splitted. any ideas?

  Read the article

• Referencing an XML string in an XML Array (Android)

  - by jax

  in arrays.xml <string-array name="my_items"> <item>My item 1</item> <item>My item 2</item> <item>My item 3</item> </string-array> in strings.xml <resources> <string name="item1">My item 1</string> <string name="item2">My item 2</string> <string name="item3">My item 3</string> </resources> I would like to reference the string in the array "My item 1" from strings.xml. How do I do that?

  Read the article

• String manipulation appears to be inefficient

  - by user2964780

  I think my code is too inefficient. I'm guessing it has something to do with using strings, though I'm unsure. Here is the code: genome = FASTAdata[1] genomeLength = len(genome); # Hash table holding all the k-mers we will come across kmers = dict() # We go through all the possible k-mers by index for outer in range (0, genomeLength-1): for inner in range (outer+2, outer+22): substring = genome[outer:inner] if substring in kmers: # if we already have this substring on record, increase its value (count of num of appearances) by 1 kmers[substring] += 1 else: kmers[substring] = 1 # otherwise record that it's here once This is to search through all substrings of length at most 20. Now this code seems to take pretty forever and never terminate, so something has to be wrong here. Is using [:] on strings causing the huge overhead? And if so, what can I replace it with? And for clarity the file in question is nearly 200mb, so pretty big.

  Read the article

• extract two parts of a string using regex in php

  - by Jubair

  Ok so I have this string: &lt;img src=images/imagename.gif alt='descriptive text here'&gt; and I am trying to split it up into the following two strings (array of two strings, what ever, just broken up). imagename.gif descriptive text here Note yes, its' actually the & lt; and not < same with the closing on the string. I know regex is the answer, but not the best at regext to know to pull it off in php.

  Read the article

• A puzzle coded in ASCII [closed]

  - by user1905398

  I'm asking this question again because it is valid: "How do I convert this: M D Y z M D Y w M D Y z M D Y x M D Y z M D Y w M D Y z M D Y w M D Y z M D Y w M D Y z M D Y x M D Y z M D Y x M D Y z M D Y w into a letter? I have 272 constructed just like this one that I need to convert to form the message in a mystery I'm trying to solve. Thanks!" It is very difficult to include all 272 strings with each one having 16 sets of 4! There wouldn't be enough room in this post for that, so I just put the first of the 272 strings. To hopefully clarify, this is a puzzle. The puzzler put his 272 word message in ASCII. Since there is no online converter, I put the question out hoping to get some help.

  Read the article

• SSTP client disconnects shortly after successfully connected to VPN

  - by Eran Betzalel

  I'm successfully authenticating and connecting to a SSTP VPN (on windows 2008) from my windows 7 machine, but for some reason, the connection is disconnected about a 1-2 seconds after it's established. I've done the following: Defined a SSTP VPN on my windows server 2008. Defined the same machine as CA. Issued the needed certificates and published them on the client. I'm currently testing this VPN inside my LAN so all the needed ports are opened. Here are the event log entries when trying to connect: Error Log (Client): The user HOME\User dialed a connection named Home VPN which has terminated. The reason code returned on termination is 829. Error Log (Server-VPN): The user HOME\User connected on port VPN0-0 on 7/27/2012 at 1:57 AM and disconnected on 7/27/2012 at 1:57 AM. The user was active for 0 minutes 0 seconds. 312 bytes were sent and 4528 bytes were received. The reason for disconnecting was user request. What would be the issue? How can I resolve or debug it? UPDATE: I've found an event log (Log=System, Source=RasSstp) message on the windows 7 machine that tries to connect to the VPN: The SSTP-based VPN connection to the remote access server was terminated because of a security check failure. Security settings on the remote access server do not match settings on this computer. Contact the system administrator of the remote access server and relay the following information: SHA1 Certificate Hash: 065D681...520375552F SHA256 Certificate Hash: 18DED363...EEEE28CFD00

  Read the article

• Cannot connect with Cisco VPN but can connect with ShrewSoft VPN

  - by rodey

  EDIT: We connected an air card to the computer to use a different Internet connection and using the Cisco software, we were able to successfully connect to our VPN server. I just don't understand why the ShrewSoft VPN client would connect but the Cisco connection won't. I'm not our network admin so sorry if I butcher some of the terminology. I have a computer at remote site that connects to our network through Cisco VPN. It uses the Cisco VPN software to do so. The problem is that the computer at this site cannot connect to our VPN because it is getting error "Reason 412: The remote peer is no longer responding." To see if perhaps something on their network was blocking the connection, I installed the ShrewSoft VPN client on the computer, imported our .pcf file and connected with no problem. I have tried two different versions of the Cisco VPN software (4.8.0.* and 5.0.03.*) and have the same problem. I installed Wireshark on the computer and have confirmed (while trying to connect through Cisco) that the computer is trying to contact the VPN server but is not receiving a response. We are not having any other problems regarding users not being able to connect. I'm at a loss at what else to check. I'll be monitoring this and have access to the computer at any time.

  Read the article

• SSH error 114 when connect with FinalBuilder 7

  - by mamcx

  I'm testing FB 7 and try to connect to my Mac OS X Snow Leopard machine. I can connect with paramiko (python SSH library) but not FB7. The only thing I get is: SSH error encoutered: 114 I try stopping & restarting the share session on Mac OS X. update: I enable server debug and get this log: debug1: sshd version OpenSSH_5.2p1 debug1: read PEM private key done: type RSA debug1: private host key: #0 type 1 RSA debug1: read PEM private key done: type DSA debug1: private host key: #1 type 2 DSA debug1: rexec_argv[0]='/usr/sbin/sshd' debug1: rexec_argv[1]='-Dd' debug1: Bind to port 22 on ::. Server listening on :: port 22. debug1: Bind to port 22 on 0.0.0.0. Server listening on 0.0.0.0 port 22. debug1: fd 5 clearing O_NONBLOCK debug1: Server will not fork when running in debugging mode. debug1: rexec start in 5 out 5 newsock 5 pipe -1 sock 8 debug1: inetd sockets after dupping: 3, 3 Connection from 10.3.7.135 port 49457 debug1: Client protocol version 2.0; client software version SecureBlackbox.8 debug1: no match: SecureBlackbox.8 debug1: Enabling compatibility mode for protocol 2.0 debug1: Local version string SSH-2.0-OpenSSH_5.2 debug1: privsep_preauth: successfully loaded Seatbelt profile for unprivileged child debug1: permanently_set_uid: 75/75 debug1: list_hostkey_types: ssh-rsa,ssh-dss debug1: SSH2_MSG_KEXINIT sent debug1: SSH2_MSG_KEXINIT received debug1: kex: client->server aes128-ctr [email protected] none debug1: kex: server->client aes128-ctr [email protected] none debug1: expecting SSH2_MSG_KEXDH_INIT debug1: SSH2_MSG_NEWKEYS sent debug1: expecting SSH2_MSG_NEWKEYS debug1: SSH2_MSG_NEWKEYS received debug1: KEX done debug1: userauth-request for user mamcx service ssh-connection method none debug1: attempt 0 failures 0 debug1: PAM: initializing for "mamcx" Connection closed by 10.3.7.135 debug1: do_cleanup debug1: PAM: setting PAM_RHOST to "10.3.7.135" debug1: do_cleanup debug1: PAM: cleanup debug1: audit_event: unhandled event 12

  Read the article

< Previous Page | 254 255 256 257 258 259 260 261 262 263 264 265  | Next Page >