Search Results

Search found 1582 results on 64 pages for 'alleged homework'.

Page 27/64 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • Recursion problem; completely lost

    - by timeNomad
    So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

    Read the article

  • Static method not called

    - by Smile
    I'm trying to call a static method (printABC()) in this class but it's not working. If I uncomment both of the lines marked T_T (1 and 2), it works! Why does it fail with only one of the lines? import java.util.Scanner; class pro0009 { static Scanner in = new Scanner(System.in); static int A,B,C; static void printABC(){ String ABC = in.nextLine(); ABC=ABC.replace("A"," "+A+" "); ABC=ABC.replace("B"," "+B+" "); ABC=ABC.replace("C"," "+C+" "); //System.out.print(ABC.substring(1)); System.out.print(ABC); } public static void main(String[] args){ int x = in.nextInt(); //1 int y = in.nextInt(); //2 int z = in.nextInt(); //3 if(x<y){//1<2 if(x<z){ //1<3 if(y<z){//x<y<z 2<3 //1<2<3 A=x; B=y; C=z; printABC();//T_T 1 System.out.println("Here"); //pro0009.printABC();//T_T 2 //System.out.println("Here2"); }else{ //x<z<y A=x; B=z; C=y; } }else{//z<x<y A=z; B=x; C=y; } }else{//y<x if(y<z){ if(x<z){//y<x<z A=y; B=x; C=z; }else{//y<z<x A=y; B=z; C=x; } }else{//z<y<x A=z; B=y; C=x; } } } }

    Read the article

  • SQL Query with computed column

    - by plotnick
    help me please with a query. Assume that we have a table with columns: Transaction StartTime EndTime Now, I need a query with computed column of (value = EndTime-Startime). Actually I need to group Users(Transaction has a FK for Users) and sort them by average time spent for transaction.

    Read the article

  • how to return a list using SwingWorker

    - by Ender
    I have an assignment where i have to create an Image Gallery which uses a SwingWorker to load the images froma a file, once the image is load you can flip threw the image and have a slideshow play. I am having trouble getting the list of loaded images using SwingWorker. This is what happens in the background it just publishes the results to a TextArea // In a thread @Override public List<Image> doInBackground() { List<Image> images = new ArrayList<Image>(); for (File filename : filenames) { try { //File file = new File(filename); System.out.println("Attempting to add: " + filename.getAbsolutePath()); images.add(ImageIO.read(filename)); publish("Loaded " + filename); System.out.println("Added file" + filename.getAbsolutePath()); } catch (IOException ioe) { publish("Error loading " + filename); } } return images; } } when it is done I just insert the images in a List<Image> and that is all it does. // In the EDT @Override protected void done() { try { for (Image image : get()) { list.add(image); } } catch (Exception e) { } } Also I created an method that returns the list called getImages() what I need to get is the list from getImages() but doesn't seam to work when I call execute() for example MySwingWorkerClass swingworker = new MySwingWorkerClass(log,list,filenames); swingworker.execute(); imageList = swingworker.getImage() Once it reaches the imageList it doesn't return anything the only way I was able to get the list was when i used the run() instead of the execute() is there another way to get the list or is the run() method the only way?. or perhaps i am not understanding the Swing Worker Class.

    Read the article

  • How could I evaluate this in code?

    - by WM
    There is a medieval puzzle about an old woman and a basket of eggs. On her way to market, a horseman knocks down the old woman and all the eggs are broken. The horseman will pay for the eggs, but the woman does not remember the exact number she had, only that when she took the eggs in pair, there was one left over; similarly, there was one left over when she took them three or five at a time. When she took them seven at a time, however, none were left. Write an application that can determine the smallest number of eggs the woman could have had. It might be a multiple of seven because there are no eggs left when it's seven at a time. But I have a problem. 49 eggs -1=2*24 49 eggs -1=3*16 49 eggs-4=5*9 49 eggs-0=7*7

    Read the article

  • how to pass an array into an function and in the function count how many numbers are in a range?

