Search Results

Search found 6927 results on 278 pages for 'frank schneede (exadata community)'.

Page 260/278 | < Previous Page | 256 257 258 259 260 261 262 263 264 265 266 267  | Next Page >

  • Looking for efficient scaling patterns for Silverlight application with distributed text-file data s

    - by Edward Tanguay
    I'm designing a Silverlight software solution for students and teachers to record flashcards, e.g. words and phrases that students find while reading and errors that teachers notice while teaching. Requirements are: each person publishes his own flashcards in a file on a web server, e.g. http://:www.mywebserver.com/flashcards.txt other people subscribe to that person's flashcards by using a Silverlight flashcard reader that I have developed and entering the URLs of flashcard files they want to subscribe to, URLs and imported flashcards being saved in IsolatedStorage the flashcards.txt file has the following simple format: title, then blocks of question/answers: Jim Smith's flashcards from English class 53-222, winter semester 2009 ==fla Das kann nicht sein. That can't be. ==fla Es sei denn, er kommt nicht. Unless he doesn't come. The user then makes public the URL to his flashcard file and other readers begin reading in his flashcards. In order to lower the bar for non-technical users to contribute, it will even be possible for them to save this text in a Google Document, which they publish and distribute the URL. The flashcard readers will then recognize it is a google document and perform the necessary screen scraping to get at the raw text. I have two technical questions about this approach: What is a best way to plan now for scalability issues: e.g. if your reader is subscribed to 10 flashcard files that are each 200K, it will have to download 2MB of text just to find out if any new flashcards are available. Or can I somehow accurately and consistently get at the last update date/time of text files on servers and published google docs? Each reader will have the ability to allow the person to test himself on imported flashcards and add meta information to them, e.g. categorize them, edit them, etc. This information will be stored in IsolatedStorage along with the important flashcards themselves. What is a good pattern to allow these readers to share and synchronize this meta data, e.g. so when you are looking at a flashcard you can see that 5 other people have made corrections to it. The best solution I can think of now is that the Silverlight readers will have to republish their data to a central database, but then there is the problem of uniquely identifying each flashcard, the best approach seems to be URL + position-in-file, or even better URL + original text of both question and answer fields, but both of these have their obvious drawbacks. The main requirement is that the bar for participation is kept as low as possible, i.e. type text in a google document, publish it, distribute the URL, and you're publishing within the flashcard community. So I want to come up with the most efficient technical solutions in order to compensate for the lack of database, lack of unique ids, etc. For those who have designed or developed similar non-traditional, distributed database projects like this, what advice, experience or best-practice tips you can share on the above two points?

    Read the article

  • ASP.NET Client to Server communication

    - by Nelson
    Can you help me make sense of all the different ways to communicate from browser to client in ASP.NET? I have made this a community wiki so feel free to edit my post to improve it. Specifically, I'm trying to understand in which scenario to use each one by listing how each works. I'm a little fuzzy on UpdatePanel vs CallBack (with ViewState): I know UpdatePanel always returns HTML while CallBack can return JSON. Any other major differences? ...and CallBack (without ViewState) vs WebMethod. CallBack goes through most of the Page lifecycle, WebMethod doesn't. Any other major differences? IHttpHandler Custom handler for anything (page, image, etc.) Only does what you tell it to do (light server processing) Page is an implementation of IHttpHandler If you don't need what Page provides, create a custom IHttpHandler If you are using Page but overriding Render() and not generating HTML, you probably can do it with a custom IHttpHandler (e.g. writing binary data such as images) By default can use the .axd or .ashx file extensions -- both are functionally similar .ashx doesn't have any built-in endpoints, so it's preferred by convention Regular PostBack (System.Web.UI.Page : IHttpHandler) Inherits Page Full PostBack, including ViewState and HTML control values (heavy traffic) Full Page lifecycle (heavy server processing) No JavaScript required Webpage flickers/scrolls since everything is reloaded in browser Returns full page HTML (heavy traffic) UpdatePanel (Control) Control inside Page Full PostBack, including ViewState and HTML control values (heavy traffic) Full Page lifecycle (heavy server processing) Controls outside the UpdatePanel do Render(NullTextWriter) Must use ScriptManager If no client-side JavaScript, it can fall back to regular PostBack with no JavaScript (?) No flicker/scroll since it's an async call, unless it falls back to regular postback. Can be used with master pages and user controls Has built-in support for progress bar Returns HTML for controls inside UpdatePanel (medium traffic) Client CallBack (Page, System.Web.UI.ICallbackEventHandler) Inherits Page Most of Page lifecycle (heavy server processing) Takes only data you specify (light traffic) and optionally ViewState (?) (medium traffic) Client must support JavaScript and use ScriptManager No flicker/scroll since it's an async call Can be used with master pages and user controls Returns only data you specify in format you specify (e.g. JSON, XML...) (?) (light traffic) WebMethod Class implements System.Web.Service.WebService HttpContext available through this.Context Takes only data you specify (light traffic) Server only runs the called method (light server processing) Client must support JavaScript No flicker/scroll since it's an async call Can be used with master pages and user controls Returns only data you specify, typically JSON (light traffic) Can create instance of server control to render HTML and sent back as string, but events, paging in GridView, etc. won't work PageMethods Essentially a WebMethod contained in the Page class, so most of WebMethod's bullet's apply Method must be public static, therefore no Page instance accessible HttpContext available through HttpContext.Current Accessed directly by URL Page.aspx/MethodName (e.g. with XMLHttpRequest directly or with library such as jQuery) Setting ScriptManager property EnablePageMethods="True" generates a JavaScript proxy for each WebMethod Cannot be used directly in user controls with master pages and user controls Any others?

    Read the article

  • Is it possible to programatically catch JavaScript SyntaxErrors?

    - by Matty
    I don't think that this is doable, but wanted to throw it out to the community to confirm my suspicions. Let's say you're writing a program in another language like Python, PHP, or ASP. This program is intended to build another program written in JavaScript. However, the first program is unfortunately not immune to errors. So, occasionally, the program which builds the JavaScript program does some funky stuff and outputs a syntax error in the JavaScript source. Now some user goes and loads the program and it essentially halts, because the web browser running it can't properly parse the JavaScript. This user is probably not going to be happy. I wouldn't be. This brings me to my question. Is it possible to write an error handler that would catch these kind of syntax problems allowing the application to fail gracefully? Here's an example: <html> <head> <script type="text/javascript" charset="utf-8"> window.onerror = errorHandler; function errorHandler(a,b,c) { alert('horray! No wait, Booo!'); } vara jfs; </script> </head> <body> Can this be done? </body> </html> or <html> <head> <script type="text/javascript" charset="utf-8"> try { vara jfs; } catch (e) { alert('horray! No wait, Booo!'); } </script> </head> <body> Can this be done? </body> </html>

    Read the article

  • Do you still limit line length in code?

    - by Noldorin
    This is a matter on which I would like to gauge the opinion of the community: Do you still limit the length of lines of code to a fixed maximum? This was certainly a convention of the past for many languages; one would typically cap the number of characters per line to a value such as 80 (and more recnetly 100 or 120 I believe). As far as I understand, the primary reasons for limiting line length are: Readability - You don't have to scroll over horizontally when you want to see the end of some lines. Printing - Admittedly (at least in my experience), most code that you are working on does not get printed out on paper, but by limiting the number of characters you can insure that formatting doesn't get messed up when printed. Past editors (?) - Not sure about this one, but I suspect that at some point in the distant past of programming, (at least some) text editors may have been based on a fixed-width buffer. I'm sure there are points that I am still missing out, so feel free to add to these... Now, when I tend to observe C or C# code nowadays, I often see a number of different styles, the main ones being: Line length capped to 80, 100, or even 120 characters. As far as I understand, 80 is the traditional length, but the longer ones of 100 and 120 have appeared because of the widespread use of high resolutions and widescreen monitors nowadays. No line length capping at all. This tends to be pretty horrible to read, and I don't see it too often, though it's certainly not too rare either. Inconsistent capping of line length. The length of some lines are limited to a fixed maximum (or even a maximum that changes depending on the file/location in code), while others (possibly comments) are not at all. My personal preference here (at least recently) has been to cap the line length to 100 in the Visual Studio editor. This means that in a decently sized window (on a non-widescreen monitor), the ends of lines are still fully visible. I can however see a few disadvantages in this, especially when you end up writing code that's indented 3 or 4 levels and then having to include a long string literal - though I often take this as a sign to refactor my code! In particular, I am curious what the C and C# coders (or anyone who uses Visual Studio for that matter) think about this point, though I would be interested in hearing anyone's thoughts on the subject. Edit Thanks for the all answers - I appreciate the variety of opinions here, all presenting sound reasons. Consensus does seem to be tipping in the direction of always (or almost always) limit the line length. Interestingly, it seems to be in various coding standards to limit the line length. Judging by some of the answers, both the Python and Google CPP guidelines set the limit at 80 chars. I haven't seen anything similar regarding C# or VB.NET, but I would be curious to see if there are ones anywhere.

    Read the article

  • Suggestions for designing large-scale Java webapp from the group up

    - by Chris Thompson
    Hi all, I'm about to start developing a large-scale system and I'm struggling with which direction to proceed. I've done plenty of Java web apps before and I have plenty of experience with servlet containers and GWT and some experience with Spring. The problem is most of my webapps have been thrown together just to be a proof of concept and what I'm struggling with is what set of frameworks to use. I need to have both a browser based application as well as a web service designed to support access from mobile devices (Android and iPhone for now). Ideally, I'd like to design this system in such a way that I don't end up rewriting all of my servlets for each client (browser and phone) although I don't mind having some small checks in there to properly format the data. In addition, although I'm the only developer now, that won't necessarily be the case down the road and I'd like to design something that scales well both with regards to traffic and number of developers (isn't just a nightmare to maintain). So where I am now is planning on using GWT to design the browser-based interface but I'm struggling with how to reuse that code with to present the interface (most likely xml) for the mobile devices. Using GWT RPC would, I think, make it relatively easy to do all of the AJAX in the browser, but might make generating xml for the mobile phones difficult. In addition, I like the idea of using something like Hibernate for persistence and Spring Security to secure the whole thing. Again, I'm not sure how well those will cooperate with GWT (I think Hibernate should be fine...) There's obviously a lot more to this than I've presented here, but I've tried to give you the 5-minute overview. I'm a bit stumped and was wondering if anybody in the community had any experience starting from this place. Does what I'm trying to do make sense? Is it realistic? I have no doubt I can make all of these frameworks speak the same language, I'm just wondering if it's worth my time to fight with them. Also, am I missing a framework that would be really beneficial? Thanks in advance and sorry for the relatively broad question... Chris

