Search Results

Search found 6992 results on 280 pages for 'exist'.

Page 260/280 | < Previous Page | 256 257 258 259 260 261 262 263 264 265 266 267  | Next Page >

  • Why is my namespace not recognized in Visual Studio / xaml

    - by msfanboy
    Hello, these are my 2 classes a Attachable Property SelectedItems: code is from here: http://stackoverflow.com/questions/1297643/sync-selecteditems-in-a-muliselect-listbox-with-a-collection-in-viewmodel The namespace TBM.Helper is for sure proper as it works for other classes too. The namespace reference is also in the xaml file: xmlns:Helper="clr_namespace:TBM.Helper" But <ListBox Helper:SelectedItems.Items="{Binding SelectedItems}" ... does not work because = The property 'SelectedItems.Items' does not exist in XML namespace 'clr_namespace:TBM.Helper'. The attachable property 'Items' was not found in type 'SelectedItems What do I have to change ? using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Windows.Controls; using System.Collections; using System.Windows; namespace TBM.Helper { public static class SelectedItems : DependencyObject { private static readonly DependencyProperty SelectedItemsBehaviorProperty = DependencyProperty.RegisterAttached( "SelectedItemsBehavior", typeof(SelectedItemsBehavior), typeof(ListBox), null); public static readonly DependencyProperty ItemsProperty = DependencyProperty.RegisterAttached( "Items", typeof(IList), typeof(SelectedItems), new PropertyMetadata(null, ItemsPropertyChanged)); public static void SetItems(ListBox listBox, IList list) { listBox.SetValue(ItemsProperty, list); } public static IList GetItems(ListBox listBox) { return listBox.GetValue(ItemsProperty) as IList; } private static void ItemsPropertyChanged(DependencyObject d, DependencyPropertyChangedEventArgs e) { var target = d as ListBox; if (target != null) { GetOrCreateBehavior(target, e.NewValue as IList); } } private static SelectedItemsBehavior GetOrCreateBehavior(ListBox target, IList list) { var behavior = target.GetValue(SelectedItemsBehaviorProperty) as SelectedItemsBehavior; if (behavior == null) { behavior = new SelectedItemsBehavior(target, list); target.SetValue(SelectedItemsBehaviorProperty, behavior); } return behavior; } } } using System.Windows; using System.Windows.Controls; using System.Collections; namespace TBM.Helper { public class SelectedItemsBehavior { private readonly ListBox _listBox; private readonly IList _boundList; public SelectedItemsBehavior(ListBox listBox, IList boundList) { _boundList = boundList; _listBox = listBox; SetSelectedItems(); _listBox.SelectionChanged += OnSelectionChanged; _listBox.DataContextChanged += OnDataContextChanged; } private void SetSelectedItems() { _listBox.SelectedItems.Clear(); foreach (object item in _boundList) { // References in _boundList might not be the same as in _listBox.Items int i = _listBox.Items.IndexOf(item); if (i >= 0) _listBox.SelectedItems.Add(_listBox.Items[i]); } } private void OnDataContextChanged(object sender, DependencyPropertyChangedEventArgs e) { SetSelectedItems(); } private void OnSelectionChanged(object sender, SelectionChangedEventArgs e) { _boundList.Clear(); foreach (var item in _listBox.SelectedItems) _boundList.Add(item); } } }

    Read the article

  • Initialize a Variable Again.

    - by SoulBeaver
    That may sound a little confusing. Basically, I have a function CCard newCard() { /* Used to store the string variables intermittantly */ std::stringstream ssPIN, ssBN; int picker1, picker2; int pin, bankNum; /* Choose 5 random variables, store them in stream */ for( int loop = 0; loop < 5; ++loop ) { picker1 = rand() % 8 + 1; picker2 = rand() % 8 + 1; ssPIN << picker1; ssBN << picker2; } /* Convert them */ ssPIN >> pin; ssBN >> bankNum; CCard card( pin, bankNum ); return card; } that creates a new CCard variable and returns it to the caller CCard card = newCard(); My teacher advised me that doing this is a violation of OOP principles and has to be put in the class. He told me to use this method as a constructor. Which I did: CCard::CCard() { m_Sperre = false; m_Guthaben = rand() % 1000; /* Work */ /* Convert them */ ssPIN >> m_Geheimzahl; ssBN >> m_Nummer; } All variables with m_ are member variables. However, the constructor works when I initialize the card normally CCard card(); at the start of the program. However, I also have a function, that is supposed to create a new card and return it to the user, this function is now broken. The original command: card = newCard(); isn't available anymore, and card = new CCard(); doesn't work. What other options do I have? I have a feeling using the constructor won't work, and that I probably should just create a class method newCard, but I want to see if it is somehow at all possible to do it the way the teacher wanted. This is creating a lot of headaches for me. I told the teacher that this is a stupid idea and not everything has to be classed in OOP. He has since told me that Java or C# don't allow code outside of classes, which sounds a little incredible. Not sure that you can do this in C++, especially when templated functions exist, or generic algorithms. Is it true that this would be bad code for OOP in C++ if I didn't force it into a class?

