Search Results

Search found 62759 results on 2511 pages for 'view first'.

Page 262/2511 | < Previous Page | 258 259 260 261 262 263 264 265 266 267 268 269  | Next Page >

  • zoomfactor value in CGAffineTransformMakeScale in iPhone

    - by suse
    Hello, 1) I'm doing pinch zoom on the UIImageView , how should i decide upon the zoomfactor value, because when the zoomfactor value goes beyond 0[i.e negative value]the image is gettig tilted, which i dont want it to happen. how to avoid this situation. 2) Y is the flickring kind of rotationis happening, Y not the smooth rotation? ll this be taken care by CGAffineTransformMakeScale(zoomfactor,zoomfactor);method? This is what i'm doing in my code: zoomFactor = 0;// Initially zoomfactor is set to zero - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event{ NSLog(@" Inside touchesBegan .................."); NSArray *twoTouches = [touches allObjects]; UITouch *first = [twoTouches objectAtIndex:0]; OPERATION = [self identifyOperation:touches :first]; NSLog(@"OPERATION : %d",OPERATION); if(OPERATION == OPERATION_PINCH){ //double touch pinch UITouch *second = [twoTouches objectAtIndex:1]; f_G_initialDistance = distanceBetweenPoints([first locationInView:self.view],[second locationInView:self.view]); } NSLog(@" leaving touchesBegan .................."); } - (void)touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { NSLog(@" Inside touchesMoved ................."); NSArray *twoTouchPoints = [touches allObjects]; if(OPERATION == OPERATION_PINCH){ CGFloat currentDistance = distanceBetweenPoints([[twoTouchPoints objectAtIndex:0] locationInView:self.view],[[twoTouchPoints objectAtIndex:1] locationInView:self.view]); int pinchOperation = [self identifyPinchOperation:f_G_initialDistance :currentDistance]; G_zoomFactor = [self calculateZoomFactor:pinchOperation :G_zoomFactor]; [uiImageView_G_obj setTransform:CGAffineTransformMakeScale(G_zoomFactor, G_zoomFactor)]; [self.view bringSubviewToFront:resetButton]; [self.view bringSubviewToFront:uiSlider_G_obj]; f_G_initialDistance = currentDistance; } NSLog(@" leaving touchesMoved .................."); } - (void)touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { NSLog(@" Inside touchesEnded .................."); NSArray *twoTouches = [touches allObjects]; UITouch *first = [twoTouches objectAtIndex:0]; if(OPERATION == OPERATION_PINCH){ //do nothing } NSLog(@" Leaving touchesEnded .................."); } Thank You.

    Read the article

  • Using a Context Menu to delete from a SQLite database in Android

    - by LordSnoutimus
    Hi, I have created a list view that displays the names and dates of items stored in a SQLite database, now I want to use a Context Menu to modify these items stored in the database such as edit the name, delete, and view. This is the code for the list view: public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.listview); SQLiteDatabase myDB = null; myDB = this.openOrCreateDatabase(MY_DB_NAME, MODE_PRIVATE, null); Cursor cur = myDB.rawQuery("SELECT _id, trackname, tracktime" + " FROM " + MY_DB_TABLE, null); ListAdapter adapter = new SimpleCursorAdapter(this, R.layout.listview, cur, new String[] { Constants.TRACK_NAME, Constants.TRACK_TIME}, new int[] { R.id.text1, R.id.text2}); ListView list = (ListView)findViewById(R.id.list); list.setAdapter(adapter); registerForContextMenu(list); } and the Context Menu... public void onCreateContextMenu(ContextMenu menu, View v, ContextMenuInfo menuInfo) { super.onCreateContextMenu(menu, v, menuInfo); menu.setHeaderTitle("Track Options"); menu.add(0, CHANGE_NAME, 0, "Change name"); menu.add(0, VIEW_TRACK, 0, "View track"); menu.add(0, SEND_TRACK, 0, "Send track"); menu.add(0, DELETE_TRACK, 0, "Delete track"); } I have used a Switch statement to control the menu items.. public boolean onContextItemSelected(MenuItem item) { switch (item.getItemId()){ case CHANGE_NAME: changename(); return true; case DELETE_TRACK: deletetrack(); return true; default: return super.onContextItemSelected(item); } So how would I go ahead and map the deletetrack(); method to find the ID of the track stored in the database to the item that has been selected in the list view?

