Search Results

Search found 21828 results on 874 pages for 'program x'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 261/874 | < Previous Page | 257 258 259 260 261 262 263 264 265 266 267 268  | Next Page >

  • Python: How to quit CLI when stuck in blocking raw_input?

    - by christianschluchter
    I have a GUI program which should also be controllable via CLI (for monitoring). The CLI is implemented in a while loop using raw_input. If I quit the program via a GUI close button, it hangs in raw_input and does not quit until it gets an input. How can I immediately abort raw_input without entering an input? I run it on WinXP but I want it to be platform independent, it should also work within Eclipse since it is a developer tool. Python version is 2.6. I searched stackoverflow for hours and I know there are many answers to that topic, but is there really no platform independent solution to have a non-blocking CLI reader? If not, what would be the best way to overcome this problem? Thanks

    Read the article

  • soft stoppped working

    - by Jack Morton
    this is might be really weird, but I have no idea what kinda wizardry of this. Basically, my Visual Studio stopped responding to my changes, it stopped building solution. I can comment code, which would completely ruin the logic of program, and Visual Studio will still run program that I guess it has in memory. It's really annoying, and I have no idea what it is. I keep restarting software, but it's still does the same. It's a licensed software. I was wondering If someone knew what was going on. Thanks!

    Read the article

  • how to find which libraries to link to? or, how can I create *-config (such as sdl-config, llvm-con

    - by numeric
    Hey, I want to write a program that outputs a list of libraries that I should link to given source code (or object) files (for C or C++ programs). In *nix, there are useful tools such as sdl-config and llvm-config. But, I want my program to work on Windows, too. Usage: get-library-names -l /path/to/lib a.cpp b.cpp c.cpp d.obj Then, get-library-names would get a list of function names that are invoked from a.cpp, b.cpp, c.cpp, and d.obj. And, it'll search all library files in /path/to/lib directory and list libraries that are needed to link properly. Is there such tool already written? Is it not trivial to write a such tool? How do you find what libraries you should link to? Thanks.

    Read the article

  • Ruby on Rails: Modules vs. Classes

    - by Jack
    I'm trying to add a function that will be accessible throughout all parts of my program. I want something like: def GlobalFunctions.my_function(x,y) puts x + y end to be accessible for all models. Specifically I am trying to use a function like this in my seeds.rb file but I am most likely going to be reusing the code and don't want any redundancy. Now I know I can make a simple class, but I could also make a module. What are some reasons to go in either direction? And once I've decided on which type to use, how do I make it accessible throughout the whole program? I have tried a module, but I keep getting " Expected app/[module file] to define [ModuleName]"

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • problem with exporting a customized form from dll

    - by mavric
    I'm working on an application so i have write an dll which contain a form with some additional work and methods. so in the beginning of my program the thread launch this form (from my dll) to get some informations and then hide it and initialize some components and the application form and then show it. when the thread come the line where it define new instance of the exported form "MyForm inputform = new MyForm();" it throw an Exception called "Top-level control cannot be added to a control." so i don't know what to do ?!!. i tried to take the code of the form from the dll source code and put it in the main program and it works.... .but still i want to know what happen and what impede my application from run that form from my dll. thanks.

    Read the article

  • Count Clicks in excel

    - by rockbala
    Hi, Can some one recommend any free program which counts the number of clicks Clicked inside a cell. For Example Imagine something like Spreadsheet I click on A1 cell the value shows 1 Then I click A1 cell again the value shows 2 and so on If I click A3 cell somewhere in between the click count on Cell A3 shows 1 and so on If something like this can be achieved as a macro with in excel (2003 please) please suggest or any other free program that you might be aware about, please do let me know. I appreciate all your help and thank you in advance. rockbala

    Read the article

  • Boost Shared Pointers and Memory Management

    - by Izza
    I began using boost rather recently and am impressed by the functionality and APIs provided. In using boost::shared_ptr, when I check the program with Valgrind, I found a considerable number of "Still reachable" memory leaks. As per the documentation of Valgrind, these are not a problem. However, since I used to use the standard C++ library only, I always made sure that any program written is completely free from memory leaks. My question is, are these memory leaks something to worry about? I tried using reset(), however it only decrements the reference count, doesn't deallocate memory. Can I safely ignore these, or any way to forcibly deallocate the memory allocated by boost::shared_ptr? Thank you.

    Read the article

  • input tags with array

    - by Dumbledore of flash
    Hi , Recently i am doing a project in which i encountered a strange problem this is the program which previous programmer did MPAN <input name="mpan[]" id="mpan[]" value="" maxlength="2" size="2" > ///this one to read <input name="mpan[]" id="mpan[]" value="" maxlength="3" size="3"> <input name="mpan[]" id="mpan[]" value="" maxlength="3" size="3"> <input name="mpan[]" id="mpan[]" value="" maxlength="2" size="2"> ///this one to read <input name="mpan[]" id="mpan[]" value="" maxlength="11" size="12"> i have to read it from a javascript what i did 1) document.getElementById("mpan").value == not reading script does not work 2) document.getElementById("mpan[]").value == reading first one 3) document.getElementById("mpan[0]").value == script does not work 4) document.getElementById("mpan[3]").value == script does not work can any body tell me how to read this from a javascript program

    Read the article

  • unittest in python: ignore an import from the code I want to test

    - by vaidab
    I have a python program that imports pythoncom (and uses pythoncom.CoCreateInstance from it). I want to create a unittest for the program logic without it importing pythoncom (so I can run the test on Linux as well). What options are there? Can I do it without modifying the system under test? What I found so far: sys.modules["pythoncom"] = "test" import module_that_imports_pythoncom My problem with it is if I have: from pythoncom.something import something I'll get: ImportError: No module named something.something And sys.modules["something.something"] or sys.modules["pythoncom.something.something"] doesn't work. Any ideas?