    Read the article

  • Best way to test for a variable's existence in PHP; isset() is clearly broken

    - by chazomaticus
    From the isset() docs: isset() will return FALSE if testing a variable that has been set to NULL. Basically, isset() doesn't check for whether the variable is set at all, but whether it's set to anything but NULL. Given that, what's the best way to actually check for the existence of a variable? I tried something like: if(isset($v) || @is_null($v)) (the @ is necessary to avoid the warning when $v is not set) but is_null() has a similar problem to isset(): it returns TRUE on unset variables! It also appears that: @($v === NULL) works exactly like @is_null($v), so that's out, too. How are we supposed to reliably check for the existence of a variable in PHP? Edit: there is clearly a difference in PHP between variables that are not set, and variables that are set to NULL: <?php $a = array('b' => NULL); var_dump($a); PHP shows that $a['b'] exists, and has a NULL value. If you add: var_dump(isset($a['b'])); var_dump(isset($a['c'])); you can see the ambiguity I'm talking about with the isset() function. Here's the output of all three of these var_dump()s: array(1) { ["b"]=> NULL } bool(false) bool(false) Further edit: two things. One, a use case. An array being turned into the data of an SQL UPDATE statement, where the array's keys are the table's columns, and the array's values are the values to be applied to each column. Any of the table's columns can hold a NULL value, signified by passing a NULL value in the array. You need a way to differentiate between an array key not existing, and an array's value being set to NULL; that's the difference between not updating the column's value and updating the column's value to NULL. Second, Zoredache's answer, array_key_exists() works correctly, for my above use case and for any global variables: <?php $a = NULL; var_dump(array_key_exists('a', $GLOBALS)); var_dump(array_key_exists('b', $GLOBALS)); outputs: bool(true) bool(false) Since that properly handles just about everywhere I can see there being any ambiguity between variables that don't exist and variables that are set to NULL, I'm calling array_key_exists() the official easiest way in PHP to truly check for the existence of a variable. (Only other case I can think of is for class properties, for which there's property_exists(), which, according to its docs, works similarly to array_key_exists() in that it properly distinguishes between not being set and being set to NULL.)

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • How to perform add/update of a model object that contains EntitySet

    - by David Liddle
    I have a similar concept to the SO questions/tags scenario however am trying to decide the best way of implementation. Tables Questions, QuestionTags and Tags Questions QuestionTags Tags --------- ------------ ---- QID QID TID QName TID TName When adding/updating a question I have 2 textboxes. The important part is a single textbox that allows users to enter in multiple Tags separated by spaces. I am using Linq2Sql so the Questions model has an EntitySet of QuestionTags with then link to Tags. My question is regarding the adding/updating of Questions (part 1), and also how to best show QuestionTags for a Question (part 2). Part 1 Before performing an add/update, my service layer needs to deal with 3 scenarios before passing to their respective repositories. Insert Tags that do not already exist Insert/Update Question Insert QuestionTags - when updating need to remove existing QuestionTags Here is my code below however started to get into a bit of a muddle. I've created extension methods on my repositories to get Tags WithNames etc. public void Add(Question q, string tags) { var tagList = tags.Split(new string[] { " " }, StringSplitOptions.RemoveEmptyEntries).ToList(); using (DB.TransactionScope ts = new DB.TransactionScope()) { var existingTags = TagsRepository.Get() .WithName(tagList) .ToList(); var newTags = (from t in tagList select new Tag { TName = t }).Except(existingTags, new TagsComparer()).ToList(); TagsRepository.Add(newTags); //need to insert QuestionTags QuestionsRepository.Add(q); ts.Complete(); } } Part 2 My second question is, when displaying a list of Questions how is it best to show their QuestionTags? For example, I have an Index view that shows a list of Questions in a table. One of the columns shows an image and when the user hovers over it shows the list of Tags. My current implementation is to create a custom ViewModel and show a List of QuestionIndexViewModel in the View. QuestionIndexViewModel { Question Question { get; set; } string Tags { get; set; } } However, this seems a bit clumsy and quite a few DB calls. public ViewResult Index() { var model= new List<QuestionIndexViewModel>(); //make a call to get a list of questions //foreach question make a call to get their QuestionTags, //to be able to get their Tag names and then join them //to form a single string. return View(model); } Also, just for test purposes using SQL Profiler, I decided to iterate through the QuestionTags entity set of a Question in my ViewModel however nothing was picked up in Profiler? What would be the reason for this?