    Read the article

  • Displaying Flex Object References

    - by Pie21
    I have a bit of a memory leak issue in my Flex application, and the short version of my question is: is there any way (in AcitonScript 3) to find all live references to a given object? What I have is a number of views with presentation models behind each of them (using Swiz). The views of interest are children of a TabNavigator, so when I close the tab, the view is removed from the stage. When the view is removed from the stage, Swiz sets the model reference in the view to null, as it should. I also removeAllChildren() from the view. However when profiling the application, when I do this and run a GC, neither the view nor the presentation model are freed (though both set their references to each other to null). One model object used by the view (not a presenter, though) IS freed, so it's not completely broken. I've only just started profiling today (firmly believing in not optimising too early), so I imagine there's some kind of reference floating around somewhere, but I can't see where, and what would be super helpful would be the ability to debug and see a list of objects that reference the target object. Is this at all possible, and if not natively, is there some light-weight way to code this into future apps for debugging purposes? Cheers.

    Read the article

  • how to scroll in android???

    - by antony
    I create a program to add check boxes dynamically.But i cant scroll down.I add the code here ,Pls HELP...... package dyntodo.pack; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.widget.CheckBox; import android.widget.EditText; import android.widget.LinearLayout; import android.widget.Button; import android.widget.TextView; public class dynact extends Activity { @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); TextView tv = (TextView)findViewById(R.id.textview); final EditText task = (EditText)findViewById(R.id.task); Button add = (Button)findViewById(R.id.add); add.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { addTask(task.getText().toString()); } }); } public void addTask(String task) { LinearLayout layout = (LinearLayout) findViewById(R.id.layout); final CheckBox chk = new CheckBox(this); //Creating checkbox objects….. chk.setText(task); layout.addView(chk); chk.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { chk.setVisibility(5); } }); } }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • android: consume key press, bypassing framework processing

    - by user360024
    What I want android to do: when user presses a single key, have the view respond, but do so without opening a text area and displaying the character associated with the key that was pressed, and without requiring that the Enter key be pressed, and without requiring that the user press Esc to make the text area go away. For example, when user presses "u" (and doesn't press Enter), that means "undo the last action", so the controller and model immediately undo the last action, then the view does an invalidate() and user sees that their last action has been undone. In other words the "u" key press should be silently processed, such that the only visual result is that user's last action has been undone. I've implemented OnKeyListener and provided an onKey() method: the class: public class MyGameView extends View implements OnKeyListener{ in the constructor: //2010jun06, phj: With onKey(), helps let this View consume key presses // before the framework gets a chance to consume the key press. setOnKeyListener((View.OnKeyListener)this); the onKey() method: public boolean onKey(View v, int keyCode, KeyEvent event) { if (keyCode == KeyEvent.KEYCODE_R) { Log.d("BWA", "In onKey received keycode associated with R."); } return true; // meaning the event (key press) has been consumed, so // the framework should not handle this event. } but when user presses "u" key on the emulator keypad, a textarea is opened at the bottom of the screen, the "u" charater is displayed there, and the onKey() method doesn't execute until user presses the Enter key. Is there a way to make android do what I want? Thanks,

    Read the article

  • Jquery load DIV inside another DIV at same page

    - by Sergio
    HTML: <div class="someclass" rel="first">text 1</div> <div class="someclass" rel="second">text 2</div></div></div> <div class="info_ly">here is some text</div> <div class="first" > the first DIV </div> <div class="second" > the second DIV </div> CSS: .first{ display:none} .second{ display:none} Jquery: $(".someclass").click(function() { $(".info_ly").html($(this).attr('rel')); }); I want to call and load the "rel" DIV inside "info_ly" DIV. With this Jquery code I get only text "first" or "second" inside "info_ly" DIV. How can I load the DIV with the class "first" or DIV with the class "second" inside "info_ly" DIV?