    Read the article

  • What's this UI pattern called?

    - by Bears will eat you
    I'm trying to figure out what this sort of thing is called, and eventually how I can create one in a web browser. It looks like this (screenshot of the first app that came to mind): The specific component/pattern I'm looking for is the two list boxes ("Included Gear" and "Excluded Gear") that represent inclusion/exclusion of items from a set. I'm not really looking for the WPF name (if there is one) but it might be helpful. I am looking for the name of this thingy, if there is one, and if you really want to make my day, you can point me toward a jQuery or YUI way of making one of these dealies in a browser. In case you were wondering, the screenshot is a World of Warcraft gear optimization program. Go figure why it was the first program that came to mind when I was trying to think of an example.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Make a USB Device, Control It In Java

    - by yar
    I'm thinking about making a physical controller (device?) with knobs, buttons, and LEDs. I'd like to interact with it using Java (respond to the knobs, light up LEDs, etc). The reason I mention Java is two-fold: first, I know Java well1. Second, I've written the rest of the program I need to interface with in Java (though there are ways to talk to the Java program from another language). I would like the device to connect via USB and be (computer-)platform independent. I haven't the slightest idea of where to start, except to start reading the Arduino website. Is this my best/only option? Is there something better suited for communicating with Java? Note: I know that Arduino has something to do with Java (not sure what), but it seems like code must be written in a subset of C. How would I get moving on this topic? 1 - No laughter, please.

    Read the article

  • Making commercial Java software

    - by roddik
    Hi. I intend to make some software to be sold over internet. I've only created open-source before, so I have really no idea of how to protect it from being cracked and distributed as warez. Bearing in mind that I know like two programms that aren't either cracked or not really useful I decided that the only more or less reliable way may look like this: Connect to a server and provide licensing info and some sort of hardware summary info If everything is fine, the server returns some crucial missing parts of the program bound to that certain pc along with the usage limit of say 2 days That crucial stuff is not saved to hard drive, so it is downloaded every time the program starts, if the programm runs more than 2 days, data is downloaded again If the same info is used from different computers, suspend the customer account What do you think about this? It may seem a bit to restrictive, but I'd better make less sales at first then eventually see my precious killer app downloaded for free. Anyways, first I need some basic theory/tutorials/guides about how to ensure that user only uses a certain Java app if he has paid for it, so please suggest some. Thanks

    Read the article

  • Multithreaded SDL error in C++

    - by wyatt
    I'm building a program in C++, using SDL, and am occasionally receiving this error: * glibc detected * ./assistant: double free or corruption (!prev) It's difficult to replicate, so I can't find exactly what's causing it, but I just added a second thread to the program, and neither thread run on its own seems to cause the error. The threads don't share any variables, though they both run the functions SDL_BlitSurface and SDL_Flip. Could running these concurrently throw up such an error, or am I barking up the wrong tree? If this is the cause, should I simply throw a mutex around all SDL calls? Thanks

    Read the article

  • explain this macro

    - by deostroll
    #define __T(x) L ## x Found in code from one of the MFC source header file. It is mostly used for converting strings to ........ (I don't know what). If I am correct it converts strings to LPCTSTR...don't know what that type is either... I can't seem to convert char* into LPCTSTR. While MFC file handling, the following code will always return error while trying to open the file... char* filepath = "C:\\Program Files\\Microsoft Office\\Office12\\BITMAPS\\STYLES\\GLOBE.WMF"; if( !file.Open((LPCTSTR)filepath , CFile::modeRead, &fexp) ) { fexp.ReportError(); return 1; } But instead if I wrote it this way, it doesn't give error: if( !file.Open( _T("C:\\Program Files\\Microsoft Office\\Office12\\BITMAPS\\STYLES\\GLOBE.WMF") , CFile::modeRead, &fexp) ) { fexp.ReportError(); return 1; } I am looking at passing a variable as the first argument to the CFile::Open() method.

    Read the article

  • Using a database/index sequential file independently of the Unix distribution

    - by Helper Method
    What I'm planning to do is a) parse a file for some lines matching a regular expression b) store the match in some sort of database / file so I don't have to do the parsing again and again c) call another program passing the matches as arguments While I can imagine how to do a) and c), I'm a little bit unsure about b). The matches are of the form key:attribute1:attribute2:attribute3 where attribute 2 may be optional. I'm thinking of storing the results in a simple database but the problem is the database needs to available on a number of Unix platform for the program to work. Are there any (simple) databases which can be found on any Unix platforms? Or should I use some sort of index-sequential file?

    Read the article

  • [C++] Needed: A simple C++ container (stack, linked list) that is thread-safe for writing

    - by conradlee
    I am writing a multi-threaded program using OpenMP in C++. At one point my program forks into many threads, each of which need to add "jobs" to some container that keeps track of all added jobs. Each job can just be a pointer to some object. Basically, I just need the add pointers to some container from several threads at the same time. Is there a simple solution that performs well? After some googling, I found that STL containers are not thread-safe. Some stackoverflow threads address this question, but none form a consensus on a simple solution.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 257 258 259 260 261 262 263 264 265 266 267 268  | Next Page >