    Read the article

  • Oracle Coding Standards Feature Implementation

    - by Mike Hofer
    Okay, I have reached a sort of an impasse. In my open source project, a .NET-based Oracle database browser, I've implemented a bunch of refactoring tools. So far, so good. The one feature I was really hoping to implement was a big "Global Reformat" that would make the code (scripts, functions, procedures, packages, views, etc.) standards compliant. (I've always been saddened by the lack of decent SQL refactoring tools, and wanted to do something about it.) Unfortunatey, I am discovering, much to my chagrin, that there doesn't seem to be any one widely-used or even "generally accepted" standard for PL-SQL. That kind of puts a crimp on my implementation plans. My search has been fairly exhaustive. I've found lots of conflicting documents, threads and articles and the opinions are fairly diverse. (Comma placement, of all things, seems to generate quite a bit of debate.) So I'm faced with a couple of options: Add a feature that lets the user customize the standard and then reformat the code according to that standard. —OR— Add a feature that lets the user customize the standard and simply generate a violations list like StyleCop does, leaving the SQL untouched. In my mind, the first option saves the end-users a lot of work, but runs the risk of modifying SQL in potentially unwanted ways. The second option runs the risk of generating lots of warnings and doing no work whatsoever. (It'd just be generally annoying.) In either scenario, I still have no standard to go by. What I'd need to know from you guys is kind of poll-ish, but kind of not. If you were going to use a tool of this nature, what parts of your SQL code would you want it to warn you about or fix? Again, I'm just at a loss due to a lack of a cohesive standard. And given that there isn't anything out there that's officially published by Oracle, I think this is something the community could weigh in on. Also, given the way that voting works on SO, the votes would help to establish the popularity of a given "refactoring." P.S. The engine parses SQL into an expression tree so it can robustly analyze the SQL and reformat it. There should be quite a bit that we can do to correct the format of the SQL. But I am thinking that for the first release of the thing, layout is the primary concern. Though it is worth noting that the thing already has refactorings for converting keywords to upper case, and identifiers to lower case.

    Read the article

  • Defining where on the page the flowdocument I am printing will 'start' and 'end'

    - by Sagi1981
    Dear community. I am almost done with implementing a printing functionality, but I am having trouble getting the last hurdle done with. My problem is, that I am printing some reports, consisting of a header (with information about the person the report is about), a footer (with a page number) and the content in the middle, which is a FlowDocument. Since the flowdocuments can be fairly long, It is very possible that they will span multiple pages. My approach is to make a custom FlowDocumentPaginator which derives from DocumentPaginator. In there i define my header and my footer. However, when I print my page, the flowdocument and my header and footer are on top of eachother. So my question is plain and simple - how do I define from where and to where the flowdocument part on the pages will be placed? here is the code from my custommade Paginator: public class HeaderedFlowDocumentPaginator : DocumentPaginator { private DocumentPaginator flowDocumentpaginator; public HeaderedFlowDocumentPaginator(FlowDocument document) { flowDocumentpaginator = ((IDocumentPaginatorSource) document).DocumentPaginator; } public override bool IsPageCountValid { get { return flowDocumentpaginator.IsPageCountValid; } } public override int PageCount { get { return flowDocumentpaginator.PageCount; } } public override Size PageSize { get { return flowDocumentpaginator.PageSize; } set { flowDocumentpaginator.PageSize = value; } } public override IDocumentPaginatorSource Source { get { return flowDocumentpaginator.Source; } } public override DocumentPage GetPage(int pageNumber) { DocumentPage page = flowDocumentpaginator.GetPage(pageNumber); ContainerVisual newVisual = new ContainerVisual(); newVisual.Children.Add(page.Visual); DrawingVisual header = new DrawingVisual(); using (DrawingContext dc = header.RenderOpen()) { //Header data } newVisual.Children.Add(header); DrawingVisual footer = new DrawingVisual(); using (DrawingContext dc = footer.RenderOpen()) { Typeface typeface = new Typeface("Trebuchet MS"); FormattedText text = new FormattedText("Page " + (pageNumber + 1).ToString(), CultureInfo.CurrentCulture, FlowDirection.LeftToRight, typeface, 14, Brushes.Black); dc.DrawText(text, new Point(page.Size.Width - 100, page.Size.Height-30)); } newVisual.Children.Add(footer); DocumentPage newPage = new DocumentPage(newVisual); return newPage; } } And here is the printdialogue call: private void btnPrint_Click(object sender, RoutedEventArgs e) { try { PrintDialog printDialog = new PrintDialog(); if (printDialog.ShowDialog() == true) { FlowDocument fd = new FlowDocument(); MemoryStream stream = new MemoryStream(ASCIIEncoding.Default.GetBytes(<My string of text - RTF formatted>)); TextRange tr = new TextRange(fd.ContentStart, fd.ContentEnd); tr.Load(stream, DataFormats.Rtf); stream.Close(); fd.ColumnWidth = printDialog.PrintableAreaWidth; HeaderedFlowDocumentPaginator paginator = new HeaderedFlowDocumentPaginator(fd); printDialog.PrintDocument(paginator, "myReport"); } } catch (Exception ex) { //Handle } }

