Search Results

Search found 17195 results on 688 pages for 'input'.

Page 263/688 | < Previous Page | 259 260 261 262 263 264 265 266 267 268 269 270  | Next Page >

  • Display Commas in Large Numbers: JavaScript

    - by user3723918
    I'm working on a customized calculator, which is working pretty well except that I can't figure out how to get the generated numbers to display commas within the number. For example, it might spit out "450000" when I need it to say "450,000". This thread gives a number of suggestions on how to create a new function to deal with the problem, but I'm rather new to JavaScript and I don't really know how to make such a function interact with what I have now. I'd really appreciate any help as to how to get generated numbers with commas! :) HTML: <table id="inputValues"> <tr> <td>Percentage:</td> <td><input id="sempPer" type="text"></td> </tr> <tr> <td>Price:</td> <td><input id="unitPrice" type="text"></td> </tr> <tr> <td colspan="2"><input id="button" type="submit" value="Calculate"></td> </tr> </table> <table id="revenue" class="TFtable"> <tr> <td class="bold">Market Share</td> <td class="bold">Partner A</td> <td class="bold">Partner B</td> </tr> <tr> <td class="bold">1%</td> <td><span id="moss1"></span></td> <td><span id="semp1"></span></td> </tr> </table> </form> JavaScript: <script> function calc() { var z = Number(document.getElementById('sempPer').value); var x = Number(document.getElementById('unitPrice').value); var y = z / 100; var dm1 = .01 * 50000 * x * (1-y); var se1 = .01 * 50000 * x * y; document.getElementById("moss1").innerHTML= "$"+Number(dm1).toFixed(2); document.getElementById("semp1").innerHTML= "$"+Number(se1).toFixed(2); } </script>

    Read the article

  • php random image file name

    - by bush man
    Okay im using a snippet I found on google to take a users uploaded image and put it in my directory under Content But Im worried about duplicates so I was going have it upload the image as a Random number well here is my code you can probably understand what im going for through it anyways <label for="file">Profile Pic:</label> <input type="file" name="ProfilePic" id="ProfilePic" /><br /> <input type="submit" name="submit" value="Submit" /> $ProfilePicName = $_FILES["ProfilePic"]["name"]; $ProfilePicType = $_FILES["ProfilePic"]["type"]; $ProfilePicSize = $_FILES["ProfilePic"]["size"]; $ProfilePicTemp = $_FILES["ProfilePic"]["tmp_name"]; $ProfilePicError = $_FILES["ProfilePic"]["error"]; $RandomAccountNumber = mt_rand(1, 99999); echo $RandomAccountNumber; move_uploaded_file($ProfilePicTemp, "Content/".$RandomAccountNumber.$ProfilePicType); And then basicly after all this Im going try to get it to put that random number in my database

    Read the article

  • Getting the dynamic value of a checkbox in repeating region loop with Jquery

    - by John
    How do I get the values of a check box that is in a repeating region with its values dynamically generated from a recordset from the database.I want to retrieve the value when it is checked and after I click on a link.The problem is that it is retrieving only the first value of the recordset which is 1.This is the code: //jQuery $(document).ready(function(){ $("#clickbtn").click(function(){ $("input[type=checkbox][checked]").each(function(){ var value=$("#checkid").attr('value'); $("#textfield").attr('value',value); }); return false; }); }); //html <td width="22"><form id="form1" name="form1" method="post" action=""> <input type="checkbox" name="checkid" id="checkid" value="<?php echo $row_people['NameID']; ?>" /> </form></td> I would appreciate the help.

    Read the article

  • VC++ - Asynchronous Thread

    - by JVNR
    I am working on VC++ project, in that my application process a file from input path and generates 3 output "*.DAT" files in the destination path. I will FTP these DAT file to the destination server. After FTP, I need to delete only two output .DAT files the folder. I am able to delete those files, because there one Asynchronous thread running behind the process. Since the thread is running, while deleting it says, "Cannot delete, the file is used by another person". I need to stop that thread and delete the files. Multiple files can also be taken from the input path to process. Please help me in resolving this issue. Its very high priority issue for me. Please help me ASAP.