    - by user320950
    #include <iostream> #include <fstream> using namespace std; int calculate_total(int exam1[], int exam2[], int exam3[]); // function that calcualates grades to see how many 90,80,70,60 int exam1[100];// array that can hold 100 numbers for 1st column int exam2[100];// array that can hold 100 numbers for 2nd column int exam3[100];// array that can hold 100 numbers for 3rd column // here i am passing an array into the function calcualate_total int calculate_total(exam1[],exam2[],exam3[]) { int above90=0, above80=0, above70=0, above60=0; if((num<=90) && (num >=100)) { above90++; { if((num<=80) && (num >=89)) { above80++; { if((num<=70) && (num >=79)) { above70++; { if((num<=60) && (num >=69)) { above60++; } } } } } } } }

    Read the article

  • Finding the average of two number using classes and methods

    - by Have alook
    I want to use methods inside class. Q: find the average of two number using classes and methods. import java.util.*; class aaa { int a,b,sum,avrg; void average() { System.out.println("The average is ="+avrg); avrg=(sum/2); } } class ave { public static void main(String args[]){ aaa n=new aaa(); Scanner m=new Scanner(System.in); System.out.println("write two number"); n.a=m.nextInt(); n.b=m.nextInt(); n.average(); } }

    Read the article

  • Read from cin or a file

    - by m42a
    When I try to compile the code istream in; if (argc==1) in=cin; else { ifstream ifn(argv[1]); in=ifn; } gcc fails, complaining that operator= is private. Is there any way to set an istream to different values based on a condition?

    Read the article

  • Java Clock Assignment

    - by Mike S
    For my assignment we are suppose to make a clock. We need variables of hours, minutes, and seconds and methods like setHours/getHours, setMinutes/getMinutes, setSeconds/getSeconds. Now the parts of the assignment that I am having trouble on is that we need a addClock() method to make the sum of two clock objects and a tickDown() method which decrements the clock object and a tick() method that increments a Clock object by one second. Lastly, the part where I am really confused on is, I need to write a main() method in the Clock class to test the functionality of your objects with a separate Tester class with a main() method. Here is what I have so far... public class Clock { private int hr; //store hours private int min; //store minutes private int sec; //store seconds //Default constructor public Clock () { setClock (0, 0, 0); } public Clock (int hours, int minutes, int seconds) { setTimes (hours, minute, seconds); } public void setClock (int hours, int minutes, int seconds) { if(0 <= hours && hours < 24) { hr = hours; } else { hr = 0; } if(0 <= minutes && minutes < 60) { min = minutes; } else { min = 0; } if(0 <= seconds && seconds < 60) { sec = seconds; } else { sec = 0; } } public int getHours ( ) { return hr; } public int getMinutes ( ) { return min; } public int getSeconds ( ) { return sec; } //Method to increment the time by one second //Postcondition: The time is incremented by one second //If the before-increment time is 23:59:59, the time //is reset to 00:00:00 public void tickSeconds ( ) { sec++; if(sec > 59) { sec = 0; tickMinutes ( ); //increment minutes } } public void tickMinutes() { min++; If (min > 59) { min = 0; tickHours(); //increment hours } } public void tickHours() { hr++; If (hr > 23) hr = 0; } }

    Read the article

  • Perl : how to interrupt/resume loop by user hitting a key?

    - by Michael Mao
    Hi all: This is for debugging purpose. I've got a for loop that generates some output to Cygwin bash's CLI. I know that I can redirect outputs to text files and use Perl or even just a normal text editor to inspect the values printed out for a particular iteration, just feel that a bit painful. What I am now thinking is, to place a special subroutine inside the for loop, so that it would be "interrupted" at the beginning of each iteration, and Perl script should only resume to run after user/programmer hits a key(the Enter Key from keyboard?) In this way I can directly inspect the values printed out during each iteration. Is there a simple way to do this, without using additional libraries/CPAN ? Many thanks to the hints/suggestions in advance.

    Read the article

  • Efective way to avoid integer overflow when multiplying?