    Read the article

  • Why has my computer started to make noises when I turn it on after I put it into sleep mode for the first time a week ago?

    - by Acid2
    I would usually have my pc on all day and fully shut it down at night time before I went to bed. I decided to put it into sleep mode instead the other day and everything was fine but when I woke it from sleep, I was presented with the blue screen of death and it started with some weird noise that sounded like some spinning part was off balance or possibly hitting something periodically. Sounds like it could be a fan or maybe the HDD. I'm not sure why sleep mode would mess up the hardware. Anyway, now sometimes, randomly, when I turn my computer on from a previous shut down, I still get to hear the noise but the start-up is normal. Sometimes I don't hear anything for the entire duration while I have it on and sometimes it goes away after a few minutes and sometimes it doesn't and I have to restart, like it isn't going away right now. I can hear the noise as I type this. Anyone got possible solutions? I don't want to open the system and mess up other stuff. I'm also not sure if I should take it somewhere to have it fixed - it might not make the noise then and work like normal and nothing would seem like needing to be fixed. Add: I'm running Windows 7, if that's of any relevance.

    Read the article

  • iPhone: Calling dealloc on parentViewController causes an exception

    - by arielcamus
    Hi, I'm dealing with viewDidUnload and dealloc methods and I've founded a problem when calling [super dealloc]; in parent view controller. I have a lot of view controllers with custom code which I have putted outside on a parent view controller. So, when defining my view controllers I set a reference to the super class: @interface LoginViewController : AbstractViewController Then, at the dealloc method I call the AbstractViewController dealloc method: //(Login View Controller code) - (void)dealloc { [user release]; [passwd release]; [super dealloc]; } [super dealloc] execute the following code: //(Abstract View Controller code) - (void)dealloc { [dbUtils release]; [loadingView release]; [super dealloc]; } If I simulate a memory warning on iPhone Simulator, the following exception is thrown: 2010-03-03 11:27:45.805 MyApp[71563:40b] Received simulated memory warning. 2010-03-03 11:27:45.808 MyApp[71563:40b] *** -[LoginViewController isViewLoaded]: message sent to deallocated instance 0x13b51b0 kill quit However, if I comment the [super dealloc] line in AbstractViewController the exception is not thrown and my app still running. Thank you for your help once again!

    Read the article

  • Weird exception: Cannot cast String to Boolean when using getBoolean

    - by La bla bla
    I'm getting a very weird error. I have 2 activities. On both I'm getting the SharedPreferences using MODE_PRIVATE (if it matters) by sp = getPreferences(MODE_PRIVATE); on each activity's onCreate() I'm calling sp.getBoolean(IntroActivity.SHOW_INTRO, true) On the IntroActivity this works fine. But when I'm trying in the main activity, I'm getting this 10-12 04:55:23.208: E/AndroidRuntime(11668): FATAL EXCEPTION: main 10-12 04:55:23.208: E/AndroidRuntime(11668): java.lang.ClassCastException: java.lang.String cannot be cast to java.lang.Boolean 10-12 04:55:23.208: E/AndroidRuntime(11668): at android.app.SharedPreferencesImpl.getBoolean(SharedPreferencesImpl.java:242) 10-12 04:55:23.208: E/AndroidRuntime(11668): at com.lablabla.parkme.ParkMeActivity$2.onClick(ParkMeActivity.java:194) 10-12 04:55:23.208: E/AndroidRuntime(11668): at android.view.View.performClick(View.java:4084) 10-12 04:55:23.208: E/AndroidRuntime(11668): at android.view.View$PerformClick.run(View.java:16966) 10-12 04:55:23.208: E/AndroidRuntime(11668): at android.os.Handler.handleCallback(Handler.java:615) 10-12 04:55:23.208: E/AndroidRuntime(11668): at android.os.Handler.dispatchMessage(Handler.java:92) 10-12 04:55:23.208: E/AndroidRuntime(11668): at android.os.Looper.loop(Looper.java:137) 10-12 04:55:23.208: E/AndroidRuntime(11668): at android.app.ActivityThread.main(ActivityThread.java:4745) 10-12 04:55:23.208: E/AndroidRuntime(11668): at java.lang.reflect.Method.invokeNative(Native Method) 10-12 04:55:23.208: E/AndroidRuntime(11668): at java.lang.reflect.Method.invoke(Method.java:511) 10-12 04:55:23.208: E/AndroidRuntime(11668): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:786) 10-12 04:55:23.208: E/AndroidRuntime(11668): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:553) 10-12 04:55:23.208: E/AndroidRuntime(11668): at dalvik.system.NativeStart.main(Native Method) I made sure that I'm not putting a String somewhere in the middle with that same key Any ideas? Thanks! EDIT: some code: //onCreate() sp = getPreferences(MODE_PRIVATE); // other method boolean showIntro = sp.getBoolean(IntroActivity.SHOW_INTRO, true); // Exception is here showIntroCheckBox.setChecked(showIntro); If it matters, the code which throws the exception is inside a button's onClick