    Read the article

  • Parallel programming in C#

    - by Alxandr
    I'm interested in learning about parallel programming in C#.NET (not like everything there is to know, but the basics and maybe some good-practices), therefore I've decided to reprogram an old program of mine which is called ImageSyncer. ImageSyncer is a really simple program, all it does is to scan trough a folder and find all files ending with .jpg, then it calculates the new position of the files based on the date they were taken (parsing of xif-data, or whatever it's called). After a location has been generated the program checks for any existing files at that location, and if one exist it looks at the last write-time of both the file to copy, and the file "in its way". If those are equal the file is skipped. If not a md5 checksum of both files is created and matched. If there is no match the file to be copied is given a new location to be copied to (for instance, if it was to be copied to "C:\test.jpg" it's copied to "C:\test(1).jpg" instead). The result of this operation is populated into a queue of a struct-type that contains two strings, the original file and the position to copy it to. Then that queue is iterated over untill it is empty and the files are copied. In other words there are 4 operations: 1. Scan directory for jpegs 2. Parse files for xif and generate copy-location 3. Check for file existence and if needed generate new path 4. Copy files And so I want to rewrite this program to make it paralell and be able to perform several of the operations at the same time, and I was wondering what the best way to achieve that would be. I've came up with two different models I can think of, but neither one of them might be any good at all. The first one is to parallelize the 4 steps of the old program, so that when step one is to be executed it's done on several threads, and when the entire of step 1 is finished step 2 is began. The other one (which I find more interesting because I have no idea of how to do that) is to create a sort of worker and consumer model, so when a thread is finished with step 1 another one takes over and performs step 2 at that object (or something like that). But as said, I don't know if any of these are any good solutions. Also, I don't know much about parallel programming at all. I know how to make a thread, and how to make it perform a function taking in an object as its only parameter, and I've also used the BackgroundWorker-class on one occasion, but I'm not that familiar with any of them. Any input would be appreciated.

    Read the article

  • how to refactor user-permission system?

    - by John
    Sorry for lengthy question. I can't tell if this should be a programming question or a project management question. Any advice will help. I inherited a reasonably large web project (1 year old) from a solo freelancer who architected it then abandoned it. The project was a mess, but I cleaned up what I could, and now the system is more maintainable. I need suggestions on how to extend the user-permission system. As it is now, the database has a t_user table with the column t_user.membership_type. Currently, there are 4 membership types with the following properties: 3 of the membership types are almost functionally the same, except for the different monthly fees each must pay 1 of the membership type is a "fake-user" type which has limited access ( different business logic also applies) With regards to the fake-user type, if you look in the system's business logic files, you will see a lot of hard-coded IF statements that do something like if (fake-user) { // do something } else { // a paid member of type 1,2 or 3 // proceed normally } My client asked me to add 3 more membership types to the system, each of them with unique features to be implemented this month, and substantive "to-be-determined" features next month. My first reaction is that I need to refactor the user-permission system. But it concerns me that I don't have enough information on the "to-be-determined" membership type features for next month. Refactoring the user-permission system will take a substantive amount of time. I don't want to refactor something and throw it out the following month. I get substantive feature requests on a monthly basis that come out of the blue. There is no project road map. I've asked my client to provide me with a roadmap of what they intend to do with the new membership types, but their answer is along the lines of "We just want to do [feature here] this month. We'll think of something new next month." So questions that come to mind are: 1) Is it dangerous for me to refactor the user permission system not knowing what membership type features exist beyond a month from now? 2) Should I refactor the user permission system regardless? Or just continue adding IF statements as needed in all my controller files? Or can you recommend a different approach to user permission systems? Maybe role-based ? 3) Should this project have a road map? For a 1 year old project like mine, how far into the future should this roadmap project? 4) Any general advice on the best way to add 3 new membership types?

    Read the article

  • apply style to range of text with javascript in uiwebview

    - by drawnonward
    I am displaying some simple styled text as html in a UIWebView on iPhone. It is basically a series of paragraphs with the occasional strong or emphasized phrase. At runtime I need to apply styles to ranges of text. There are a few similar scenarios, one of which is highlighting search results. If the user has searched for "something" I would like to change the background color behind occurrences of the word, then later restore the original background. Is it possible to apply styles to ranges of text using javascript? A key part of this is also being able to unset the styles. There seem to be two likely paths to follow. One would be modifying some html in Objective-C and passing it through javascript as the new innerHTML of some container. The other would be to use javascript to directly manipulate DOM nodes. I could manipulate html, but that sounds tedious in Objective-C so I would rather manipulate the DOM if that is a reasonable approach. I am not that familiar with javascript and DOM so I do not know if it is a reasonable approach. I wrote some routines to translate between text ranges and node ranges with offsets. So if I start with text range 100-200 and that starts in one paragraph and ends in a third, I can get the text nodes and the offsets within the nodes that represent the given text range. I just need a way to split a text node at an offset in the text. Currently I just apply styles to the paragraphs containing the text range. A few notes: straight javascript please, no external frameworks like jquery. the changes never need to be written to disk. the changes should be undoable or at least removable. the styles to apply already exist in a css file. it needs to work in iPhone 3.0 and forward. all the source files are shipped with the app. please be verbose. Thanks for any suggestions.

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • How to develop a Jquery plugin to find the first child that match with a selector?

    - by Ivan
    I'm trying to make a Jquery plugin (findFirst()) to find the first child with a given characteristics (something in the middle of the find() and children() functions. For instance, given this markup: <div id="start"> <div> <span>Hello world</span> <ul class="valid-result"> ... </ul> <ul class="valid-result"> <li> <ul class="not-a-result"> ... </ul> </li> </ul> <div> <ul class="valid-result"> ... </ul> </div> </div> </div> If you ask for $("#start").findFirst('ul') it should return all ul lists that I have tagged with the valid-result class, but not the ul with class not-a-result. It is, this function has to find the first elements that matches with a given selector, but not the inner elements that match this selector. This is the first time I try to code a Jquery function, and what I've already read doesn't helps me too much with this. The function I have developed is this: jQuery.fn.findFirst = function (sel) { return this.map(function() { return $(this).children().map(function() { if ($(this).is(sel)) { return $(this); } else { return $(this).findFirst(sel); } }); }); } It works in the sense it tries to return the expected result, but the format it returns the result is very rare for me. I suppose the problem is something I don't understand about Jquery. Here you have the JFiddle where I'm testing. EDIT The expected result after $("#start").findFirst('ul') is a set with all UL that have the class 'valid-result' BUT it's not possible to use this class because it doesn't exist in a real case (it's just to try to explain the result). This is not equivalent to first(), because first returns only one element!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Inserting checkbox values

    - by rabeea
    hey i have registration form that has checkboxes along with other fields. i cant insert the selected checkbox values into the data base. i have made one field in the database for storing all checked values. this is the code for checkbox part in the form: Websites, IT and Software Writing and Content <pre><input type="checkbox" name="expertise[]" value="Design and Media"> Design and Media <input type="checkbox" name="expertise[]" value="Data entry and Admin"> Data entry and Admin </pre> <pre><input type="checkbox" name="expertise[]" value="Engineering and Skills"> Engineering and Science <input type="checkbox" name="expertise[]" value="Seles and Marketing"> Sales and Marketing </pre> <pre><input type="checkbox" name="expertise[]" value="Business and Accounting"> Business and Accounting <input type="checkbox" name="expertise[]" value="Others"> Others </pre> and this is the corresponding php code for inserting data $checkusername=mysql_query("SELECT * FROM freelancer WHERE fusername='{$_POST['username']}'"); if (mysql_num_rows($checkusername)==1) { echo "username already exist"; } else { $query = "insert into freelancer(ffname,flname,fgender,femail,fusername,fpwd,fphone,fadd,facc,facc_name,fbank_details,fcity,fcountry,fexpertise,fprofile,fskills,fhourly_rate,fresume) values ('".$_POST['first_name']."','".$_POST['last_name']."','".$_POST['gender']."','".$_POST['email']."','".$_POST['username']."','".$_POST['password']."','".$_POST['phone']."','".$_POST['address']."','".$_POST['acc_num']."','".$_POST['acc_name']."','".$_POST['bank']."','".$_POST['city']."','".$_POST['country']."','".implode(',',$_POST['expertise'])."','".$_POST['profile']."','".$_POST['skills']."','".$_POST['rate']."','".$_POST['resume']."')"; $result = ($query) or die (mysql_error()); this code inserts data for all fields but the checkbox value field remains empty???

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • Php plugin to replace '->' with '.' as the member access operator ? Or even better: alternative synt

    - by Gigi
    Present day usable solution: Note that if you use an ide or an advanced editor, you could make a code template, or record a macro that inserts '->' when you press Ctrl and '.' or something. Netbeans has macros, and I have recorded a macro for this, and I like it a lot :) (just click the red circle toolbar button (start record macro),then type -> into the editor (thats all the macro will do, insert the arrow into the editor), then click the gray square (stop record macro) and assign the 'Ctrl dot' shortcut to it, or whatever shortcut you like) The php plugin: The php plugin, would also have to have a different string concatenation operator than the dot. Maybe a double dot ? Yea... why not. All it has to do is set an activation tag so that it doesnt replace / interpreter '.' as '->' for old scripts and scripts that dont intent do use this. Something like this: <php+ $obj.i = 5 ?> (notice the modified '<?php' tag to '<?php+' ) This way it wouldnt break old code. (and you can just add the '<?php+' code template to your editor and then type 'php tab' (for netbeans) and it would insert '<?php+' ) With the alternative syntax method you could even have old and new syntax cohabitating on the same page like this (I am illustrating this to show the great compatibility of this method, not because you would want to do this): <?php+ $obj.i = 5; ?> <?php $obj->str = 'a' . 'b'; ?> You could change the tag to something more explanatory, in case somebody who doesnt know about the plugin reads the script and thinks its a syntax error <?php-dot.com $obj.i = 5; ?> This is easy because most editors have code templates, so its easy to assign a shortcut to it. And whoever doesnt want the dot replacement, doesnt have to use it. These are NOT ultimate solutions, they are ONLY examples to show that solutions exist, and that arguments against replacing '->' with '.' are only excuses. (Just admit you like the arrow, its ok : ) With this potential method, nobody who doesnt want to use it would have to use it, and it wouldnt break old code. And if other problems (ahem... excuses) arise, they could be fixed too. So who can, and who will do such a thing ?

    Read the article

  • Live search results as you type... am I going about this the right way? jQuery + PHP

    - by dallen
    This is my first time building a tool like this, so please bare with me. I'm doing this to learn more about jQuery and AJAX. Basically, I have a search input and a hidden div. When you start typing in the search input, the hidden div becomes visible and results are brought in. In this case, I'm searching for client names. It all works fine, however I think my code could be better but I'm not sure exactly where to begin. Each keyup requests a PHP script which accesses a table in a database to find a like string. But in my PHP script, I'm echo'ing some JS/jQuery which I'm not sure is good practice. Below is my code. Am I going about this the right way or am I totally off base? Any suggestions for improvement? Javascript $("#search").keyup(function() { $("#search_results").show("fast"); $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search/" + $("#search").val(), success: function(html) { $("#search_results").html(html); } }); }); PHP function search($search_string = false) { if ($search_string) { $this->db->like('name', $search_string); $query = $this->db->get('clients'); if ($query->num_rows() == 0) { echo "No client exists."; } else { foreach ($query->result() as $row) { echo '<script>'; echo ' $("#client_results_'.$row->id.'").hide(); $("#'.$row->id.'").toggle(function() { $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search_client_ads/" + '.$row->id.', success: function(html) { $("#client_results_'.$row->id.'").html(html).show("fast"); } }); }, function() { $("#client_results_'.$row->id.'").hide("fast").html(""); });'; echo '</script>'; echo '<p><span id="'.$row->id.'">'.$row->name.'</span></p>'; echo '<div id="client_results_'.$row->id.'"></div>'; } } } else { echo ''; } } function search_client_ads($client_id) { $query = $this->db->get_where('online_ads', array('client' => $client_id)); if ($query->num_rows() == 0) { echo "No ads exist."; } else { foreach ($query->result() as $row) { echo $row->id; } } }

    Read the article

  • Is there a reason why a base class decorated with XmlInclude would still throw a type unknown exception when serialized?

