Search Results

Search found 1459 results on 59 pages for 'zack the human'.

Page 27/59 | < Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >

  • sqlite3 timestamp column

    - by Flavius
    Hi I feel stupid, but I can't get a TIMESTAMP column to be shown in human understandable way in a SELECT. I could do that in MySQL, not in sqlite3. Could someone show me an example please? Thanks

    Read the article

  • sizeof derived already from base

    - by Oops
    Hi, is it possible to return the sizeof a derived class already from base class/struct? imho the size of a class is a kind of property of itself, like the weight of a human being. But I don't want to write the same function in every class. many thanks in advance Oops

    Read the article

  • Explain why MickroC pic18f4550 HID example works

    - by Dr Deo
    MickroC compiler has a library for HID(Human Interface Device) usb communication. In the supplied samples, they specify that the buffers below should be in USB ram and use a pic18f4550. unsigned char readbuff[64] absolute 0x500; // Buffers should be in USB RAM, please consult datasheet unsigned char writebuff[64] absolute 0x540; But the pic18f4550 datasheet says USB ram ranges from 400h to 4FFh So why does their example work when their buffers appear not to be between 400h to 4FFh? Link to full source

    Read the article

  • Rating mechanisms

    - by Jasie
    Is there any place that showcases a bunch of different types of rating systems (like using multiple sliders, star ratings, up/down votes)? I'm trying to get ideas for a better rating system than just up/down (more criteria). (I'm not interested in the backend, but the human/computer interaction part of it).

    Read the article

  • Incomplete information card game

    - by binil
    I would like to develop a trick taking card game. The game is between four players, one of which is a human and the other three hands are played by the computer. Where can I read up about developing the AI for such games?

    Read the article

  • Exact textual representation of an IEEE "double"

    - by CyberShadow
    I need to represent an IEEE 754-1985 double (64-bit) floating point number in a human-readable textual form, with the condition that the textual form can be parsed back into exactly the same (bit-wise) number. Is this possible/practical to do without just printing the raw bytes? If yes, code to do this would be much appreciated.

    Read the article

  • Prevent windows from presenting any dialog on native code unhandled exception

    - by Lucas Meijer
    Our buildserver compiles and runs testsuites for many different c++ programs. From time to time the programs are buggy, and can crash. When they crash, Windows7 will always throw this modal dialog: Which has to be clicked away by a human being, causing the buildserver to sit idle. Is there a way to at a system level prevent this from happening? I know I can do it from within the process itself, but I'd love to be able to do it across the entire system.

    Read the article

  • Package to compare LSA, TFIDF, Cosine metrics and Language Models

    - by gouwsmeister
    Hi, I'm looking for a package (any language, really) that I can use on a corpus of 50 documents to perform interdocument similarity testing in various metrics, like tfidf, okapi, language models, lsa, etc. I want as a result a document similarity matrix, i.e. doc1 is x% similar to doc2, etc... This is for research purposes, not for production. I specifically want the doc similarity matrix as I want to correlate this with human ratings. Thank you in advance!

    Read the article

  • Does Google punish content duplication across multiple country domains?

    - by Logan Koester
    I like the way Google handles internationalization, with domains such as google.co.uk, google.nl, google.de etc. I'd like to do this for my own site, but I'm concerned that Google will interpret this as content duplication, particularly across countries that speak the same human language, as there won't be any translation to hint that the content is different. My site is a web application, not a content farm, so is this a legitimate concern? Would I be better off with subdomains of my .com? Directories?

    Read the article

  • Sorting a list of colors in one dimension?

    - by Ptah- Opener of the Mouth
    I would like to sort a one-dimensional list of colors so that colors that a typical human would perceive as "like" each other are near each other. Obviously this is a difficult or perhaps impossible problem to get "perfectly", since colors are typically described with three dimensions, but that doesn't mean that there aren't some sorting methods that look obviously more natural than others. For example, sorting by RGB doesn't work very well, as it will sort in the following order, for example: (1) R=254 G=0 B=0 (2) R=254 G=255 B=0 (3) R=255 G=0 B=0 (4) R=255 G=255 B=0 That is, it will alternate those colors red, yellow, red, yellow, with the two "reds" being essentially imperceivably different than each other, and the two yellows also being imperceivably different from each other. But sorting by HLS works much better, generally speaking, and I think HSL even better than that; with either, the reds will be next to each other, and the yellows will be next to each other. But HLS/HSL has some problems, too; things that people would perceive as "black" could be split far apart from each other, as could things that people would perceive as "white". Again, I understand that I pretty much have to accept that there will be some splits like this; I'm just wondering if anyone has found a better way than HLS/HSL. And I'm aware that "better" is somewhat arbitrary; I mean "more natural to a typical human". For example, a vague thought I've had, but have not yet tried, is perhaps "L is the most important thing if it is very high or very low", but otherwise it is the least important. Has anyone tried this? Has it worked well? What specifically did you decide "very low" and "very high" meant? And so on. Or has anyone found anything else that would improve upon HSL? I should also note that I am aware that I can define a space-filling curve through the cube of colors, and order them one-dimensionally as they would be encountered while travelling along that curve. That would eliminate perceived discontinuities. However, it's not really what I want; I want decent overall large-scale groupings more than I want perfect small-scale groupings. Thanks in advance for any help.

    Read the article

  • How do I distinguish files and folders on an FTP server

    - by soulmerge
    I want to list all files on an FTP server using PHP. According to RFC 959 the FTP command LIST is allowed to print arbitrary human-readable information on files/folders, which seems to make it impossible to determine the file type correctly. But how do other FTP clients manage to distinguish files and folders? Is there an unwritten standard or such?

    Read the article

  • Is it possible to programmatically edit a sound file based on frequency?

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 23 24 25 26 27 28 29 30 31 32 33 34  | Next Page >