    Read the article

  • Avoiding mass propagation of properties and events for exposure to ViewModels.

    - by firoso
    I have an MVVM application I am developing that is to the point where I'm ready to start putting together a user interface (my client code is largely functional) I'm now running into the issue that I'm trying to get my application data to where I need it so that it can be consumed by the view model and then bound to the view. Unfortunately, it seems that I've either got a few structural oversights, or I'm just going to have to face the reality that I need to be propogating events and raising excessive amounts of errors to notify view models that thier properties have changed. Let me go into some examples of my issue: I have a class "Unit" contained in a class "Test", contained in a class "Session" contained in a class "TestManager" which is contained in "TestDataModel" which is utilized by "TestViewModel" which is databound to by my "TestView" .... WHOA. Now, consider that Unit (the bottom of the heiarchy) has a property called "Results" that is updated periodically, I want to expose that to my viewmodel and then databind it to my view, trouble is, the only way I can really think to do this is to perpetuate events WAY up a chain that say "I've been updated!" and then request the new value... This seems like an aweful way to do this. Alternatively, I could register a static event and raise it, and have the appropriate "Unit view model" grab the event and request the update. This SEEMS better... but... static events? Is that a taboo idea? Also, having an expression like: TestDataModel.TestManager.Session.Test.Unit.Results[i] Seems REALLY gross to have on a View Model. I know this all reeks of a bad design issue, but I can't figure out what I did wrong? Should I be using more singleton/container controlled lifetimes type objects? Register object instances with static helper containers? Obviously these are hard questions to answer without being intimate with the existing structure, but if you've run into situations like this, what did you do to refactor? Should I just live with this, add mass events, and propogate them?

    Read the article

  • .NET MVC: How to fix Visual Studio's lack of awareness of CSS classes in partial views?

    - by Mega Matt
    Hi all, This has been sort of an annoyance for me for a while. I make pretty heavy use of partial views in MVC, and am using Visual Studio 2008 to develop. The problem is that when I give html elements a class in a partial view (<div class="someClass">), it will underline them in green like it doesn't know what they are. I realize this is because I'm in a partial view, and haven't put link tags anywhere in that file for it to know where the CSS is (the link tags are in the main view that renders the partial view). The CSS still works fine on my site because the browser will render all views as one long html page anyway, but it's really annoying to look through my partial views and see all of my classes underlined in green. Is there a way that I can still tell Visual Studio that those classes exist somewhere, from the partial view? I figured there has to be a way to let it know, but am not sure what it is. Maybe a way to import the stylesheets from the parent view? Thanks for your help.

    Read the article

  • DOM class injection in PHP

    - by Adam Kiss
    idea Via jQuery, I was able to mark all :first-child and :last-child elements in document (well, almost all :)) with class first which could I later style (i.e. first li in ul#navigation would be easily adressable as ul#navigation .first). I used following code: var $f = $('*:first-child') $f.addClass('first'); var $l = $('body *:last-child') $l.addClass('last'); question Now, my question is if it's possible to do the same via php, so non-JS users/gadgets could have the same effects and additional styling and also it would be less overkill on browser. So, is it possible to capture output, parse it as html and inject this class easily in php?

    Read the article

  • How to call a method from another class that's been instantiated within the current class

    - by Pavan
    my screen has a few views like such __________________ | _____ | | | | | //viewX is a video screen | | | | | viewX | vY | | //viewY is a custom uiview i created. | |____| | //it contains a method which i would like to call that toggles |_________________| //the hidden property of this view. and when it hides, a little | | //button is replaced no the top right corner on top of viewX | viewZ | //the video layer | | |_________________| //viewZ is a view containing many square views - thumbnails. my question is, i dont know how to register for touch events so that it recognises any touch event on no matter which view the user touches the screen.. atm im handling the touch events for each view inside it. so all works well... however what im trying to do is that when the user taps anywhere else on the screen but on viewY, viewY should dissapear by calling that method in the viewY class. this viewY class is instantiated and has no xib file attached to it. the uiview is created progammatically in the viewY class. this whole class for viewY behviour is instantiated in viewX - the video view. my boss says add delegates.. although i have now clue how to do that... any help? is there anyway i can just make it really simple and be able to say REMOVE VIEW no matter which class im calling from? Also ive seen other people achieve this by using these funky arrows - ... <- etc.. although im not sure if thats what i need or how to implement such a thing. ah i think ive made my question quite complicated but i really mean it to be a simple one, and know it can be done in an easy way!

    Read the article

  • Help with this reg. exp. in PHP

    - by Jonathan
    Hi, i don't know about regular expressions, I asked here for one that: gets either anything up to the first parenthesis/colon or the first word inside the first parenthesis. This was the answer: preg_match('/(?:^[^(:]+|(?<=^\\()[^\\s)]+)/', $var, $match); I need an improvement, I need to get either anything up to the first parenthesis/colon/quotation marks or the first word inside the first parenthesis. So if I have something like: $var = 'story "The Town in Hell"s Backyard'; // I get this: $match = 'story'; $var = "screenplay (based on)"; // I get this: $match = 'screenplay'; $var = "(play)"; // I get this: $match = 'play'; $var = "original screen"; // I get this: $match = 'original screen'; Thanks!

    Read the article

  • ServiceStack razor default page

    - by Tom
    Say I have 2 pages /NotADefault.cshtml /Views/Default.cshtml Question 1. Now I run it, page A always gets called implicitly as start-up default page no matter what I name it. Page B will only be called when I explicitly call localhost/View/Default. How do I make page B (the one in View folder) my default page? Question 2. I also have NotADefaultService.cs and DefaultService.cs. I give each page a Service class at the back. However, when page A is called NotADefaultService.cs never gets called. Only DefaultService.cs gets called when page B is called... My observation is that only the pages in the View folder will get their back-end service class working. Outside of View folder it doesn't work. Combining Q1 and Q2. How do I: Option 1. get the backend service class working under / root outside "View" folder? OR Option 2. appoint /View/Default.schtml as my default at start-up where the service class can be hit?

    Read the article

  • Excel file reading with 2007 office connection string.

    - by p-vasuu
    Actually in my system having 2007 office then i am reading the 2003 .xls file with using the 2007 connection string string ConnectionString = "Provider=Microsoft.ACE.OLEDB.12.0;Data Source=" + Filename + ";Extended Properties=\"Excel 8.0;HDR=YES;\""; data is not reading. But if the first row first column data length is lessthen 255 then the following first columns data is cutting up to 255 character. If the First row first column is morethan the 255 character then the following first columns data is reading fine. Is there any back word computability is there?

    Read the article

  • Packages name conflicting with getters and setters?

    - by MrKishi
    Hello, folks. So, I've came across this compilation error a while ago.. As there's an easy fix and I didn't find anything relevant at the time, I eventually let it go. I just remembered it and I'm now wondering if this is really part of the language grammar (which I highly doubt) or if it's a compiler bug. I'm being purely curious about this -- it doesn't really affect development, but it would be nice to see if any of you have seen this already. package view { import flash.display.Sprite; public class Main extends Sprite { private var _view:Sprite = new Sprite(); public function Main() { this.test(); } private function test():void { trace(this.view.x, this.view.y); //1178: Attempted access of inaccessible property x through a reference with static type view:Main. //1178: Attempted access of inaccessible property y through a reference with static type view:Main. //Note that I got this due to the package name. //It runs just fine if I rename the package or getter. } public function get view():Sprite { return this._view; } } }

    Read the article

  • Troubles moving a UIView.

