Search Results

Search found 10857 results on 435 pages for 'tab character'.

Page 27/435 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • Tab Auto-Completion in Mac OS X when using sftp in terminal

    - by AlanTuring
    i have been getting very frustrated lately since the readline functionality has been removed from MacOSX and Tab Auto-Completion doesn't work anymore. So i was wondering if anyone knew a good alternative to use that i could install so i can tab auto-complete files when sftp'd in. I heard that with-readline is a good option for this. If so, how do i get an alias sftp = with-readline sftp to work? I would like to do the same with any other option that isn't with-readline, so i don't have to assign an alias each time i set up a session. I am using Mac OS X 10.8(Mountain Lion) with Homebrew installed. Thanks in advance to anyone who can help me.

    Read the article

  • Run Dialog: Tab Key dont complete commands

    - by Gilney
    I like to use the Tab key to complete/skip commands/links in Shells/Browsers when typing. But when I hit the tab key in "Run Dialog" causes focus leave Text box, so i'm forced to leave home keys to use arrow keys. Is there a way change this behavior? Edit: I found here a flag that enables autocomplete in Run Dialog. This doesn't solve the question, but it helps when the command you want is the first option listed, because you just press enter instead of moving to arrow key and select the command. In my case this solves about 80% of cases.

    Read the article

  • Force firefox to open pages in a specific tab using command line

    - by user36306
    Hey Guys, Here's the challenge--I developed Softphone Screenpop PHP App that takes caller id info and searches for a match in our db, also allows us to collect call statistics. Great for our management but it's driving our reps nuts. We use firefox here and when our softphone pops to the external page, every time it opens in a new tab, the girls quickly get 5-10 open and it becomes confusing. Our softphone will also run command line. I wondering if there is a way to have a URL open in a certain tab. Otherwise does anyone have any other ideas? Thanks!

    Read the article

  • tab completion for service command on debian

    - by markus
    I have two systems with debian squeeze installed. On one system when I type: service <TAB> it shows me all available service (from /etc/init.d) on the other system it shows me all files from the current directory. Does anyone know which setting changes that behaviour ? UPDATE: The file /etc/bash_completion.d/service was missing. I copied it from the machine where it is working. If I type complete -p | grep service it shows me: complete -F _service service On the machine where it is not working that command shows me nothing. I executed complete -F _service service in the command line, after that, the command service <TAB> shows me: service -su: completion: function `_service' not found this function is defined in the service file I recently copied, for some reasons it can't be found ...

    Read the article

  • Best practice for organizing/storing character/monster data in an RPG?

    - by eclecto
    Synopsis: Attempting to build a cross-platform RPG app in Adobe Flash Builder and am trying to figure out the best class hierarchy and the best way to store the static data used to build each of the individual "hero" and "monster" types. My programming experience, particularly in AS3, is embarrassingly small. My ultra-alpha method is to include a "_class" object in the constructor for each instance. The _class, in turn, is a static Object pulled from a class created specifically for that purpose, so things look something like this: // Character.as package { public class Character extends Sprite { public var _strength:int; // etc. public function Character(_class:Object) { _strength = _class._strength; // etc. } } } // MonsterClasses.as package { public final class MonsterClasses extends Object { public static const Monster1:Object={ _strength:50, // etc. } // etc. } } // Some other class in which characters/monsters are created. // Create a new instance of Character var myMonster = new Character(MonsterClasses.Monster1); Another option I've toyed with is the idea of making each character class/monster type its own subclass of Character, but I'm not sure if it would be efficient or even make sense considering that these classes would only be used to store variables and would add no new methods. On the other hand, it would make creating instances as simple as var myMonster = new Monster1; and potentially cut down on the overhead of having to read a class containing the data for, at a conservative preliminary estimate, over 150 monsters just to fish out the one monster I want (assuming, and I really have no idea, that such a thing might cause any kind of slowdown in execution). But long story short, I want a system that's both efficient at compile time and easy to work with during coding. Should I stick with what I've got or try a different method? As a subquestion, I'm also assuming here that the best way to store data that will be bundled with the final game and not read externally is simply to declare everything in AS3. Seems to me that if I used, say, XML or JSON I'd have to use the associated AS3 classes and methods to pull in the data, parse it, and convert it to AS3 object(s) anyway, so it would be inefficient. Right?