    - by Jonathan
    Hi, I'm working on a hash function which gets a string as input. Right now I'm doing a loop and inside the hash (an int variable) is being multiplied by a value and then the ASCII code for the current character is added to the mix. hash = hash * seed + string[i] But sometimes, if the string is big enough there is an integer overflow there, what can I do to avoid it while maintaining the same hash structure? Maybe a bit operation included inside the loop?

    Read the article

  • Java - How to declare table[i][j] elements as instance variables?

    - by JDelage
    All, I am trying to code a Connect4 game. For this, I have created a P4Game class and a P4Board class which represents the i X j dimensions of the Connect4 board. In P4Game, I have the following: public class P4Game{ //INSTANCE VARIABLES private int nbLines; private int nbColumns; private P4Board [][] position; //CONSTRUCTOR public P4Game(int nbLines, int nbColumns){ this.nbColumns = nbColumns; this.nbLines = nbLines; P4Board [][] position = new P4Board [nbLines][nbColumns]; //Creates the table to receive the instances of the P4Board object.*/ for (int i=0; i<nbLines; i++){ for (int j=0; j<nbColumns; j++){ this.position[i][j] = new P4Board(i,j); //Meant to create each object at (line=i, column=j) } } } This causes a NullPointerException in the nested loops where I mention this.position[i][j]. I reference those objects in other methods of this class so I need them to be instance variables. I suppose the exception is due to the fact that I have not listed the table element position[i][j] as an instance variable at the beginning of the class. my question to people here is (1) is my assumption correct, and if so (2) what would be the syntax to declare instance variables of this form? Thank you all for your help with what I realize is a very basic question. Hopefully it will also benefit other newbies. Cheers, JDelage

    Read the article

  • how to fix my error saying expected expression before 'else'

    - by user292489
    this program intended to read a .txt, a set of numbers, file and wwrite to another two .txt files called even amd odd as follows: #include <stdio.h> #include <stdlib.h> int main(int argc, char *argv[]) { int i=0,even,odd; int number[i]; // check to make sure that all the file names are entered if (argc != 3) { printf("Usage: executable in_file output_file\n"); exit(0); } FILE *dog = fopen(argv[1], "r"); FILE *feven= fopen(argv[2], "w"); FILE *fodd= fopen (argv[3], "w"); // check whether the file has been opened successfully if (dog == NULL) { printf("File %s cannot open!\n", argv[1]); exit(0); } //odd = fopen(argv[2], "w"); { if (i%2!=1) i++;} fprintf(feven, "%d", even); fscanf(dog, "%d", &number[i]); else { i%2==1; i++;} fprintf(fodd, "%d", odd); fscanf(dog, "%d", &number[i]); fclose(feven); fclose(fodd);

    Read the article

  • c program for this quesion

    - by sashi
    suppose that a disk drive has 5000 cylinders, numbered 0 to 4999. the drive is currently serving a request at cylinder 143 and the previous request was at cylinder 125. the ueue of pending requests in the given order is 86,1470,913,17774,948,1509,1022,1750,130. write a 'c' program for finding the total distance in cylinders that the disk arm moves to satisfy all the pending reuests from the current heads position, using SSTF scheduling algorith. seek time is the time for the disk arm to move the head to the cylider containing the desired sector. sstf algorithm selects the minimum seek time from the current head position.

    Read the article

  • Accessing every child class of parent class in Java

    - by darkie15
    Hi All, I have to implement a logic whereby given a child class, I need to access its parent class and all other child class of that parent class, if any. I did not find any API in Java Reflection which allows us to access all child classes of a parent class. Is there any way to do it? Ex. class B extends class A class C extends class A Now using class B, I can find the superclass by calling getSuperClass(). But is there any way to find all the child classes once I have the parent class i.e. class B and class C?? Regards, darkie

    Read the article

  • How does Java pick which method to call?

    - by Gaurav
    Given the following code: public class Test { public void method(Object o){ System.out.println("object"); } public void method(String s) { System.out.println("String"); } public void method() { System.out.println("blank"); } /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Test test=new Test(); test.method(null); } } Java prints "String". Why is this the case?