    - by Joshua
    I have been trying to move a UIView by following a users touch. I have almost got it to work except for one thing, the UIView keeps flicking between two places. Here's the code I have been using: - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { NSLog(@"touchDown"); UITouch *touch = [touches anyObject]; firstTouch = [touch locationInView:self.view]; lastTouch = [touch locationInView:self.view]; [self.view setNeedsDisplay]; } - (void)touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { InSightViewController *contentView = [[InSightViewController alloc] initWithNibName:@"SubView" bundle:[NSBundle mainBundle]]; [contentView loadView]; UITouch *touch = [touches anyObject]; currentTouch = [touch locationInView:self.view]; if (CGRectContainsPoint(contentView.view.bounds, firstTouch)) { NSLog(@"touch in subView/contentView"); sub.frame = CGRectMake(currentTouch.x - 50.0, currentTouch.y, 130.0, 21.0); } NSLog(@"touch moved"); lastTouch = currentTouch; [self.view setNeedsDisplay]; } And here's what's been happening: http://cl.ly/Sjx

    Read the article

  • recursively reverse linked list.

    - by Amanda
    I am implementing a function to recursively reverse a linked-list, but getting seg-fault. typedef struct _node { int data; struct _node *next; } Node, *NodeP; NodeP recursiveReverseList(NodeP first){ if(first == NULL) return NULL; if(first->next == NULL) return head; NodeP rest = recursiveReverseList(head->next); rest->next = first; first->next = NULL; return first; } Can you please help. P.S. The iterative version is working fine though. Its not homework. Just practicing C.

    Read the article

  • Android :WindowManager$BadTockenException on Spinner Click

    - by Miya
    Hi, I have a spinner in my home.class. When I click on the spinner, the process is stopped showing exception that WindowManager$BadTockenException is caught. I am calling this home.class from main.class which extends ActivityGroup. If I am simply run only the home.class, the spinner is showing all items. But the problem is only with calling home.class from main.class. The following are my code. Please tell me why this is happened. main.class public class main extends ActivityGroup { public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); Intent intent=new Intent(this,home.class); View view=getLocalActivityManager().startActivity("1", intent.addFlags(Intent.FLAG_ACTIVITY_CLEAR_TOP)).getDecorView(); setContentView(view); } } home.class String[] country={"Please selects","US","INDIA","UK"}; Spinner s2 = (Spinner) findViewById(R.id.spinnerCountry); ArrayAdapter<CharSequence> adapterCountry=new ArrayAdapter(this,android.R.layout.simple_spinner_item,country); adapterCountry.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); s2.setAdapter(adapterCountry); s2.setOnItemSelectedListener(new OnItemSelectedListener() { public void onItemSelected( AdapterView<?> parent, View view, int position, long id) { countryName=country[position]; } public void onNothingSelected(AdapterView<?> parent) { countryName=country[0]; } }); Stack Thread [<1 main] (Suspended (exception WindowManager$BadTokenException)) AlertDialog(Dialog).show() line: 245 AlertDialog$Builder.show() line: 802 Spinner.performClick() line: 260 View$PerformClick.run() line: 9080 ViewRoot(Handler).handleCallback(Message) line: 587 ViewRoot(Handler).dispatchMessage(Message) line: 92 Looper.loop() line: 123 ActivityThread.main(String[]) line: 3647 Method.invokeNative(Object, Object[], Class, Class[], Class, int, boolean) line: not available [native method] Method.invoke(Object, Object...) line: 507 ZygoteInit$MethodAndArgsCaller.run() line: 839 ZygoteInit.main(String[]) line: 597 NativeStart.main(String[]) line: not available [native method] Thank You....

    Read the article

  • ViewController behaving oddly when pushed on the window

    - by ayazalavi
    I am using multiple controller during launch of an application in app delegate. One controller is for registration and the second controller is tabbar. tabbar was loading fine but when I pushed registration controller on window, contents went up by 20 units and I have good white blank screen at bottom. Therefore I recreated frame of my registration view controller in its viewdidload method and slided it 20 units down. The code is self.view.frame = CGRectMake(0, 20, self.view.frame.size.width, self.view.frame.size.height); and code in my app delegate for launch application was - (BOOL)application:(UIApplication *)application didFinishLaunchingWithOptions:(NSDictionary *)launchOptions { if (![self accountExists]) { //code if account does not exists on iphone app database self.registerAccount = [[registerViewController alloc] initWithNibName:@"registerViewController" bundle:nil]; [window addSubview:registerAccount.view]; } else if([self autoLoginForAnyAccount]){ //code for autologin to app } else { self.tabBarController.selectedIndex = 1; self.tabBarController.delegate = self; [window addSubview:tabBarController.view]; } [window makeKeyAndVisible]; return YES; } if anyone knows why there is a white space at bottom when registration controller is pushed then please share it with me.

    Read the article

  • Unknown ListView Behavior

    - by st0le
    I'm currently making a SMS Application in Android, the following is a code snippet from Inbox Listactivity, I have requested a cursor from the contentresolver and used a custom adapter to add custom views into the list. Now, in the custom view i've got 2 TextViews (tvFullBody,*tvBody*)... tvFullBody contains the Full SMS Text while tvBody contains a short preview (35 characters) The tvFullBody Visibility is by default set to GONE. My idea is, when the user clicks on a list item, the tvBody should dissappear(GONE) and the tvFullBody should become visible (VISIBLE). On Clicking again, it should revert back to its original state. //isExpanded is a BitSet of the size = no of list items...keeps track of which items are expanded and which are not @Override protected void onListItemClick(ListView l, View v, int position, long id) { if(isExpanded.get(position)) { v.findViewById(R.id.tvFullBody).setVisibility(View.GONE); v.findViewById(R.id.tvBody).setVisibility(View.VISIBLE); }else { v.findViewById(R.id.tvFullBody).setVisibility(View.VISIBLE); v.findViewById(R.id.tvBody).setVisibility(View.GONE); } isExpanded.flip(position); super.onListItemClick(l, v, position, id); } The Code works as it is supposed to :) except for an undesired sideeffect.... Every 10th (or so) List Item also gets "toggled". eg. If i Expand the 1st, then the 11th, 21th list items are also expanded...Although they remain off screen, but on scrolling you get to see the undesired "expansion". By my novice analysis, i'm guessing Listview keeps track of 10 list items that are currently visible, upon scrolling, it "reuses" those same variables, which is causing this problem...(i didn't check the android source code yet.) I'd be gratefull for any suggestion, on how i should tackle this! :) I'm open to alternative methods aswell....Thanks in advance! :)

    Read the article

  • How to check whether iterators form a contiguous memory zone?

    - by Vincent
    I currently have the following function to read an array or a vector of raw data (_readStream is a std::ifstream) : template<typename IteratorType> inline bool MyClass::readRawData( const IteratorType& first, const IteratorType& last, typename std::iterator_traits<IteratorType>::iterator_category* = nullptr ) { _readStream.read(reinterpret_cast<char*>(&*first), (last-first)*sizeof(*first)); return _readStream.good(); } First question : does this function seem ok for you ? As we read directly a block of memory, it will only work if the memory block from first to last is contiguous in memory. How to check that ?

    Read the article

  • C++ : Swapping template class elements of different types?

    - by metamemetics
    template< class T1, class T2 > class Pair { T1 first; T2 second; }; I'm being asked to write a swap() method so that the first element becomes the second and the second the first. I have: Pair<T2,T1> swap() { return Pair<T2,T1>(second, first); } But this returns a new object rather than swapping, where I think it needs to be a void method that changes its own data members. Is this possible to do since T1 and T2 are potentially different class types? In other words I can't simply set temp=first, first=second, second=temp because it would try to convert them to different types. I'm not sure why you would potentially want to have a template object that changes order of its types as it seems that would cause confusion but that appears to be what I'm being asked to do.

    Read the article

< Previous Page | 258 259 260 261 262 263 264 265 266 267 268 269  | Next Page >