    - by Tedford
    I will simplify the code to save space but what is presented does illustrate the core problem. I have a class which has a property that is a base type. There exist 3 dervived classes which could be assigned to that property. If I assign any of the derived classes to the container then the XmlSerializer throws dreaded "The type xxx was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically." exception when attempting to seralize the container. However my base class is already decorated with that attribute so I figure there must be an additional "hidden" requirement. The really odd part is that the default WCF serializer has no issues with this class hierarchy. The Container class [DataContract] [XmlRoot(ElementName = "TRANSACTION", Namespace = Constants.Namespace)] public class PaymentSummaryRequest : CommandRequest { /// <summary> /// Gets or sets the summary. /// </summary> /// <value>The summary.</value> /// <remarks></remarks> [DataMember] public PaymentSummary Summary { get; set; } /// <summary> /// Initializes a new instance of the <see cref="PaymentSummaryRequest"/> class. /// </summary> public PaymentSummaryRequest() { Mechanism = CommandMechanism.PaymentSummary; } } The base class [DataContract] [XmlInclude(typeof(xxxPaymentSummary))] [XmlInclude(typeof(yyyPaymentSummary))] [XmlInclude(typeof(zzzPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(zzzPaymentSummary))] public abstract class PaymentSummary { } One of the derived classes [DataContract] public class xxxPaymentSummary : PaymentSummary { } The serialization code var serializer = new XmlSerializer(typeof(PaymentSummaryRequest)); serializer.Serialize(Console.Out,new PaymentSummaryRequest{Summary = new xxxPaymentSummary{}}); The Exception System.InvalidOperationException: There was an error generating the XML document. --- System.InvalidOperationException: The type xxxPaymentSummary was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically. at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write13_PaymentSummary(String n, String ns, PaymentSummary o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write14_PaymentSummaryRequest(String n, String ns, PaymentSummaryRequest o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write15_TRANSACTION(Object o) --- End of inner exception stack trace --- at System.Xml.Serialization.XmlSerializer.Serialize(XmlWriter xmlWriter, Object o, XmlSerializerNamespaces namespaces, String encodingStyle, String id) at System.Xml.Serialization.XmlSerializer.Serialize(TextWriter textWriter, Object o, XmlSerializerNamespaces namespaces) at UserQuery.RunUserAuthoredQuery() in c:\Users\Tedford\AppData\Local\Temp\uqacncyo.0.cs:line 47

    Read the article

  • ajaxSubmit and Other Code. Can someone help me determine what this code is doing?

    - by Matt Dawdy
    I've inherited some code that I need to debug. It isn't working at present. My task is to get it to work. No other requirements have been given to me. No, this isn't homework, this is a maintenance nightmare job. ASP.Net (framework 3.5), C#, jQury 1.4.2. This project makes heavy use of jQuery and AJAX. There is a drop down on a page that, when an item is chosen, is supposed to add that item (it's a user) to an object in the database. To accomplish this, the previous programmer first, on page load, dynamically loads the entire page through AJAX. To do this, he's got 5 div's, and each one is loaded from a jquery call to a different full page in the website. Somehow, the HTML and BODY and all the other stuff is stripped out and the contents of the div are loaded with the content of the aspx page. Which seems incredibly wrong to me since it relies on the browser to magically strip out html, head, body, form tags and merge with the existing html head body form tags. Also, as the "content" page is returned as a string, the previous programmer has this code running on it before it is appended to the div: function CleanupResponseText(responseText, uniqueName) { responseText = responseText.replace("theForm.submit();", "SubmitSubForm(theForm, $(theForm).parent());"); responseText = responseText.replace(new RegExp("theForm", "g"), uniqueName); responseText = responseText.replace(new RegExp("doPostBack", "g"), "doPostBack" + uniqueName); return responseText; } When the dropdown itself fires it's onchange event, here is the code that gets fired: function SubmitSubForm(form, container) { //ShowLoading(container); $(form).ajaxSubmit( { url: $(form).attr("action"), success: function(responseText) { $(container).html(CleanupResponseText(responseText, form.id)); $("form", container).css("margin-top", "0").css("padding-top", "0"); //HideLoading(container); } } ); } This blows up in IE, with the message that "Microsoft JScript runtime error: Object doesn't support this property or method" -- which, I think, has to be that $(form).ajaxSubmit method doesn't exist. What is this code really trying to do? I am so turned around right now that I think my only option is to scrap everything and start over. But I'd rather not do that unless necessary. Is this code good? Is it working against .Net, and is that why we are having issues?

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • iPhone: Create a single UIView from multiple clicks

    - by Cuzog
    I'm making a partial overlay modal in my app with the code from “Semi-Modal (Transparent) Dialogs on the iPhone” at ramin.firoozye.com. In doing so, the button that calls the modal is still visible and clickable. I will hide this button when the modal spawns, but I want to be sure if the user clicks very quickly twice, a new modal doesn't come up for each click. What is the best way to check that the modal doesn't already exist when calling it from the button click? You can download the test project here. For those that don't have xcode, the relevant functions are below: I call forth the modal on button click with this: - (IBAction)displayModal:(id)sender { ModalViewController *modalController = [[ModalViewController alloc] initWithNibName:@"ModalViewController" bundle:nil]; modalController.view.frame = CGRectOffset(modalController.view.frame, 0, 230); [self showModal:modalController.view]; } Then use this function to animate the custom modal over the current view: - (void)showModal:(UIView*) modalView { UIWindow* mainWindow = (((TestAppDelegate*) [UIApplication sharedApplication].delegate).window); CGPoint middleCenter = modalView.center; CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); modalView.center = offScreenCenter; // we start off-screen [mainWindow addSubview:modalView]; // Show it with a transition effect [UIView beginAnimations:nil context:nil]; [UIView setAnimationDuration:0.4]; // animation duration in seconds modalView.center = middleCenter; [UIView commitAnimations]; } Then I dismiss the modal on button click with this: - (IBAction)dismissModal:(id)sender { [self hideModal:self.view]; } And then use these functions to animate the modal offscreen and clean itself up: - (void)hideModal:(UIView*) modalView { CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); [UIView beginAnimations:nil context:modalView]; [UIView setAnimationDuration:0.7]; [UIView setAnimationDelegate:self]; [UIView setAnimationDidStopSelector:@selector(hideModalEnded:finished:context:)]; modalView.center = offScreenCenter; [UIView commitAnimations]; } - (void)hideModalEnded:(NSString *)animationID finished:(NSNumber *)finished context:(void *)context { UIView* modalView = (UIView *)context; [modalView removeFromSuperview]; [self release]; } Any help is greatly appreciated!

    Read the article

  • Form validation with optional File Upload field callback

    - by MotiveKyle
    I have a form with some input fields and a file upload field in the same form. I am trying to include a callback into the form validation to check for file upload errors. Here is the controller for adding and the callback: public function add() { if ($this->ion_auth->logged_in()): //validate form input $this->form_validation->set_rules('title', 'title', 'trim|required|max_length[66]|min_length[2]'); // link url $this->form_validation->set_rules('link', 'link', 'trim|required|max_length[255]|min_length[2]'); // optional content $this->form_validation->set_rules('content', 'content', 'trim|min_length[2]'); $this->form_validation->set_rules('userfile', 'image', 'callback_validate_upload'); $this->form_validation->set_error_delimiters('<small class="error">', '</small>'); // if form was submitted, process form if ($this->form_validation->run()) { // add pin $pin_id = $this->pin_model->create(); $slug = strtolower(url_title($this->input->post('title'), TRUE)); // path to pin folder $file_path = './uploads/' . $pin_id . '/'; // if folder doesn't exist, create it if (!is_dir($file_path)) { mkdir($file_path); } // file upload config variables $config['upload_path'] = $file_path; $config['allowed_types'] = 'jpg|png'; $config['max_size'] = '2048'; $config['max_width'] = '1920'; $config['max_height'] = '1080'; $config['encrypt_name'] = TRUE; $this->load->library('upload', $config); // upload image file if ($this->upload->do_upload()) { $this->load->model('file_model'); $image_id = $this->file_model->insert_image_to_db($pin_id); $this->file_model->add_image_id_to_pin($pin_id, $image_id); } } // build page else: // User not logged in redirect("login", 'refresh'); endif; } The callback: function validate_upload() { if ($_FILES AND $_FILES['userfile']['name']): if ($this->upload->do_upload()): return true; else: $this->form_validation->set_message('validate_upload', $this->upload->display_errors()); return false; endif; else: return true; endif; } I am getting the error Fatal error: Call to a member function do_upload() on a non-object on line 92 when I try to run this. Line 92 is the if ($this->upload->do_upload()): line in the validate_upload callback. Am I going about this the right way? What's triggering this error?

    Read the article

  • What are the rules governing how a bind variable can be used in Postgres and where is this defined?

    - by Craig Miles
    I can have a table and function defined as: CREATE TABLE mytable ( mycol integer ); INSERT INTO mytable VALUES (1); CREATE OR REPLACE FUNCTION myfunction (l_myvar integer) RETURNS mytable AS $$ DECLARE l_myrow mytable; BEGIN SELECT * INTO l_myrow FROM mytable WHERE mycol = l_myvar; RETURN l_myrow; END; $$ LANGUAGE plpgsql; In this case l_myvar acts as a bind variable for the value passed when I call: SELECT * FROM myfunction(1); and returns the row where mycol = 1 If I redefine the function as: CREATE OR REPLACE FUNCTION myfunction (l_myvar integer) RETURNS mytable AS $$ DECLARE l_myrow mytable; BEGIN SELECT * INTO l_myrow FROM mytable WHERE mycol IN (l_myvar); RETURN l_myrow; END; $$ LANGUAGE plpgsql; SELECT * FROM myfunction(1); still returns the row where mycol = 1 However, if I now change the function definition to allow me to pass an integer array and try to this array in the IN clause, I get an error: CREATE OR REPLACE FUNCTION myfunction (l_myvar integer[]) RETURNS mytable AS $$ DECLARE l_myrow mytable; BEGIN SELECT * INTO l_myrow FROM mytable WHERE mycol IN (array_to_string(l_myvar, ',')); RETURN l_myrow; END; $$ LANGUAGE plpgsql; Analysis reveals that although: SELECT array_to_string(ARRAY[1, 2], ','); returns 1,2 as expected SELECT * FROM myfunction(ARRAY[1, 2]); returns the error operator does not exist: integer = text at the line: WHERE mycol IN (array_to_string(l_myvar, ',')); If I execute: SELECT * FROM mytable WHERE mycol IN (1,2); I get the expected result. Given that array_to_string(l_myvar, ',') evaluates to 1,2 as shown, why arent these statements equivalent. From the error message it is something to do with datatypes, but doesnt the IN(variable) construct appear to be behaving differently from the = variable construct? What are the rules here? I know that I could build a statement to EXECUTE, treating everything as a string, to achieve what I want to do, so I am not looking for that as a solution. I do want to understand though what is going on in this example. Is there a modification to this approach to make it work, the particular example being to pass in an array of values to build a dynamic IN clause without resorting to EXECUTE? Thanks in advance Craig

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

  • C++ include statement required if defining a map in a headerfile.

    - by Justin
    I was doing a project for computer course on programming concepts. This project was to be completed in C++ using Object Oriented designs we learned throughout the course. Anyhow, I have two files symboltable.h and symboltable.cpp. I want to use a map as the data structure so I define it in the private section of the header file. I #include <map> in the cpp file before I #include "symboltable.h". I get several errors from the compiler (MS VS 2008 Pro) when I go to debug/run the program the first of which is: Error 1 error C2146: syntax error : missing ';' before identifier 'table' c:\users\jsmith\documents\visual studio 2008\projects\project2\project2\symboltable.h 22 Project2 To fix this I had to #include <map> in the header file, which to me seems strange. Here are the relevant code files: // symboltable.h #include <map> class SymbolTable { public: SymbolTable() {} void insert(string variable, double value); double lookUp(string variable); void init(); // Added as part of the spec given in the conference area. private: map<string, double> table; // Our container for variables and their values. }; and // symboltable.cpp #include <map> #include <string> #include <iostream> using namespace std; #include "symboltable.h" void SymbolTable::insert(string variable, double value) { table[variable] = value; // Creates a new map entry, if variable name already exist it overwrites last value. } double SymbolTable::lookUp(string variable) { if(table.find(variable) == table.end()) // Search for the variable, find() returns a position, if thats the end then we didnt find it. throw exception("Error: Uninitialized variable"); else return table[variable]; } void SymbolTable::init() { table.clear(); // Clears the map, removes all elements. }

    Read the article

  • Casting objects in C# (ASP.Net MVC)

    - by Mortanis
    I'm coming from a background in ColdFusion, and finally moving onto something modern, so please bear with me. I'm running into a problem casting objects. I have two database tables that I'm using as Models - Residential and Commercial. Both of them share the majority of their fields, though each has a few unique fields. I've created another class as a container that contains the sum of all property fields. Query the Residential and Commercial, stuff it into my container, cunningly called Property. This works fine. However, I'm having problems aliasing the fields from Residential/Commercial onto Property. It's quite easy to create a method for each property: fillPropertyByResidential(Residential source) and fillPropertyByCommercial(Commercial source), and alias the variables. That also works fine, but quite obviously will copy a bunch of code - all those fields that are shared between the two main Models. So, I'd like a generic fillPropertyBySource() that takes the object, and detects if it's Residential or Commercial, fills the particular fields of each respective type, then do all the fields in common. Except, I gather in C# that variables created inside an If are only in the scope of the if, so I'm not sure how to do this. public property fillPropertyBySource(object source) { property prop = new property(); if (source is Residential) { Residential o = (Residential)source; //Fill Residential only fields } else if (source is Commercial) { Commercial o = (Commercial)source; //Fill Commercial only fields } //Fill fields shared by both prop.price = (int)o.price; prop.bathrooms = (float)o.bathrooms; return prop; } "o" being a Commercial or Residential only exists within the scope of the if. How do I detect the original type of the source object and take action? Bear with me - the shift from ColdFusion into a modern language is pretty..... difficult. More so since I'm used to procedural code and MVC is a massive paradigm shift. Edit: I should include the error: The name 'o' does not exist in the current context For the aliases of price and bathrooms in the shared area.

    Read the article

< Previous Page | 256 257 258 259 260 261 262 263 264 265 266 267  | Next Page >