    Read the article

  • Issue while saving image using savefiledialog

    - by user1097772
    I'm using savefiledialog to save an image. Canvas is picturebox and the loaded image is bitmap. When I try to save it the file is created but somehow corrupted. Cause when I try againt load the image or show in different viewer it doesn't work - I mean the saved file is corrupted. There is an method for saving image. private void saveFileDialog1_FileOk(object sender, CancelEventArgs e) { System.IO.FileStream fs = (System.IO.FileStream)saveFileDialog1.OpenFile(); try { switch (saveFileDialog1.FilterIndex) { case 1: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Bmp); break; case 2: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Jpeg); break; case 3: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Png); break; case 4: canvas.Image.Save(saveFileDialog1.FileName, System.Drawing.Imaging.ImageFormat.Tiff); break; } } catch (Exception ex) { System.Console.WriteLine("Exception " + ex); } I should also mention the property Filter. saveFileDialog1.Filter has value: bmp (*.bmp)|*.bmp|jpeg (*.jpeg)|*.jpeg|png (*.png)|*.png|tiff (*.tiff)|*.tiff

    Read the article

  • Quickest way to write to file in java

    - by user1097772
    I'm writing an application which compares directory structure. First I wrote an application which writes gets info about files - one line about each file or directory. My soulution is: calling method toFile Static PrintWriter pw = new PrintWriter(new BufferedWriter( new FileWriter("DirStructure.dlis")), true); String line; // info about file or directory public void toFile(String line) { pw.println(line); } and of course pw.close(), at the end. My question is, can I do it quicker? What is the quickest way? Edit: quickest way = quickest writing in the file

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How can I prevent segmentation faults in my program?

    - by worlds-apart89
    I have a C assignment. It is a lot longer than the code shown below, and we are given the function prototypes and instructions only. I have done my best at writing code, but I am stuck with segmentation faults. When I compile and run the program below on Linux, at "735 NaN" it will terminate, indicating a segfault occurred. Why? What am I doing wrong? Basically, the program does not let me access table-list_array[735]-value and table-list_array[735]-key. This is of course the first segfault. There might be more following index 735. #include <stdio.h> #include <stdlib.h> typedef struct list_node list_node_t; struct list_node { char *key; int value; list_node_t *next; }; typedef struct count_table count_table_t; struct count_table { int size; list_node_t **list_array; }; count_table_t* table_allocate(int size) { count_table_t *ptr = malloc(sizeof(count_table_t)); ptr->size = size; list_node_t *nodes[size]; int k; for(k=0; k<size; k++){ nodes[k] = NULL; } ptr->list_array = nodes; return ptr; } void table_addvalue(count_table_t *table) { int i; for(i=0; i<table->size; i++) { table->list_array[i] = malloc(sizeof(list_node_t)); table->list_array[i]->value = i; table->list_array[i]->key = "NaN"; table->list_array[i]->next = NULL; } } int main() { count_table_t *table = table_allocate(1000); table_addvalue(table); int i; for(i=0; i<table->size; i++) printf("%d %s\n", table->list_array[i]->value, table->list_array[i]->key); return 0; }

    Read the article

  • Optimal sorting algorithm with modified cost... [closed]

    - by David
    The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. Design an algorithm that given a list of numbers, determine the optimal(in terms of cost) sequence of moves to rearrange the sequence.

    Read the article

  • calling a function from another function in python

    - by user1040503
    I have written this function that takes to strings in order to see if they are anagrams: def anagram_check(str_x, str_y): x = string1.replace(" ","") y = string2.replace(" ","") lower1 = x.lower() lower2 = y.lower() sorted1 = sorted(lower1) sorted2 = sorted(lower2) if sorted1 == sorted2: return True else: return False this function works fine, the problem is that now I need to use this function in another function in order to find anagrams in a text file. I want to print a list of tuples with all the anagrams in it. this is what i have done so far def anagrams_finder(words_num): anagrams = [] f = open("words.txt") a = list(f) list1 = ([s.replace('\n', '') for s in a]) list2 = ([i.lower() for i in list1]) list3 = list2[0:words_num] #number of words from text that need to be checked. for i in list3: .... I tried using for loops, while loops, appand.... but nothing seems to work. how can I use the first function in order to help me with the second? Please help...

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >