Search Results

Search found 32731 results on 1310 pages for 'regex for html'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 258/1310 | < Previous Page | 254 255 256 257 258 259 260 261 262 263 264 265  | Next Page >

  • How can I improve this regular expression?

    - by Michael Haren
    I want a regular expression to match valid input into a Tags input field with the following properties: 1-5 tags Each tag is 1-30 characters long Valid tag characters are [a-zA-Z0-9-] input and tags can be separated by any amount of whitespace Here's what I have so far--it seems to work but I'm interested how it could be simplified or if it has any major flaws: \s*[a-zA-Z0-9-]{1,30}(\s+[a-zA-Z0-9-]{1,30}){0,4}\s* // that is: \s* // match all beginning whitespace [a-zA-Z0-9-]{1,30} // match the first tag (\s+[a-zA-Z0-9-]{1,30}){0,4} // match all subsequent tags \s* // match all ending whitespace Preprocessing the input to make the whitespace issue easier isn't an option (e.g. trimming or adding a space). If it matters, this will be used in javascript. Any suggestions would be appreciated, thanks!

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • Apply a class to a <h1> based on the site url

    - by user1870639
    I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

    Read the article

  • java - check if string ends with certain pattern

    - by The Learner
    I have string like: This.is.a.great.place.too.work. (or) This/is/a/great/place/too/work/ than my java program should give me that the sentence is valid and it has "work". if i Have : This.is.a.great.place.too.work.hahahha (or) This/is/a/great/place/too/work/hahahah Should not give me that there is a work in the sentance. so I am looking at java strings to find a word at the end of the sentance having . (or),(or)/ before it. How can I achieve that

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • How to match a variable list of items separated by commas

    - by user261915
    I want to turn something like this CS 240, CS 246, ECE 222, ... (more or less); Software Engineering students only into ('CS 240', 'CS 246', 'ECE 222', 'ECE 220') in Python, code that matches a single course looks like >>> re.search('([A-Z]{2,5} \d{3})', 'SE 112').groups() ('SE 112',) I prefer a regular expression only method because I have a bunch of other alternate reg exps using '|' to combine them. However, a method with split is acceptable.

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • [Qt] Check octal number

    - by sterh
    Hello, I write simple application in C++/Qt. And i have a text and some octal number in it. My app splits this text by spaces. And i need to check octal numbers from text. How can i select octal numbers from this text with regular expressions? Thank you.

    Read the article

  • Need some help setting up subdomains for my site

    - by KarimSaNet
    I'm setting up my website and want to have it so all subdomain requests are rewritten to the appropriate subdirectory. For example http://projects.karimsa.net/ -> http://karimsa.net/projects/ But I want to use the Apache rewrite mod to do this so that the URL in the browser stays the same. Here is what my config looks like at the moment: ## rewrite subdomains RewriteEngine On RewriteCond %{HTTP_HOST} ^(.*).karimsa.net RewriteCond %{HTTP_HOST} !^www.karimsa.net [NC] RewriteRule ^(.*)$ http://karimsa.net/%1/$1 [R=301,L] And my CNAME records on 'projects.karimsa.net': Domain TTL Data Type projects.karimsa.net 14400 karimsa.net CNAME Theoretically, I feel this should work. But when I go to the URL, it gives me a server misconfiguration error, my provider's default webpage. What I should see is the index.php under /projects/. What am I doing wrong? Any help would be appreciated, thanks for reading. Addition: I realized I forgot to mention some of the problem. The domain 'karimsa.net' is parked at 'karimsa.x10.mx'. If I set up the same configuration on 'projects.karimsa.x10.mx', the rewrite and CNAME work. But on the parked domain I still get the default webpage.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • python and regular expression with unicode

    - by bsn
    I need to delete some unicode symbols from the string '?????? ??????? ???????????? ??????????' I know they exist here for sure. I try: re.sub('([\u064B-\u0652\u06D4\u0670\u0674\u06D5-\u06ED]+)', '', '?????? ??????? ???????????? ??????????') but it doesn't work. String stays the same. ant suggestion what i do wrong?

    Read the article

  • Regular Expression

    - by Blanca
    Hi! i would like to avoid texts like this one: height="49" with a regular expresion. I tought in .replaceAll("\s*="*"",""); (replaceAll is used as a method in a java class), but eclipse don't allowed me to do that. Any other suggestion?? tx!

    Read the article

  • Using varible in re.match in python

    - by screwuphead
    I am trying to create an array of things to match in a description line. So I cant ignore them later on in my script. Below is a sample script that I have been working on, on the side. Basically I am trying to take a bunch of strings and match it against a bunch of other strings. AKA: asdf or asfs or wrtw in string = true continue with script if not print this. import re ignorelist = ['^test', '(.*)set'] def guess(a): for ignore in ignorelist: if re.match(ignore, a): return('LOSE!') else: return('WIN!') a = raw_input('Take a guess: ') print guess(a) Thanks

    Read the article

  • Regular expression one or more times JAVA

    - by user1381564
    Hi i am trying to match a string against a pattern this is the possible string signal CS, NS, dl: stateType := writeOrRead0; signal CS, pS : stateType := writeOrRead0; signal dS : stateType := writeOrRead0; i am only concerned with the pattern as far as the first colon. but the number of signals define can be more than one it could be three or four even this is the regular expression i have ^signal\\s*(\\w+),*\\s*(\\w+)\\s*: it will pick up the second two signal but and for the second one it picks up CS and pS and but the d and S in the next signal when i use matcher.group() come up seperately Can anyone give me an expression that will pick up all signal names whether there is one two three or more?

    Read the article

  • dropping characters from regular expression groups

    - by tcurdt
    The goal: I want to convert a number from the format "10.234,56" to "10234.56" Using this simple approach almost gets us there /([\d\.]+),(\d\d)/ => '\1.\2' The problem is that the first group of the match (of course) still contains the '.' character. So questions are: Is it possible to exclude a character from the group somehow? How would you solve this with a single regexp (I know this is a trivial problem when not using a single regexp)

    Read the article

  • Return HTML from a user selection

    - by Cruinh
    I have the following, very simple html page... <html> <head> <script type="text/javascript"> function alertSelection() { var selection = window.getSelection(); var txt = selection.toString(); alert(txt); } </script> </head> <body> This is <span style="background-color:black;color:white">the</span> text. <div style="background-color:green;width:30px;height:30px;margin:30px" onmouseover="alertSelection()"> </body> </html> When I select the entire first line and mouseover the square, I get an alert with "This is the text.". How would I fix this so the the span tag or any other selected HTML isn't stripped out of the alert message?

    Read the article

  • Need to add specific characters to regular expression

    - by lordryan
    i'm using the following regular expression to form a basic email validation. var emailRegEx = /^([a-zA-Z0-9])(([a-zA-Z0-9])*([\._\+-])*([a-zA-Z0-9]))*@(([a-zA-Z0-9\-])+(\.))+([a-zA-Z]{2,4})+$/; this works pretty well for what i need but i also need to exclude these specific characters for reasons i won't go into. !,#,$,%,^,&,*,(,),-,+,|,{,},[,],:,>,<,?,/,\,= - (the characters between the "," if that isn't clear) could someone help me with adding the second group to the first? I know the pro's and cons of using javascript to validate email addresses - i have to do it this way. thanks.

    Read the article

  • regular expression - function body extracting

    - by Altariste
    Hi, In Python script,for every method definition in some C++ code of the form: return_value ClassName::MethodName(args) {MehodBody} ,I need to extract three parts: the class name, the method name and the method body for further processing. Finding and extracting the ClassName and MethodName is easy, but is there any simple way to extract the body of the method? With all possible '{' and '}' inside it? Or are regexes unsuitable for such task?

    Read the article

  • Position a div relative to a top-level container?

    - by Seifeddine Dridi
    I'm trying to model an HTML document which only contains div elements positioned in absolute. For each div, properties left and top are precalculated wrt. the top-level div, but a problem occurs with nested divs since according to the CSS standard an element is positioned relative to its first ancestral element whose positioning is either relative or absolute. Does anyone know any workaround? EDIT: small code snippet that demonstrates the problem <html> <body style="background-color: #444444"> <div style="position: relative; background-color: white;"> <div style="position: absolute; background-color: red; width: 4cm; height: 3cm; top: 1cm">div 1 <div style="position: absolute; background-color: green; top: 4cm"> div 1.1</div> </div> </div> </body> </html> The green div is expected to be positioned right after the red div, instead there is a gap of 1cm in between.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 254 255 256 257 258 259 260 261 262 263 264 265  | Next Page >