    Read the article

  • MySQL table organization and optimization (Rails)

    - by aguynamedloren
    I've been learning Ruby on Rails over the past few months with no prior programming experience. Lately, I've been thinking about database optimization and table organization. I know there are great books on the subject, but I typically learn by example / as I go. Here's a hypothetical situation: Let's say I am building a social network for a niche community with 250,000 members (users). The users have the ability to attend events. Let's say there are 50,000 past/present/future events. Much like Facebook events, a user can attend any number of events and an event can have any number of attendees. In the database, there would be a table for users and a table for events. Somehow I would have to create an association between the users and events. I could create an "events" column in the users table such that each user row would contain a hash of event IDs, or I could create an "attendees" column in the events table such that each event row would contain a hash of user IDs. Neither of these solutions seem ideal, however. On a users profile page, I want to display the list of events they are associated with, which would require scanning the 50,000 event rows for the user ID of said user if I include an "attendees" column in the events table. Likewise, on an event page, I want to display a list of attendees for the event, which would require scanning the 250,000 user rows for the event ID of said event if I include an "events" column in the users table. Option 3 would be to create a third table that contains the attendee information for each and every event - but I don't see how this would solve any problems. Are these non-issues? Rails makes accessing all of this information easy, but I guess I'm worried about scale. It is entirely possible that I am under-estimating the speed and processing power of modern databases / servers / etc. How long would it take to scan 250,000 user rows for specific event IDs - 10ms? 100ms? 1,000ms? I guess that's not that bad. Am I just over-thinking this?

    Read the article

  • Suggestions for designing large-scale Java webapp from the ground up

    - by Chris Thompson
    Hi all, I'm about to start developing a large-scale system and I'm struggling with which direction to proceed. I've done plenty of Java web apps before and I have plenty of experience with servlet containers and GWT and some experience with Spring. The problem is most of my webapps have been thrown together just to be a proof of concept and what I'm struggling with is what set of frameworks to use. I need to have both a browser based application as well as a web service designed to support access from mobile devices (Android and iPhone for now). Ideally, I'd like to design this system in such a way that I don't end up rewriting all of my servlets for each client (browser and phone) although I don't mind having some small checks in there to properly format the data. In addition, although I'm the only developer now, that won't necessarily be the case down the road and I'd like to design something that scales well both with regards to traffic and number of developers (isn't just a nightmare to maintain). So where I am now is planning on using GWT to design the browser-based interface but I'm struggling with how to reuse that code with to present the interface (most likely xml) for the mobile devices. Using GWT RPC would, I think, make it relatively easy to do all of the AJAX in the browser, but might make generating xml for the mobile phones difficult. In addition, I like the idea of using something like Hibernate for persistence and Spring Security to secure the whole thing. Again, I'm not sure how well those will cooperate with GWT (I think Hibernate should be fine...) There's obviously a lot more to this than I've presented here, but I've tried to give you the 5-minute overview. I'm a bit stumped and was wondering if anybody in the community had any experience starting from this place. Does what I'm trying to do make sense? Is it realistic? I have no doubt I can make all of these frameworks speak the same language, I'm just wondering if it's worth my time to fight with them. Also, am I missing a framework that would be really beneficial? Thanks in advance and sorry for the relatively broad question... Chris

    Read the article

  • Flex - Issues with linkbar dataprovider

    - by BS_C3
    Hello Community! I'm having some issues displaying a linkbar. The data I need to display is in a XML file. However, I couldn't get the linkbar to display a xmllist (I did indeed read that you cannot set a xmlllist as a linkbar dataprovider... ). So, I'm transforming the xmllist in a array of objects. Here is some code. XML file: <data> <languages> <language id="en"> <label>ENGLISH</label> <source></source> </language> <language id="fr"> <label>FRANCAIS</label> <source></source> </language> <language id="es"> <label>ESPAÑOL</label> <source></source> </language> <language id="jp"> <label>JAPANESE</label> <source></source> </language> </languages> </data> AS Code that transforms the xmllist in an array of objects: private function init():void { var list:XMLList = generalData.languages.language; var arr:ArrayCollection = new ArrayCollection; var obj:Object; for(var i:int = 0; i<list.length(); i++) { obj = new Object; obj.id = list[i].@id; obj.label = list[i].label; obj.source = list[i].source; arr.addItemAt(obj, arr.length); } GlobalData.instance.languages = arr.toArray(); } Linkbar code: <mx:HBox horizontalAlign="right" width="100%"> <mx:LinkBar id="language" dataProvider="{GlobalData.instance.languages}" separatorWidth="3" labelField="{label}"/> </mx:HBox> The separator is not displaying, and neither do the label. But the array is populated (I tested it). Thanks for any help you can provide =) Regards, BS_C3

    Read the article

  • Zend database query result converts column values to null

    - by David Zapata
    Hi again. I am using the next instructions to get some registers from my Database. Create the needed models (from the params module): $obj_paramtype_model = new Params_Model_DbTable_Paramtype(); $obj_param_model = new Params_Model_DbTable_Param(); Getting the available locales from the database // This returns a Zend_Db_Table_Row_Abstract class object $obj_paramtype = $obj_paramtype_model->getParamtypeByValue('available_locales'); // This is a query used to add conditions to the next sentence. This is executed from the Params_Model_DbTable_Param instance class, that depends from Params_Model_DbTable_Paramtype class (reference map and dependentTables arrays are fine in both classes) $obj_select = $this->select()->where('deleted_at IS NULL')->order('name'); // Execute the next query, applying the select restrictions. This returns a Zend_Db_Table_Rowset_Abstract class object. This means "Find Params by Paramtype" $obj_params_rowset = $obj_paramtype->findDependentRowset('Params_Model_DbTable_Param', 'Paramtype', $obj_paramtype); // Here the firebug log displays the queries.... Zend_Registry::get('log')->debug($obj_params_rowset); I have a profiler for all my DB executions from Zend. At this point the log and profiler objects (that includes Firebug writers), shows the executed SQL Queries, and the last line displays the resulting Zend_Db_Table_Rowset_Abstract class object. If I execute the SQL Queries in some MySQL Client, the results are as expected. But the Zend Firebug log writer displays as NULL the column values with latin characters (ñ). In other words, the external SQL client shows es_CO | Español de Colombia and en_US | English of United States but the Query results from Zend displays (and returns) es_CO | null and en_US | English of United States. I've deleted the ñ character from Español de Colombia and the query results are just fine in my Zend Log Firebug screen, and in the final Zend Form element. The MySQL database, tables and columns are in UTF-8 - utf8_unicode_ci collation. All my zend framework pages are in UTF-8 charset. I'm using XAMPP 1.7.1 (PHP 5.2.9, Apache at port 90 and MySQL 5.1.33-community) running on Windows 7 Ultimate; Zend Framework 1.10.1. I'm sorry if there is so much information, but I don't really know why could that happen, so I tryed to provide as much related information as I could to help to find some answer.

    Read the article

  • string categorization strategies

    - by Andrew Heath
    I'm the one-man dev team on a fledgling military history website. One aspect of the site is a catalog of ~1,200 individual battles, including the nations & formations (regiments, divisions, etc) which took part. The formation information (as well as the other battle info) was manually imported from a series of books by a 10-man volunteer team. The formations were listed in groups with varying formatting and abbreviation patterns. At the time I set up the data collection forms I couldn't think of a good way to process that data... and elected to store it all as strings in the MySQL database and sort it out later. Well, "later" - as it tends to happen - has arrived. :-) Each battle has 2+ records in the database - one for each nation that participated. Each record has a formations text string listing the formations present as the volunteer chose to add them. Some real examples: 39th Grenadier Rgmt, 26th Volksgrenadier Division 2nd Luftwaffe Field Division, 246th Infantry Division 247th Rifle Division, 255th Tank Brigade 2nd Luftwaffe Field Division, SS Cavalry Division 28th Tank Brigade, 158th Rifle Division, 135th Rifle Division, 81st Tank Brigade, 242nd Tank Brigade 78th Infantry Division 3rd Kure Special Naval Landing Force, Tulagi Seaplane Base personnel 1st Battalion 505th Infantry Regiment The ultimate goal is for each individual force to have an ID, so that its participation can be traced throughout the battle database. Formation hierarchy, such as the final item above 1st Battalion (of the) 505th Infantry Regiment also needs to be preserved. In that case, 1st Battalion and 505th Infantry Regiment would be split, but 1st Battalion would be flagged as belonging to the 505th. In database terms, I think I want to pull the formation field out of the current battle info table and create three new tables: FORMATION [id] [name] FORMATION_HIERARCHY [id] [parent] [child] FORMATION_BATTLE [f_id] [battle_id] It's simple to explain, but complicated to enact. What I'm looking for from the SO community is just some tips on how best to tackle this problem. Ideally there's some sort of method to solving this that I'm not aware of. However, as a last resort, I could always code a classification framework and call my volunteers back to sort through 2,500+ records...

    Read the article

  • Square Peg Web: Gets you the traffic to where it matters most: Your Website!

    - by demetriusalwyn
    Have you decided to start your business online or is your business not reaching the targeted audience? Come to Square Peg Web; where you will find what you want to make your business reach new heights. The team at Square Peg Web is professionals who understand what you want and make sure you get it right. Our confidence stems from the fact of thousands of satisfied clients who keep referring friends and business associates to us and we do not let our clients down. Many companies promise the sky but how far is does their work live up to the promises? We do not know about the others however, we are sure that we strive to put together all our ideas and thoughts to make your website rank among the top. Web hosting is something that needs to have a personal touch; Square Peg Web customizes everything to suit your requirements so that you do not have to look further. With Square Peg Web you have a host of features to make your Business go viral. Some of the product details that are offered with Square Peg Web are unlimited product options/ variants/ properties giving you an option on price modifiers. You get unlimited customized input fields for your products and you can also Customer-define the prices. Square Peg Web provides you an option of using multiple product images with zoom features and one can also list a particular product in several categories. There are other aspects which make Square Peg Web the best choice for your website needs; every sale of yours’ is important to you and to us. We make sure that each sale is tracked by the product and also the list of bestsellers that appeal to the audience. Other comprehensive statistics of Square Peg Web includes searchable order data, an interface for shipments and order fulfillments, export sales & customer data for usage in a spreadsheet and the ability to export orders to QuickBooks format. With Square Peg Web; Admin Panel is a lot simpler. Administrative access is completely password protected and any changes done are all in real-time. You can have absolute control on the cart from anywhere around the world using your web browser and the topping on the cake is the unlimited amount of admin accounts that can be created for you. Square Peg Web offers you a world of experience with the options of choosing from marketing websites to e-commerce and from customized applications to community oriented sites. Some of the projects which appear in the portfolio of Square Peg Web are Online Marketing Web Sites, E-Commerce Web Sites, customized web applications, Blog designing and programming, video sharing and the option of downloading web sites, online advertisements, flash animation, customer and product support web sites, web site re-designing and planning and complete information architecture.

    Read the article

  • java.util.zip - ZipInputStream v.s. ZipFile

    - by lucho
    Hello, community! I have some general questions regarding the java.util.zip library. What we basically do is an import and an export of many small components. Previously these components were imported and exported using a single big file, e.g.: <component-type-a id="1"/> <component-type-a id="2"/> <component-type-a id="N"/> <component-type-b id="1"/> <component-type-b id="2"/> <component-type-b id="N"/> Please note that the order of the components during import is relevant. Now every component should occupy its own file which should be externally versioned, QA-ed, bla, bla. We decided that the output of our export should be a zip file (with all these files in) and the input of our import should be a similar zip file. We do not want to explode the zip in our system. We do not want opening separate streams for each of the small files. My current questions: Q1. May the ZipInputStream guarantee that the zip entries (the little files) will be read in the same order in which they were inserted by our export that uses ZipOutputStream? I assume reading is something like: ZipInputStream zis = new ZipInputStream(new BufferedInputStream(fis)); ZipEntry entry; while((entry = zis.getNextEntry()) != null) { //read from zis until available } I know that the central zip directory is put at the end of the zip file but nevertheless the file entries inside have sequential order. I also know that relying on the order is an ugly idea but I just want to have all the facts in mind. Q2. If I use ZipFile (which I prefer) what is the performance impact of calling getInputStream() hundreds of times? Will it be much slower than the ZipInputStream solution? The zip is opened only once and ZipFile is backed by RandomAccessFile - is this correct? I assume reading is something like: ZipFile zipfile = new ZipFile(argv[0]); Enumeration e = zipfile.entries();//TODO: assure the order of the entries while(e.hasMoreElements()) { entry = (ZipEntry) e.nextElement(); is = zipfile.getInputStream(entry)); } Q3. Are the input streams retrieved from the same ZipFile thread safe (e.g. may I read different entries in different threads simultaneously)? Any performance penalties? Thanks for your answers!

    Read the article

  • Sitecore E-Commerce Module - Discount/Promotional Codes

    - by Zachary Kniebel
    I am working on a project for which I must use Sitecore's E-Commerce Module (and Sitecore 6.5 rev. 120706 - aka 'Update 5') to create a web-store. One of the features that I am trying to implement is a generic promotional/discount code system - customer enters a code at checkout which grants a discount like 'free shipping', '20% off', etc. At the moment, I am looking for some guidance (a high-level solution, a few pseudo-ideas, some references to review, etc) as to how this can be accomplished. Summary: What I am looking for is a way to detect whether or not the user entered a promo code at a previous stage in the checkout line, and to determine what that promo code is, if they did. Progress Thus Far: I have thoroughly reviewed all of the Sitecore E-Commerce Services (SES) documentation, especially "SES Order Line Extension" documentation (which I believe will have to be modified/extended in order to accomplish this task). Additionally, I have thoroughly reviewed the Sitecore Community article Extending Sitecore E-Commerce - Pricing and believe that it may be a useful guide for applying a discount statically, but does not say much in the way of applying a discount dynamically. After reviewing these documents, I have come up with the following possible high-level solution to start from: I create a template to represent a promotional code, which holds all data relevant to the promotion (percent off, free shipping, code, etc). I then create another template (based on the Product Search Group template) that holds a link to an item within a global "Promotional Code" items folder. Next, I use the Product Search Group features of my new template to choose which products to apply the discount to. In the source code for the checkout I create a class that checks if a code has been entered and, if so, somehow carry it through the rest of the checkout process. This is where I get stuck. More Details: No using cookies No GET requests No changing/creating/deleting items in the Sitecore Database during the checkout process (e.g., no manipulation of fields of a discount item during checkout to signal that the discount has been applied) must stay within the scope of C# Last Notes: I will update this post with any more information that I find/progress that I make. I upgrade all answers that are relevant and detailed, thought-provoking, or otherwise useful to me and potentially useful to others, in addition to any high-level answers that serve as a feasible solution to this problem; even if your idea doesn't help me, if I think it will help someone else I will still upgrade it. Thanks, in advance, for all your help! :)

    Read the article

  • Learn C# now or finish up with Java and then learn C#?

    - by Sahat
    Ok here is my situation. I've studied Java in my college for 2 semesters. But you know they teach you jack in there, just the basics. We skipped half of our textbook and even then our professors don't teach from section to section of each chapter. I don't blame them. It's hard as it is for new students to understand even the basic concepts of programming. Now this is a community college we are talking about and not Stanford, MIT or Berkeley. So like I said I've done 2 semester of Java. I really like our textbook because it has some challenging projects to do at the end of each chapter. This textbook is pretty clear and i have no problem understanding it (although 2-D and 3-D Arrays have given me some trouble). I have tried reading a few C# books such as Pro C# 2008 and .NET 3.5 and C# 4.0 in a Nutshell. I found these books to be dry and overloaded with information that put me to sleep (No offense to the authors of those 2 wonderful, according to amazon ratings, books). Would you suggest I finish my Java textbook, brush up my knowledge of Arrays, Polymorphism, and etc that are universal to most programming languages. And then switch to C#, plus the syntax is very similar so it should be easy to switch. Or should I just start learning C# right now from the very beginning? If it's the latter then could you recommend some free online resources that will keep me engaged and at the same time teach me everything I need to know about C#. Someone has recommended me to learn .NET first, but I found it to be not the brightest idea. .NET is just a big monster full of libraries. How am I going to apply it if I don't even know the C# or VB!? Anyway back to my question: Master Java and switch to C# or just go with C#? DISCLAIMER: I don't want to start .NET vs J2EE or C# vs Java flame war. I am going with C#. I've decided that I want to work in a Microsoft shop in the future. .NET is what I want to learn. Thanks! Will be waiting for the answers.

    Read the article

  • Migrating from hand-written persistence layer to ORM

    - by Sergey Mikhanov
    Hi community, We are currently evaluating options for migrating from hand-written persistence layer to ORM. We have a bunch of legacy persistent objects (~200), that implement simple interface like this: interface JDBC { public long getId(); public void setId(long id); public void retrieve(); public void setDataSource(DataSource ds); } When retrieve() is called, object populates itself by issuing handwritten SQL queries to the connection provided using the ID it received in the setter (this usually is the only parameter to the query). It manages its statements, result sets, etc itself. Some of the objects have special flavors of retrive() method, like retrieveByName(), in this case a different SQL is issued. Queries could be quite complex, we often join several tables to populate the sets representing relations to other objects, sometimes join queries are issued on-demand in the specific getter (lazy loading). So basically, we have implemented most of the ORM's functionality manually. The reason for that was performance. We have very strong requirements for speed, and back in 2005 (when this code was written) performance tests has shown that none of mainstream ORMs were that fast as hand-written SQL. The problems we are facing now that make us think of ORM are: Most of the paths in this code are well-tested and are stable. However, some rarely-used code is prone to result set and connection leaks that are very hard to detect We are currently squeezing some additional performance by adding caching to our persistence layer and it's a huge pain to maintain the cached objects manually in this setup Support of this code when DB schema changes is a big problem. I am looking for an advice on what could be the best alternative for us. As far as I know, ORMs has advanced in last 5 years, so it might be that now there's one that offers an acceptable performance. As I see this issue, we need to address those points: Find some way to reuse at least some of the written SQL to express mappings Have the possibility to issue native SQL queries without the necessity to manually decompose their results (i.e. avoid manual rs.getInt(42) as they are very sensitive to schema changes) Add a non-intrusive caching layer Keep the performance figures. Is there any ORM framework you could recommend with regards to that?

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • If we don't like it for the presentation layer, then why do we tolerate it for the behavior layer?

    - by greim
    Suppose CSS as we know it had never been invented, and the closest we could get was to do this: <script> // this is the page's stylesheet $(document).ready(function(){ $('.error').css({'color':'red'}); $('a[href]').css({'textDecoration':'none'}); ... }); </script> If this was how we were forced to write code, would we put up with it? Or would every developer on Earth scream at browser vendors until they standardized upon CSS, or at least some kind of declarative style language? Maybe CSS isn't perfect, but hopefully it's obvious how it's better than the find things, do stuff method shown above. So my question is this. We've seen and tasted of the glory of declarative binding with CSS, so why, when it comes to the behavioral/interactive layer, does the entire JavaScript community seem complacent about continuing to use the kludgy procedural method described above? Why for example is this considered by many to be the best possible way to do things: <script> $(document).ready(function(){ $('.widget').append("<a class='button' href='#'>...</div>"); $('a[href]').click(function(){...}); ... }); </script> Why isn't there a massive push to get XBL2.0 or .htc files or some kind of declarative behavior syntax implemented in a standard way across browsers? Is this recognized as a need by other web development professionals? Is there anything on the horizon for HTML5? (Caveats, disclaimers, etc: I realize that it's not a perfect world and that we're playing the hand we've been dealt. My point isn't to criticize the current way of doing things so much as to criticize the complacency that exists about the current way of doing things. Secondly, event delegation, especially at the root level, is a step closer to having a declarative behavior layer. It solves a subset of the problem, but it can't create UI elements, so the overall problem remains.)

    Read the article

  • HTML-like GUI Framework in Java

    - by wintermute
    I was recently brought onto a project where we are developing a lot GUI elements for BlackBerry devices. The standard RIM APIs are pretty basic, almost never do what is required and are difficult or impossible to extend, so we end up re-implementing chunks of it. Currently the code we have isn't super organized and factored so there are lots of little tricks that get implemented over and over again. I had a thought about how to aid development efforts on this platform and wanted to see if the community could tell me if I'm still sane or if I've gone totally nuts. By far, the biggest organizational problem I've run into is making sure that each screen is laid out properly with proper padding and such. The current approach is to manually keep track of padding like so: protected void sublayout(int width, int height) { final int padding = 5; int y = padding; int x = padding; layoutChild(_someChild, width - padding * 2, height / 3 - padding * 2); setPositionChild(_someChild, x, y); y += _someChild.getHeight() + padding; // Calculate where to start drawing next. /* ... snipped ... */ } As you can see, positioning elements on a screen is a nightmare due to the tedium. I have investigated other GUI frameworks but, for a variety of reasons, it is difficult to find one that suites our purposes. One potential solution that came to me is to create a GUI framework who's API resembles HTML/CSS. This would allow for things like padding, margins, borders and colours to be handled through a sort of CSS API while the content would be organized using the HTML part of the API. It might look something like this: public class OptionsScreen extends Document { public OptionsScreen() { // You would set the style (like CSS style) through the constructor. Div content = new Div(new Style(new Padding(5), Color.BLACK)); // Then build up a tree of elements which can each have their own style's. // Each element knows how to draw itself, but it doesn't have to worry about // manually handling things like padding. // content.addChild(new P("This is a paragraph", new Style(new Padding(), Color.RED))); Ul list = new Ul(); list.addChild(new Li("item 1")); list.addChild(new Li("item 2")); content.addChild(list); addChild(content); } } I can imagine this making it easier to customize the UI of our app (which is very important) with different fonts, colours and layouts. Does this idea belong on The Daily WTF or do you think there is some promise?

    Read the article

  • Patterns: Local Singleton vs. Global Singleton?

    - by Mike Rosenblum
    There is a pattern that I use from time to time, but I'm not quite sure what it is called. I was hoping that the SO community could help me out. The pattern is pretty simple, and consists of two parts: A singleton factory, which creates objects based on the arguments passed to the factory method. Objects created by the factory. So far this is just a standard "singleton" pattern or "factory pattern". The issue that I'm asking about, however, is that the singleton factory in this case maintains a set of references to every object that it ever creates, held within a dictionary. These references can sometimes be strong references and sometimes weak references, but it can always reference any object that it has ever created. When receiving a request for a "new" object, the factory first searches the dictionary to see if an object with the required arguments already exits. If it does, it returns that object, if not, it returns a new object and also stores a reference to the new object within the dictionary. This pattern prevents having duplicative objects representing the same underlying "thing". This is useful where the created objects are relatively expensive. It can also be useful where these objects perform event handling or messaging - having one object per item being represented can prevent multiple messages/events for a single underlying source. There are probably other reasons to use this pattern, but this is where I've found this useful. My question is: what to call this? In a sense, each object is a singleton, at least with respect to the data it contains. Each is unique. But there are multiple instances of this class, however, so it's not at all a true singleton. In my own personal terminology, I tend to call the factory method a "global singleton". I then call the created objects "local singletons". I sometimes also say that the created objects have "reference equality", meaning that if two variables reference the same data (the same underlying item) then the reference they each hold must be to the same exact object, hence "reference equality". But these are my own invented terms, and I am not sure that they are good ones. Is there standard terminology for this concept? And if not, could some naming suggestions be made? Thanks in advance...

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Rails learn's confusion

    - by Steve
    This is a beginner's rails learning confusion. When I learn rails, from time to time, I feel frustrated on rails' principle "Convention over Configuration". Rails uses heavily on conventions. A lot of them are just naming conventions. If I forget a convention, I will either use the wrong naming and get unexpected result or get things magically done but don't understand how. Sometimes, I think of configuration. At least configuration lists everything clearly and nothing is in fog. In rails, there seems a hidden, dark contract between you and the machine. If you follow the contract, you communicate well. But a beginner usually forgets items listed on the contract and this usually leads to confusion. That's why when I first pick up rails, I feel like it is somehow difficult to learn. Besides, there are many other things that could be new to a learner, such as using git, using plugins from community, using RESTful routing style, using RSpec. All these are new and come together in learning ruby and rails. This definitely adds up difficulties for a beginner. In contrast, if you learn php, it wouldn't be that bad. You can forget many things and focus on learning php itself. You don't need to learn database handling if you know SQL already(in rails, you need to learn a whole new concept migration), you don't have to learn a new decent unit test(in rails, usually they teach RSpec along the way because rails is agile and you should learn test-driven development in the early learning stage), you don't have to learn a new version control(in rails, you will be taught about git anyway), you don't have to use complicated plugins(in rails, they usually use third-party plugins in textbook examples! what the hell? why not teach how to do a simplified similar thing in rails?), you don't have to worry RESTful style. All in all, when I learn php, I learn it quick and soon I start to write things myself. Learning php is similar to learning C/java. It tastes like those traditional languages. When I learn rails, it is more difficult. And I need to learn ruby as well (I believe many of you learn ruby just because of rails). Does anyone have the similar feeling as I have? How do you overcome it and start to master rails? Hints will be welcomed. Thank you.

    Read the article

  • Running OpenMPI on Windows XP

    - by iamweird
    Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

    Read the article

< Previous Page | 256 257 258 259 260 261 262 263 264 265 266 267  | Next Page >