    Read the article

  • Switching efficiently between windows, not apps, in OS X

    - by Vultan
    Previous questions have asked "how can I efficiently switch between windows, not applications, in OS X"? (Switching windows on OS X, Switch between windows on Mac OS X? and others). The most recommended suggestions seem to be: Use some combo of cmd-tab and cmd-~. Use Expose, and possibly Spaces Use Witch I spent the money on Witch, and have been using it for a few weeks; it's ok, but it is sometimes slow to respond, sometimes buggy on window order, crashes my system if I disable and re-enable it too many times, and doesn't work properly with X11 apps. The built-in cmd-tab and cmd-~ are ok, but still bring an entire application to the forefront. I find a very common workflow I use is to bounce back and forth between two windows (for example, a browser window and a Thunderbird email in progress), when both apps (the browser and email software) have multiple windows open. I can use Cmd-Tab to get back and forth between apps, but whenever I switch to an app, ALL windows from that app pop up. That suddenly fills my screen with irrelevant data and windows, and often drops those other windows in front of the single window from the other app that I was using and would conveniently like to keep viewing even though it isn't in focus. Expose seems to be the preferred "OS X natural way," but I can't seem to get myself to use it efficiently. I hit F9, and see 10 windows; I then need to squint, try to find the window I want, then use the mouse or the cursor keys to navigate to the one I want. Given the number of power users who say they use Expose, I must be missing the boat here. My goal is not to make this a repeat of previous questions. I'm not asking "what are my alternatives?" (unless I've missed one above!) Rather, I'm asking: what are you, OS X power users, actually doing to handle the use case I described above? Another common use case for me is having multiple Excel spreadsheets open and multiple browser windows open, and I'm rapidly switching back and forth between one spreadsheet in particular and one browser window. Every time I Cmd-Tab, all spreadsheets or all browser windows appear: I don't want to see the ones I'm not working with, and they tend to hide the windows from the alternative app that I don't have in focus but I'd like to at least eyeball. Can you describe what your workflow is like, and how you rapidly and thoughtlessly switch between windows from apps that have multiple windows open?

    Read the article

  • Tab Bar and Nav Controller: Where did I go wrong in my Interface Builder wiring?

    - by editor
    Even if you don't know how I've shot myself in the foot, a story which I've tried to lay out below, if you think I've done a good job showing the parameters of my problem I'd appreciate an upvote so that I might be able to grab some attention for my question. I've been working on an iPhone application in XCode and Interface Builder of the Tab Bar project type. After getting a table view of topics (business sectors) working fine I realized that I would need to add a Navigation Control to allow the user to drill into a subtopics (subsectors) table. As a green Objective-C developer, that was confusing, but I managed to get it working by reading various documentation trying out a few different IB options. My current setup is a Tab Bar Controller with Tab 1 as a Navigation Controller and Tab 2 a plain view with a Table View placed into it. The wiring works: I can log when table rows are selected and I'm ready to push a new View Controller onto the stack so that I can display the subtopics Table View. My problem: For some reason the first tab's Table View is a delegate and dataSource of the second ta. It doesn't make sense to me and I can't figure out why that's the only setup that works. Here is the wiring: Navigation Controller (Sectors) is a delegate of Tab Bar Navigation Bar is a delegate of Navigation Controller (Sectors) View Contoller (Sectors) has a view of Table View Table View (in Navigation Controller (Sectors)) is a delegate of First View Controller (Companies) Table View (in Navigation Controller (Sectors)) is a dataSource outlet of First View Controller (Companies) First View Controller (Companies) First View Contoller (Sectors) has a view of Table View Table View (in First View Controller (Companies)) is not hooked up to a dataSource outlet and is not a delegate When I click the tab buttons and look at the Inspector I see that the first tab is correctly hooked up to my MainWindow.xib and the second tab has selected a nib called SecondView.xib. It's in the File's Owner of MainWindow.xib where I inherit UITableViewDataSource and UITableViewDelegate (and also UITabBarControllerDelegate) in the .h, and in the .m where I implement the delegate methods. Why does this setup only work when the Table View in my first tab (View Controller (Sectors)) is a delegate and dataSource of the second tab? I'm confused: why wouldn't it need to be hooked up to the Navigation Controller-enabled tab in which the Table View is seen (Navigation Controller (Sectors))? The Table View seen on the second tab has neither dataSource and is not a delegate. I'm having trouble getting a pushViewController to fire (self.navigationController is not nil but the new View Controller still doesn't load) and I suspect that I need to work out this IB wiring issue before I can troubleshoot why the Nav Controller won't push a new View Controller onto the stack. if(nil == self.navigationController) { NSLog(@"self.navigationController is nil."); } else { NSLog(@"self.navigationController is not nil."); SectorList *subsectorViewController = [[SectorList alloc] initWithNibName:@"SectorList" bundle:nil]; subsectorViewController.title = @"Subsectors"; [[self navigationController] pushViewController:subsectorViewController animated:YES]; [subsectorViewController release]; }

    Read the article

  • ASP.net Ajax tab container not appearing

    - by Eyla
    I created new web project using VS 2008 with enabled Ajax template with C# and Framework 3.5. I added Ajax reference to the project and I can see all Ajax toolkit in my tool box. The problem that when I add tab container with Tab Panels then run the projects nothing appear on the browser and I tried few browsers. I'm including my code and I wish that someone would help me. Regards, My Code: ................................................................ <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="Default.aspx.cs" Inherits="Contacts._Default" %> <%@ Register assembly="AjaxControlToolkit" namespace="AjaxControlToolkit" tagprefix="asp" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <head runat="server"> <title>Untitled Page</title> </head> <body> <form id="form1" runat="server"> <asp:ScriptManager ID="ScriptManager1" runat="server" /> <div> <asp:TabContainer ID="TabContainer1" runat="server" ActiveTabIndex="0"> <asp:TabPanel runat="server" HeaderText="TabPanel1" ID="TabPanel1"> <ContentTemplate> tab 1 </ContentTemplate> </asp:TabPanel> <asp:TabPanel runat="server" HeaderText="TabPanel2" ID="TabPanel2"> <ContentTemplate> tab 2 </ContentTemplate> </asp:TabPanel> <asp:TabPanel runat="server" HeaderText="TabPanel3" ID="TabPanel3"> <ContentTemplate> tab 3 </ContentTemplate> </asp:TabPanel> </asp:TabContainer> </div> </form> </body> </html>

    Read the article

  • Showing login view controller before main tab bar controller

    - by Padawan
    I'm creating an iPad app with a tab bar controller that requires login. So on launch, I want to show a LoginViewController and if login is successful, then show the tab bar controller. This is how I implemented an initial test version (left out some typical header stuff, etc)... AppDelegate.h: @interface AppDelegate_Pad : NSObject <UIApplicationDelegate, LoginViewControllerDelegate> { UIWindow *window; UITabBarController *tabBarController; } @property (nonatomic, retain) IBOutlet UIWindow *window; @property (nonatomic, retain) IBOutlet UITabBarController *tabBarController; @end AppDelegate.m: @implementation AppDelegate_Pad @synthesize window; @synthesize tabBarController; - (BOOL)application:(UIApplication *)application didFinishLaunchingWithOptions:(NSDictionary *)launchOptions { LoginViewController_Pad *lvc = [[LoginViewController_Pad alloc] initWithNibName:@"LoginViewController_Pad" bundle:nil]; lvc.delegate = self; [window addSubview:lvc.view]; //[lvc release]; [window makeKeyAndVisible]; return YES; } - (void)loginViewControllerDidFinish:(LoginViewController_Pad *)loginViewController { [window addSubview:tabBarController.view]; } - (void)dealloc {...} @end LoginViewController_Pad.h: @protocol LoginViewControllerDelegate; @interface LoginViewController_Pad : UIViewController { id<LoginViewControllerDelegate> delegate; } @property (nonatomic, assign) id <LoginViewControllerDelegate> delegate; - (IBAction)buttonPressed; @end @protocol LoginViewControllerDelegate -(void)loginViewControllerDidFinish:(LoginViewController_Pad *)loginViewController; @end LoginViewController_Pad.m: @implementation LoginViewController_Pad @synthesize delegate; ... - (IBAction)buttonPressed { [self.view removeFromSuperview]; [self.delegate loginViewControllerDidFinish:self]; } ... @end So the app delegate adds the login view controller's view on launch and waits for login to call "did finish" using a delegate. The login view controller calls removeFromSuperView before it calls didFinish. The app delegate then calls addSubView on the tab bar controller's view. If you made it up to this point, thanks, and I have three questions: MAIN QUESTION: Is this the right way to show a view controller before the app's main tab bar controller is displayed? Even though it seems to work, is it a proper way to do it? If I comment out the "lvc release" in the app delegate then the app crashes with EXC_BAD_ACCESS when the button on the login view controller is pressed. Why? With the "lvc release" commented out everything seems to work but on the debugger console it writes this message when the app delegate calls addSubView for the tab bar controller: Using two-stage rotation animation. To use the smoother single-stage animation, this application must remove two-stage method implementations. What does that mean and do I need to worry about it?

    Read the article

  • Shift+Tab not working in TreeView control

    - by Christian
    I cannot get backwards navigation using Shift+Tab to work in a TreeView that contains TextBoxs, forward navigation using Tab works fine and jump from TextBox to TextBox inside the TreeView. Anytime Shift+Tab is used when one of the TextBoxes inside the TreeView, then the focus is move to the previous control outside the TreeView, instead of the previous control inside the TreeView. Also its only Shift+Tab navigation that are not working correctly, Ctrl+Shift+Tab work as expected and in the correct order. Any suggestions to what I'm doing wrong? Example code: <Window x:Class="TestTabTreeView.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="350" Width="525"> <Window.Resources> <Style TargetType="TreeViewItem"> <Setter Property="KeyboardNavigation.TabNavigation" Value="Continue" /> </Style> </Window.Resources> <Grid> <Grid.RowDefinitions> <RowDefinition Height="Auto" /> <RowDefinition Height="*" /> <RowDefinition Height="Auto" /> </Grid.RowDefinitions> <TextBox Text="First Line" Grid.Row="0" /> <TreeView Grid.Row="1" KeyboardNavigation.TabNavigation="Continue" IsTabStop="False"> <TreeViewItem IsExpanded="True"><TreeViewItem.Header><TextBox Text="Popular Words"/></TreeViewItem.Header> <TreeViewItem><TreeViewItem.Header><TextBox Text="Foo"/></TreeViewItem.Header></TreeViewItem> <TreeViewItem><TreeViewItem.Header><TextBox Text="Bar"/></TreeViewItem.Header></TreeViewItem> <TreeViewItem><TreeViewItem.Header><TextBox Text="Hello"/></TreeViewItem.Header></TreeViewItem> </TreeViewItem> <TreeViewItem IsExpanded="True"><TreeViewItem.Header><TextBox Text="Unpopular Words"/></TreeViewItem.Header> <TreeViewItem><TreeViewItem.Header><TextBox Text="Work"/></TreeViewItem.Header></TreeViewItem> <TreeViewItem><TreeViewItem.Header><TextBox Text="Duplication"/></TreeViewItem.Header></TreeViewItem> </TreeViewItem> </TreeView> <TextBox Text="Last Line" Grid.Row="2" /> </Grid>

    Read the article

  • iPhone:Tabbar hides when pushing from TableView to UIViewController

    - by user187532
    Hello all, I have four Tab bar items in a Tab bar which is being bottom of the view where i have the TableView. I am adding Tab bar and items programmatically (Refer below code) not through I.B. Click on first three Tab bar items, will show the data in the same TableView itself. But clicking on last Tab bar items will push to another UIViewcontroller and show the data there. The problem here is, when i push to the viewController when clicking on last Tab bar item, main "Tab bar" is getting removed. Tab bar code: UITabBar *tabBar = [[UITabBar alloc] initWithFrame:CGRectMake(0, 376, 320, 44)]; item1 = [[UITabBarItem alloc] initWithTitle:@"First Tab" image:[UIImage imageNamed:@"first.png"] tag:0]; item2 = [[UITabBarItem alloc] initWithTitle:@"Second Tab" image:[UIImage imageNamed:@"second.png"] tag:1]; item3 = [[UITabBarItem alloc] initWithTitle:@"Third Tab" image:[UIImage imageNamed:@"third.png"] tag:2]; item4 = [[UITabBarItem alloc] initWithTitle:@"Fourth Tab" image:[UIImage imageNamed:@"fourth.png"] tag:3]; item5 = [[UITabBarItem alloc] initWithTitle:@"Fifth Tab" image:[UIImage imageNamed:@"fifth.png"] tag:4]; NSArray *items = [NSArray arrayWithObjects: item1,item2,item3,item4, item5, nil]; [tabBar setItems:items animated:NO]; [tabBar setSelectedItem:item1]; tabBar.delegate=self; [self.view addSubview:tabBar]; Push controller code clicking from last Tab bar item: myViewController = [ [MyViewController alloc] initWithNibName:@"MyView" bundle:nil]; myViewController.hidesBottomBarWhenPushed=NO; [[self navigationController] pushViewController:myViewController animated:NO]; I am not seeing bottom Tab bar when i push my current TableView to myViewController. I am seeing full screen view there. I want to see bottom Tab bar always when every tab item clicked. What might be the problem here? Could someone who come across this issue, please share your suggestion to me? Thank you.

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Show full URI/URL in Chrome's developer tools Network tab

    - by Lev
    When using Chrome to debug, I find it incredibly difficult to be efficient due to the fact that I don't see how I can force the "Network" tab of the developer tools to show the full request URI. It will show the full URI if you hover the link and wait a second, but this is incredibly counterproductive. All of my AJAX requests are sent to ajax.php, and handled by using query string arguments, like: ajax.php?do=profile-set ajax.php?do=game-save ... etc. Since I use AJAX extensively, my network tab is filled with "ajax.php", but I have to manually hover each and every entry to find the request I am looking for. Surely there has got to be another way!? I am constantly fed up by something new in Firefox and immediately force myself back into Chrome, but it is always the developer tools in Chrome that keep me from using it for an extended period of time. Hopefully I can find out how to do this so I can continue using Chrome as my numero uno. I've provided a screen shot to show you where I mean:

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • Accessing Firefox tab element in nsIWebProgressListener::OnStateChange using C++

    - by Vaibhav Gade
    Hi All, I am developing extension for Firefox 3.0-3.5 versions using VS2008. I want to set attribute to a tab once the document load request completes within that tab window. So in OnStateChange method, I am checking for document load. I have used STATE_STOP & STATE_IS_DOCUMENT for it. I want to determine which tab window has been associated with particular document request. I have valid DOM Document pointer got from nsIWebProgress *aWebProgress which is 1st input parameter of OnStateChange. if ((aStateFlags & STATE_STOP) && (aStateFlags & STATE_IS_DOCUMENT)) { nsCOMPtr<nsIDOMWindow> domwin; nsCOMPtr<nsIDOMDocument> domDoc; aWebProgress->GetDOMWindow(getter_AddRefs(domwin)); domwin->GetDocument(getter_AddRefs(domDoc)); } I have tried to get nsIDOMDocumentXBL pointer by QIing nsIDOMDocument pointer(domDoc in my example) but it fails with Error code 0x80004002 (2147500034) i.e.NS_ERROR_NO_INTERFACE. How do I get the tab element corresponding to document load request. Could any one please help me? Thanks in Advance, Vaibhav D. Gade.

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Launch User Control in a tab control dynamically

    - by Redburn
    I have a custom built menu system in which I would like to load user controls from another project into a tab control on my main project (menu control) User control Project : foobar Menu system Project : Menu The function to load them into the tab control: private void LaunchWPFApplication(string header, string pPath) { // Header - What loads in the tabs header portion. // pPath - Page where to send the user //Create a new browser tab object BrowserTab bt = tabMain.SelectedItem as BrowserTab; bt = new BrowserTab(); bt.txtHeader.Text = header; bt.myParent = BrowserTabs; //Load in the path try { Type formType = Type.GetType(pPath, true); bt.Content = (UserControl)Activator.CreateInstance(formType); } catch { MessageBox.Show("The specified user control : " + pPath + " cannot be found"); } //Add the browser tab and then focus BrowserTabs.Add(bt); bt.IsSelected = true; } And what I send to the function as an example: LaunchWPFApplication("Calculater", "foobar.AppCalculater"); But every time run, the application complains that the formType is null. I am confused on how to load the user control and curious if I'm sending the correct parameters.

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • SWT: scrollable area within a tab

    - by DaveJohnston
    I am trying to add a scrollable area to my tabbed window. So far I have a CTabFolder in a shell. I have added 5 CTabItems to it and everything works as expected. On one of my CTabItems the contents are too big to fit on the screen so I would like to be able to scroll. The contents is a collection of Groups each containing various widgets. So the CTabFolder is created as follows: CTabFolder tabs = new CTabFolder(shell, SWT.BORDER); tabs.setSimple(false); tabs.setUnselectedImageVisible(false); tabs.setUnselectedCloseVisible(false); tabs.setMinimizeVisible(false); tabs.setMaximizeVisible(false); FormData tabsLayoutData = new FormData(); tabsLayoutData.top = new FormAttachment(0, 5); tabsLayoutData.left = new FormAttachment(0, 5); tabsLayoutData.bottom = new FormAttachment(92, 0); tabsLayoutData.right = new FormAttachment(100, -5); tabs.setLayoutData(tabsLayoutData); Then the CTabItem: CTabItem tab = new CTabItem(tabs, SWT.NONE); tab.setText("Role"); Then the contents: Composite tabArea = new Composite(tabs, SWT.V_SCROLL); tabArea.setLayout(new FormLayout()); tab.setControl(tabArea); So the groups contained within the tab are created with tabArea as the parent and everything appears as you would expect. The problem is though that the vertical scroll bar is always present but doesn't seem to do anything. The contents are chopped off at the bottom of the tabArea composite. Is there anything else I need to do to get the scrolling to work properly?

    Read the article

  • Updating Android Tab Icons

    - by lnediger
    I have an activity which has a TabHost containing a set of TabSpecs each with a listview containing the items to be displayed by the tab. When each TabSpec is created, I set an icon to be displayed in the tab header. The TabSpecs are created in this way within a setupTabs() method which loops to create the appropriate number of tabs: TabSpec ts = mTabs.newTabSpec("tab"); ts.setIndicator("TabTitle", iconResource); ts.setContent(new TabHost.TabContentFactory( { public View createTabContent(String tag) { ... } }); mTabs.addTab(ts); There are a couple instances where I want to be able to change the icon which is displayed in each tab during the execution of my program. Currently I am deleting all the tabs, and calling the above code again to re-create them. mTabs.getTabWidget().removeAllViews(); mTabs.clearAllTabs(true); setupTabs(); Is there a way to replace the icon that is being displayed without deleting and re-creating all of the tabs?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >