Search Results

Search found 11961 results on 479 pages for 'boot arguments'.

Page 261/479 | < Previous Page | 257 258 259 260 261 262 263 264 265 266 267 268  | Next Page >

  • Remove first and last characters from a string in Lisp

    - by powerj1984
    I am passing in command line arguments to my Lisp program and they are formatted like this when they hit my main function: ("1 1 1" "dot" "2 2 2") I have a dot function and would like to call it directly from the argument, but first I must strip the " characters. I tried variations of this function: (defun remove-quotes (s) (setf (aref s 0) '"")) to no avail, Lisp complains that "" is not a member of base-char. Thanks!

    Read the article

  • LINQ Query returns nothing.

    - by gtas
    Why is this query returns 0 lines? There is a record matching the arguments. Deafkaw.Where(p => (p.ImerominiaKataxorisis >= aDate && p.ImerominiaKataxorisis <= DateTime.Now) && (p.Year == etos && p.IsYpodeigma == false) ).ToList(); Am i missing something?

    Read the article

  • JQuery UI popup elements not positioning correctly

    - by Okku
    I am using both JQuery UI Dialog and JQuery UI autocomplete both have the same erroneous behavior when they popup, the position is always 0,0! I have tried some different position arguments when popping up the dialog but non seems to help. Any clues? Is this a bug in the position calculation in JQuery? Or is this some css bug? Versions are 1.4.2 and 1.8.0

    Read the article

  • how get fully result from Asynchronism communication?

    - by rima
    Hi all refer to these post : here1 and here2 at last I solve my problem by build a asynchronous solution,and it work well!!! but there is a problem that i face with it,now my code is like this: class MyProcessStarter { private Process process; private StreamWriter myStreamWriter; private static StringBuilder shellOutput = null; public String GetShellOutput { get { return shellOutput.ToString(); }} public MyProcessStarter(){ shellOutput = new StringBuilder(""); process = new Process(); process.StartInfo.FileName = "sqlplus"; process.StartInfo.UseShellExecute = false; process.StartInfo.CreateNoWindow = true; process.OutputDataReceived += new DataReceivedEventHandler(ShellOutputHandler); process.StartInfo.RedirectStandardInput = true; process.StartInfo.RedirectStandardOutput = true; //process.StartInfo.RedirectStandardError = true; process.Start(); myStreamWriter = process.StandardInput; process.BeginOutputReadLine(); } private static void ShellOutputHandler(object sendingProcess,DataReceivedEventArgs outLine) { if (!String.IsNullOrEmpty(outLine.Data)) shellOutput.Append(Environment.NewLine + outLine.Data); } public void closeConnection() { myStreamWriter.Close(); process.WaitForExit(); process.Close(); } public void RunCommand(string arguments) { myStreamWriter.WriteLine(arguments); myStreamWriter.Flush(); process.WaitForExit(100); Console.WriteLine(shellOutput); Console.WriteLine("============="+Environment.NewLine); process.WaitForExit(2000); Console.WriteLine(shellOutput); } } and my input is like this: myProcesStarter.RunCommand("myusername/mypassword"); Console.writeline(myProcesStarter.GetShellOutput); but take a look at my out put: SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. ============= SQL*Plus: Release 11.1.0.6.0 - Production on Thu May 20 11:57:38 2010 Copyright (c) 1982, 2007, Oracle. All rights reserved. Enter user-name: Connected to: Oracle Database 11g Enterprise Edition Release 11.1.0.6.0 - Production With the Partitioning, OLAP, Data Mining and Real Application Testing options as u see the output for run a function is not same in different time!So now would you do me a faver and help me that how I can wait until all the output done in other mean how I can customize my process to wait until output finishing ?? because I want to write a sqlcompiler so I need the exact output of shell. plz help me soon.thanxxxxxxxxxxxx :X

    Read the article

  • Good policy to force all developers in a company to use the same IDE?

    - by Henrik
    In my organization they are thinking about rolling out Eclipse company wide but I prefer using another editor (UltraEdit). I do not have any good arguments against this except subjective opinions that a developer should get to use whatever he/she wants as long as he's productive enough. This to make the developer a happy employee :-) Do you guys think its a good policy to force all developers in the same company to use the same IDE? Would there be any technical (dis)advantages of this decision?

    Read the article

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • Simulating "focus" and "blur" in jQuery .live() method...

    - by Jonathan Sampson
    Update: As of jQuery 1.4, $.live() now supports focusin and focusout events. jQuery currently1 doesn't support "blur" or "focus" as arguments for the $.live() method. What type of work-around could I implement to achieve the following: $("textarea") .live("focus", function() { foo = "bar"; }) .live("blur", function() { foo = "fizz"; }); 1. 07/29/2009, version 1.3.2

    Read the article

  • Memory Allocation Error in MySQL

    - by Chinjoo
    I am using MySql ODBC driver with .Net 3.5. I have created a stored procedure in MySQl which accepts around 15 parameters with types like datetime, varchar, Int32, Int64 etc.. When I run the SP from the query window with the arguments provided, it runs fine. But whwn I test using the .Net application, it gives exception with "Memory allocation error", MySQL native error code is 4001. Any help will be much appreciated.

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Find the version of an installed npm package

    - by Laurent Couvidou
    How to find the local version of an installed node.js/npm package? This prints the version of npm itself: npm -v <package-name> This prints a cryptic error: npm version <package-name> For some reason, probably because of the weird arguments ordering, or because of the false positives mentioned above, I just can't remember the proper command. So this question is a note for self that might help others.

    Read the article

  • What are the reasons *not* to use a GUID for a primary key?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Are GUID primary keys bad in theory, or just practice?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

< Previous Page | 257 258 259 260 261 262 263 264 265 266 267 268  | Next Page >