    Read the article

  • Problem with Initializing Consts

    - by UdiM
    This code, when compiled in xlC 8.0 (on AIX 6.1), produces the wrong result. It should print 12345, but instead prints 804399880. Removing the const in front of result makes the code work correctly. Where is the bug? #include <stdio.h> #include <stdlib.h> #include <string> long int foo(std::string input) { return strtol(input.c_str(), NULL, 0); } void bar() { const long int result = foo("12345"); printf("%u\n", result); } int main() { bar(); return 0; } Compilation command: /usr/vacpp/bin/xlC example.cpp -g

    Read the article

  • How to pass a variable inside a jquery fonction $.each($("abc")...?

    - by Rock
    I'm trying to iterate a bunch of SELECT OPTION html drop-down fields and from the ones that are NOT empty, take the values and add a hidden field for a PAYPAL shopping cart. My problem is that for some reason, the variable "curitem" is not passed inside the each function and I can't add the hidden field like they should. All I get is "NaN" or "undefined". What PAYPAL expect is : item_name_1, item_name_2, etc. All numbers must iterate by +1. How can I do this? Thanks a bunch in advance var curitem; $.each($("select"), function(index, item) { var attname = $(this).attr("name"); var nom = $(this).attr("data-nom"); var prix = $(this).attr("data-val"); var partname = attname.substring(0, 1); var qte = $(this).val(); // i want all my <select option> items that the NAME start with "q" AND have a value selected if (partname == "q" && isNaN(qte) == false && qte > 0) { // item name var inp2 = document.createElement("input"); inp2.setAttribute("type", "hidden"); inp2.setAttribute("id", "item_name_"+curitem); inp2.setAttribute("name", "item_name_"+curitem); inp2.setAttribute("value", nom); // amount var inp3 = document.createElement("input"); inp3.setAttribute("type", "hidden"); inp3.setAttribute("id", "amount_"+curitem); inp3.setAttribute("name", "amount_"+curitem); inp3.setAttribute("value", prix); // qty var inp4 = document.createElement("input"); inp4.setAttribute("type", "hidden"); inp4.setAttribute("id", "quantity_"+curitem); inp4.setAttribute("name", "quantity_"+curitem); inp4.setAttribute("value", qte); // add hidden fields to form document.getElementById('payPalForm').appendChild(inp2); document.getElementById('payPalForm').appendChild(inp3); document.getElementById('payPalForm').appendChild(inp4); // item number curitem = curitem + 1; } });

    Read the article

  • Calling a webservice synchronously from a Silverlight 3 application?

    - by Lasse V. Karlsen
    I am trying to reuse some .NET code that performs some calls to a data-access-layer type service. I have managed to package up both the input to the method and the output from the method, but unfortunately the service is called from inside code that I really don't want to rewrite in order to be asynchronous. Unfortunately, the webservice code generated in Silverlight only produces asynchronous methods, so I was wondering if anyone had working code that managed to work around this? I tried the recipe found here: The Easy Way To Synchronously Call WCF Services In Silverlight, but unfortunately it times out and never completes the call. Or rather, what seems to happen is that the completed event handler is called, but only after the method returns. I am suspecting that the event handler is called from a dispatcher or similar, and since I'm blocking the main thread here, it never completes until the code is actually back into the GUI loop. Or something like that. Here's my own version that I wrote before I found the above recipe, but it suffers from the same problem: public static object ExecuteRequestOnServer(Type dalInterfaceType, string methodName, object[] arguments) { string securityToken = "DUMMYTOKEN"; string input = "DUMMYINPUT"; object result = null; Exception resultException = null; object evtLock = new object(); var evt = new System.Threading.ManualResetEvent(false); try { var client = new MinGatServices.DataAccessLayerServiceSoapClient(); client.ExecuteRequestCompleted += (s, e) => { resultException = e.Error; result = e.Result; lock (evtLock) { if (evt != null) evt.Set(); } }; client.ExecuteRequestAsync(securityToken, input); try { var didComplete = evt.WaitOne(10000); if (!didComplete) throw new TimeoutException("A data access layer web service request timed out (" + dalInterfaceType.Name + "." + methodName + ")"); } finally { client.CloseAsync(); } } finally { lock (evtLock) { evt.Close(); evt = null; } } if (resultException != null) throw resultException; else return result; } Basically, both recipes does this: Set up a ManualResetEvent Hook into the Completed event The event handler grabs the result from the service call, and signals the event The main thread now starts the web service call asynchronously It then waits for the event to become signalled However, the event handler is not called until the method above has returned, hence my code that checks for evt != null and such, to avoid TargetInvocationException from killing my program after the method has timed out. Does anyone know: ... if it is possible at all in Silverlight 3 ... what I have done wrong above?

    Read the article

  • <button type="submit"> compatibility?

    - by Mark
    I'd like to have a submit button that submits a different value than is displayed on the button. With <input type="submit"> you can't seem to do this. With <button type="submit"> however, these can be two different values. The question is, will it work in all browsers? Trying this test code here: <form method="get" action=""> <input type="text" name="txt"/> <button type="submit" name="btn" value="val">text</button> </form> In FF 3.6 it updates my address bar with both values appropriately (and responds to me pressing enter in the text box). In IE 8, it also accepts pressing enter, displays the text value in the address bar, but it show the button's value as a GET param at all... does that mean it's not submitting it?

    Read the article

  • jQuery/Javascript problem with IE

    - by Shadyn
    I have two radio buttons each with a unique ID. When one is clicked, I would like to add $10 to a total. When the other is clicked, we go back to the original total price. My jquery looks like this: function check_ceu() { var price = <%= conference_price %>; if($('#ceu_yes').is(':checked')){ $('#total').val(parseFloat(price) + 10) } else{ $('#total').val(price) } } I have this function bound to document.ready (for page refreshes) and also the onchange handler of the radio buttons. In FF and Chrome this works fine. In IE, when the radio button with ID of "ceu_yes" is checked nothing happens, then when clicking back to the other radio button, 10 is added. So in essence, IE has the checkbox functionality reversed. Below is my code for the buttons: <input type="radio" name="ceu" id="ceu_yes" value="1" onchange="check_ceu()" /> $10 <input type="radio" name="ceu" id="ceu_no" value="0" checked="checked" onchange="check_ceu()" /> No, thank you Any ideas on this?

    Read the article

  • How can I make a table move in JavaScript?

    - by Michal Skrzypek
    My problem is that I was creating a simple website the other day and I needed the content to move according to the button pressed. I managed to do so in CSS3, but the solution did not work for IE whatsoever. Therefore I would like to ask if there is a simple solution for that in js? I don't know js at all but I heard what I need is much easier in js than in css. Details: http://i42.tinypic.com/6yl4ia.png I need the table in the picture to move according to the buttons (which are labels to be exact). The visible area is a div. Here's the relevant code (without animation as I was not satisfied with it): body { background-color: #fff; color: #fff; padding:0px; } #bodywrapperfixed { width: 1248px; margin: 0px auto; position: relative; overflow: hidden; height: 730px; } #bodywrapper { display:block; background-color: #fff; width: 1248px; color: #59595B; padding-top:50px; font-family: 'Roboto', sans-serif; position: absolute; top:0px; left:0px; z-index:1; font-size: 60px; height:730px; } #bodywrapper img { width:400px; padding:15px 0px 20px 0px; } #texten { font-family: 'Roboto', sans-serif; font-size: 35px; padding:5px; } #textpl { font-family: 'Roboto', sans-serif; font-size: 25px; padding:5px; } table#linki { width: 110px; border: none; margin-top:15px; } label { display: block; height: 54px; width: 54px; color:#fff; font-family: 'Roboto', sans-serif; font-weight: 300; font-size: 35px; background-color: #117D10; text-align: center; padding:23px; } label:hover { background-color: #004F00; cursor: pointer; } input#pl { position: absolute; top: -9999px; left: -9999px; } input#en { position: absolute; top: -9999px; left: -9999px; } and the relevant HTML: <div id="bodywrapperfixed"> <div id="bodywrapperfloat"> <table id="ramka"> <tr> <td>random text</td> <td><div id="bodywrapper"> <center> <div id="texten"><div style="font-weight:300; display:inline-block;">Introducing the all-in-one entertainment system.</div><div style="font-weight:500; display:inline-block;">&nbsp;For everyone.</div></div> <div id="textpl"><div style="font-weight:300; display:inline-block;">Przedstawiamy zintegrowany system rozrywki.</div><div style="font-weight:500; display:inline-block;">&nbsp;&nbsp;Dla wszystkich.</div></div> <img src="imgs/xboxone.png"> <div id="texten"><div style="font-weight:300; display:inline-block;">Choose your version of the story:</div></div> <div id="textpl"><div style="font-weight:300; display:inline-block;">Wybierz swoja wersja opowiesci:</div></div> <table id="linki"> <tr> <td><label for="en">en</label><input id="en" type="checkbox"></td> <td><label for="pl">pl</label><input id="pl" type="checkbox"></td> </tr></table> </center> </div></td> <td>random text</td> </tr> </table> </div> </div> Here's what it looks like: http://ingame.lh.pl/thinkone/ Please help me.

    Read the article

  • Firefox Back Button is occaisionally breaking the back button.

    - by Webjedi
    Having a really frustrating time with Firefox and the back button...given this simple ASP form: <head> <title>Form 1</title> </head> <body> <form action="form2.asp" method="post"> Enter some text:<input type="text" name="thetext" id="thetext"> <input type="submit" id="submit" name="submit"> </form> </body> </html> Firefox (3.6.3) will occasionally clear the value of the text box after hitting submit and then the back button. It's unpredictable when it will strike. And it will work for dozens to hundreds of times, and then all of a sudden it stops working. Any ideas where I should start?

    Read the article

  • Couldn't match expected type - Haskell Code

    - by wvyar
    I'm trying to learn Haskell, but the small bit of sample code I tried to write is running into a fairly large amount of "Couldn't match expected type" errors. Can anyone give me some guidance as to what I'm doing wrong/how I should go about this? These are the errors, but I'm not really sure how I should be writing my code. toDoSchedulerSimple.hs:6:14: Couldn't match expected type `[t0]' with actual type `IO String' In the return type of a call of `readFile' In a stmt of a 'do' block: f <- readFile inFile In the expression: do { f <- readFile inFile; lines f } toDoSchedulerSimple.hs:27:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter task name: " In the expression: do { putStr "Enter task name: "; task <- getLine; return inFileArray : task } toDoSchedulerSimple.hs:34:9: Couldn't match expected type `IO ()' with actual type `[a0]' In a stmt of a 'do' block: putStrLn "Your task is: " ++ (inFileArray !! i) In the expression: do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } In an equation for `getTask': getTask inFileArray = do { i <- randomRIO (0, (length inFileArray - 1)); putStrLn "Your task is: " ++ (inFileArray !! i) } toDoSchedulerSimple.hs:41:9: Couldn't match expected type `[a0]' with actual type `IO ()' In the return type of a call of `putStr' In a stmt of a 'do' block: putStr "Enter the task you would like to end: " In the expression: do { putStr "Enter the task you would like to end: "; task <- getLine; filter (endTaskCheck task) inFileArray } toDoSchedulerSimple.hs:60:53: Couldn't match expected type `IO ()' with actual type `[String] -> IO ()' In a stmt of a 'do' block: schedulerSimpleMain In the expression: do { (getTask inFileArray); schedulerSimpleMain } In a case alternative: "get-task" -> do { (getTask inFileArray); schedulerSimpleMain } This is the code itself. I think it's fairly straightforward, but the idea is to run a loop, take input, and perform actions based off of it by calling other functions. import System.Random (randomRIO) import Data.List (lines) initializeFile :: [char] -> [String] initializeFile inFile = do f <- readFile inFile let parsedFile = lines f return parsedFile displayHelp :: IO() displayHelp = do putStrLn "Welcome to To Do Scheduler Simple, written in Haskell." putStrLn "Here are some commands you might find useful:" putStrLn " 'help' : Display this menu." putStrLn " 'quit' : Exit the program." putStrLn " 'new-task' : Create a new task." putStrLn " 'get-task' : Randomly select a task." putStrLn " 'end-task' : Mark a task as finished." putStrLn " 'view-tasks' : View all of your tasks." quit :: IO() quit = do putStrLn "We're very sad to see you go...:(" putStrLn "Come back soon!" createTask :: [String] -> [String] createTask inFileArray = do putStr "Enter task name: " task <- getLine return inFileArray:task getTask :: [String] -> IO() getTask inFileArray = do i <- randomRIO (0, (length inFileArray - 1)) putStrLn "Your task is: " ++ (inFileArray !! i) endTaskCheck :: String -> String -> Bool endTaskCheck str1 str2 = str1 /= str2 endTask :: [String] -> [String] endTask inFileArray = do putStr "Enter the task you would like to end: " task <- getLine return filter (endTaskCheck task) inFileArray viewTasks :: [String] -> IO() viewTasks inFileArray = case inFileArray of [] -> do putStrLn "\nEnd of tasks." _ -> do putStrLn (head inFileArray) viewTasks (tail inFileArray) schedulerSimpleMain :: [String] -> IO() schedulerSimpleMain inFileArray = do putStr "SchedulerSimple> " input <- getLine case input of "help" -> displayHelp "quit" -> quit "new-task" -> schedulerSimpleMain (createTask inFileArray) "get-task" -> do (getTask inFileArray); schedulerSimpleMain "end-task" -> schedulerSimpleMain (endTask inFileArray) "view-tasks" -> do (viewTasks inFileArray); schedulerSimpleMain _ -> do putStrLn "Invalid input."; schedulerSimpleMain main :: IO() main = do putStr "What is the name of the schedule? " sName <- getLine schedulerSimpleMain (initializeFile sName) Thanks, and apologies if this isn't the correct place to be asking such a question.

    Read the article

  • HTML5 Video Javascript

    - by user373721
    Hi, I am not experienced in Javascript, I have the following script to play video files on Andriod phone, and it works fine. <script type="text/javascript"> function PlayMyVideo(arg) { var myVideo = document.getElementById([arg]); myVideo.play(); } </script> <video id="what" src="what.mp4" poster="" /> <input type="button" onclick="PlayMyVideo('what')" value="Play" /> I am trying to write the tag on the fly: <script type="text/javascript"> function PlayVideo() { new_video = document.createElement('video'); new_video.setAttribute('scr', 'what.mp4'); new_video.play(); } </script> <input type="button" onclick="PlayVideo()" value="Play2" /> Nothing happen, would appreciate your suggestions. Thanks in advance

    Read the article

  • Passing Values from a View to itself with parameters getting null values ?

    - by vsj
    Hi all, I am trying to get values from a view which i have the code below and I am taking the start date value from the view input text box and posting it back but I am still getting null except for the apikey and userkey.Here are the two views.. public ActionResult View1(string apiKey, string userId) { StartGoalViewModel vm = new StartGoalViewModel(); vm.ApiKey = apiKey; vm.UserId = userId; vm.GoalTypeId =1; vm.StartDate = null; return View(vm); } VIEW1.ASPX <% Html.BeginForm(); %> <%= Html.TextBox("name", Model.StartDate) %> <input type="submit" value="Start" /> <% Html.EndForm(); %> [HttpPost] public ActionResult VIEW1 (StartGoalViewModel fm) { // I get StartDate null... }

    Read the article

  • How do I do Textbox Submit

    - by Newb
    Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

    Read the article

  • Why is Drupal writing to root and not sites/default/files?

    - by Candland
    I'm using Drupal 6.14 on Win7. Everything seems to work except files that should be written to sites/default/files are trying to be written to /. The site was moved from a linux installation, which is writing the files correctly. I have setup a web.config w/ the rewrite rules for drupal. Not sure what or where else I should check. Thanks for any help. <rule name="Drupal Clean URLs" stopProcessing="true"> <match url="^(.*)$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php?q={R:1}" appendQueryString="true" /> </rule>

    Read the article

  • javascript ul button dropdown crashes after if doing more than 1 button

    - by Apprentice Programmer
    So i have a button drop down list that i want users to select a choice, and basically the button will return the users selection.Pretty straight forward, tested on jsFiddle and works great. Using ruby on rails btw, so i'm not sure if it might conflicting the way rails handle javascript actions. Heres the code: <%= form_for(@user, :html => {:class => 'form-horizontal'}) do |f| %> <fieldset> <p>Do you have experience in Business? If yes, select one of the following: <div class="input-group"> <div class="input-group-btn btn-group"> <button type="button" class="btn btn-default dropdown-toggle" data-toggle="dropdown">Select one <span class="caret"></span></button> <ul class="dropdown-menu"> <li ><a href="#">Entrepreneurship</a></li> <li ><a href="#">Investments</a></li> <li ><a href="#">Management</a></li> <li class="divider"></li> <li ><a href="#">All of the Above</a></li> </ul> </div><!-- /btn-group --> <%= f.text_field :years_business , :class => "form-control", :placeholder => "Years of experience" %> </div> Now there are 2 more of these, and basically what happens is that if I select an item for the first time from the dropdown list, everything works great. But the moment I select the same button/or new button, the page immediately kind of refreshes, they selected value will not show up after the list drops down and user selects a value. I viewed the page source and added additional javascript src and types, but still doesnt work. the jquery code: jQuery(function ($) { $('.input-group-btn .dropdown-menu > li:not(.divider)').click(function(){ $(this).closest('ul').prev().text($(this).text()) }) }); Any suggestions what is causing the problem?? The jsfiddle link is here: http://jsfiddle.net/w4s8u/7/

    Read the article

  • inputMismatchException Java reading doubles from plain text file

    - by user939287
    Using double variable = inputFile.nextDouble(); Gives the mismatch error and I can't figure out why... Anyone know what's up? The input file is just a bunch of doubles like 5.0... Okay here is the code snippet String fileName; Scanner scanner = new Scanner(System.in); System.out.println("\nEnter file name that contains the matrix and vector: "); fileName = scanner.nextLine(); Scanner inputFile = new Scanner(fileName); double a1 = inputFile.nextDouble(); the input file is a plain text document .txt in this format 5.0 4.0 -3.0 4.0 2.0 5.0 6.0 5.0 -2.0 -13.0 4.0 12.0 I don't understand why it wouldn't take those as doubles... As far as what its expecting the format of the file to be... I suppose binary? isn't that the default? I didn't specify in the code...

    Read the article

  • IIS7 URL Redirect with Regex

    - by andyjv
    I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

    Read the article

  • Using php to create a password system with chinese characters

    - by WillDonohoe
    Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

    Read the article

  • how to use OR in jquery

    - by user1493339
    1st i would like to thanks all who view this and special thanks for those who answer this. today, i tested this out but it not working, so just want to know how should this code. multiple "OR" in one line $("input[name='ABC']or[name='DEF']or[name='GHI']or[name='JKL']").click(function (){ //do something }); or even put else for it like... $("input[name='ABC'][name='DEF'][name='GHI'][name='JKL']").click(function (){ //do something }else{ //do something else }); i know both code is invalid, so is that possible to code in that way? so far i code it all one by one, so my coding is very long.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Failed to sum splited text

    - by user1784753
    I have a problem when summing all of bx3.text to t2.text. first I split bx3.text with space private void total() { string[] ps = bx3.Text.Split(new string[] {" "}, StringSplitOptions.None ); t2.Text = ps.Select(x => Convert.ToInt32(x)).Sum().ToString(); } I did try with t2.text = ps[1] and the number showed was correct. but when i try to sum it all, I got error "Input string was not in a correct format" on (x = Convert.ToInt32(x)) bx3.text is full of user-input number separated by single space " "

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

< Previous Page | 259 260 261 262 263 264 265 266 267 268 269 270  | Next Page >