Search Results

Search found 8942 results on 358 pages for 'print r'.

Page 272/358 | < Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >

• how to get key value of array with curl (php)

  - by Vierri

  Hello I want to make use of an API but it print alot of info and i don't know how i can get a few key values of the array. <?php $query = "SELECT * FROM kvk WHERE adres='Wit-geellaan 158'"; $host = "http://api.openkvk.nl/php/"; $url = $host ."/". rawurlencode($query); $curl = curl_init(); curl_setopt($curl, CURLOPT_FOLLOWLOCATION, 1); curl_setopt($curl, CURLOPT_URL, $url); curl_setopt($curl, CURLOPT_HEADER, 0); curl_exec($curl); curl_close($curl); ?> Is my php script and it shows array(array("RESULT"=>array("TYPES"=>array("int","bigint","varchar","varchar","varchar","varchar","varchar","int","int","smallint","smallint","int"),"HEADER"=>array("id","kvk","bedrijfsnaam","adres","postcode","plaats","type","kvks","sub","bedrijfsnaam_size","adres_size","verhuisd"),"ROWS"=>array(array("1303095","271242250000","Schoonmaakbedrijf Regio","Wit-geellaan 158","2718CK","Zoetermeer","Hoofdvestiging","27124225","0","23","16","0"))))) Thanks in advance Greetings, Vierri

  Read the article

• python packaging problem

  - by Apache

  hi expert, I develop code in python to scan wifi and send to the server, it's working fine when executed manually, but i packaged it via http://www.python-packager.com by uploading my .py file and they create package for me as deb file for linux, and i download it and install the package but nothing happen when i click the .exe or set it as startup application. Why does this happen? Nothing is printed in the terminal. In .py file i'm having print statement to check manually to list out the wifi scan value, data to post to the server, response from the server once send. How this can be solved? thanks

  Read the article

• Perl array and hash manipulation using map

  - by somebody

  I have the following test code use Data::Dumper; my $hash = { foo => 'bar', os => 'linux' }; my @keys = qw (foo os); my $extra = 'test'; my @final_array = (map {$hash->{$_}} @keys,$extra); print Dumper \@final_array; The output is $VAR1 = [ 'bar', 'linux', undef ]; Shouldn't the elements be "bar, linux, test"? Why is the last element undefined and how do I insert an element into @final_array? I know I can use the push function but is there a way to insert it on the same line as using the map command? Basically the manipulated array is meant to be used in an SQL command in the actual script and I want to avoid using extra variables before that and instead do something like: $sql->execute(map {$hash->{$_}} @keys,$extra);

  Read the article

• Perl/SQLite - How do I select / update a row with the prepare method?

  - by somebody

  I have the following code my $db = DBI->connect( "dbi:SQLite:data.db", "", "", { RaiseError => 1, AutoCommit => 1, PrintError => 0 } ); my $row = $db->selectall_arrayref( "SELECT * FROM something WHERE name=\'$hash->{name}\'"); print Dumper $row; How do I do the same with my $sql = $db->prepare("......"); $sql->execute($hash->{name}); so that it's escaped correctly and I have the selected data in $row?

  Read the article

• Help with PHPExcel Library and mySQL data from a table

  - by user547363

  Hello! Everyone.. I have this script $query = "SELECT id,last_name,first_name FROM users WHERE tmima_id='6'"; $result = @mysql_query($query); while($row = mysql_fetch_array($result)) { $i = 3; $emp_id = $row['id']; $cell = 'A'.$i; $objPHPExcel->setActiveSheetIndex(0) ->setCellValue($cell, $row['last_name']. $row['first_name']); $i++; } But in the .xls file it prints only one user. Why id doesnt print all of the users ? W Thanks in advance.

  Read the article

• How to optimize this script

  - by marks34

  I have written the following script. It opens a file, reads each line from it splitting by new line character and deleting first character in line. If line exists it's being added to array. Next each element of array is splitted by whitespace, sorted alphabetically and joined again. Every line is printed because script is fired from console and writes everything to file using standard output. I'd like to optimize this code to be more pythonic. Any ideas ? import sys def main(): filename = sys.argv[1] file = open(filename) arr = [] for line in file: line = line[1:].replace("\n", "") if line: arr.append(line) for line in arr: lines = line.split(" ") lines.sort(key=str.lower) line = ''.join(lines) print line if __name__ == '__main__': main()

  Read the article

• Python metaclass to run a class method automatically on derived class

  - by Barry Steyn

  I want to automatically run a class method defined in a base class on any derived class during the creation of the class. For instance: class Base(object): @classmethod def runme(): print "I am being run" def __metclass__(cls,parents,attributes): clsObj = type(cls,parents,attributes) clsObj.runme() return clsObj class Derived(Base): pass: What happens here is that when Base is created, ''runme()'' will fire. But nothing happens when Derived is created. The question is: How can I make ''runme()'' also fire when creating Derived. This is what I have thought so far: If I explicitly set Derived's metclass to Base's, it will work. But I don't want that to happen. I basically want Derived to use the Base's metaclass without me having to explicitly set it so.

  Read the article

• Matching id's in BeautifulSoup

  - by Ockonal

  Hello, I'm using BeautifulSoup - python module. I have to find any reference to the div's with id like: 'post-#'. For example: <div id="post-45">...</div> <div id="post-334">...</div> How can I filter this? html = '<div id="post-45">...</div> <div id="post-334">...</div>' soupHandler = BeautifulSoup(html) print soupHandler.findAll('div', id='post-*') > []

  Read the article

• Search one element of a list in another list recursively

  - by androidnoob

  I have 2 lists old_name_list = [a-1234, a-1235, a-1236] new_name_list = [(a-1235, a-5321), (a-1236, a-6321), (a-1234, a-4321), ... ] I want to search recursively if the elements in old_name_list exist in new_name_list and returns the associated value with it, for eg. the first element in old_name_list returns a-4321, second element returns a-5321, and so on until old_name_list finishes. I have tried the following and it doesn't work for old_name, new_name in zip(old_name_list, new_name_list): if old_name in new_name[0]: print new_name[1] Is the method I am doing wrong or I have to make some minor changes to it? Thank you in advance.

  Read the article

• Python structure mistake

  - by jaddy123

  I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

  Read the article

• JSP::Confused with the session objects

  - by Legend

  I just started exploring Java Servlets and JSP and am a little confused about the sessions object. Inside a servlet I have this: public class SampleServlet extends HttpServlet { public void doPost(HttpServletRequest request, HttpServletResponse response) throws IOException { HttpSession session = request.getSession(true); session.setAttribute("_session", "_value"); response.sendRedirect("page2.jsp"); } } Now, inside page2.jsp, there is a session object as well, but when I do this <% out.print(session.getAttribute("_session")) %> it gives me an error. Can someone tell me the right way of doing this? As to what I am trying to do, I want to share some session variables.

  Read the article

• Mail php function does'nt send the email

  - by Mamadou

  Hello everybody, I have the following code wich work on some server and does not work in an other: $Name = "myname"; //senders name $email_sender = "[email protected]"; //senders e-mail adress $recipient = $email; //recipient $mail_body = "The text for the mail..."; //mail body $subject = "Subject for reviever"; //subject $header = "From: ". $Name . " <" . $email_sender . ">\r\n"; $status = mail($recipient, $subject, $mail_body, $header); print('ENVOI '. $status); the $status variable is true but i dont see any email.

  Read the article

• dreferencing 2 d array

  - by ashish-sangwan

  Please look at this peice of code :- #include<stdio.h> int main() { int arr[2][2]={1,2,3,4}; printf("%d %u %u",**arr,*arr,arr); return 0; } When i compiled and executed this program i got same value for arr and *arr which is the starting address of the 2 d array. For example:- 1 3214506 3214506 My question is why does dereferencing arr ( *arr ) does not print the value stored at the address contained in arr ?

  Read the article

• variable $base_path is not working

  - by Nidhi Prasad

  I am trying to get the value of base_path variable in PHP (on lamp server) . I have kept the code insider beta_test directory inside www directly. i.e, base path function should return " /beta_test/ " . But it is returning just single slash ( "/" ) . The code that I tried is <script type="text/javascript" src="<?php print base_path(); ?>sites/all/themes/people10/slider/call.js"></script> Expected output is <script type="text/javascript" src="/beta_test/sites/all/themes/people10/slider/call.js"></script> But its giving <script type="text/javascript" src="/sites/all/themes/people10/slider/call.js"></script> I am using php version 5.3.3.Can anyone please help me in getting this issue solved? I am newbie to php and drupal .

  Read the article

• Choosing randomly all the elements in the the list just once

  - by Dalek

  How is it possible to randomly choose a number from a list with n elements, n time without picking the same element of the list twice. I wrote a code to choose the sequence number of the elements in the list but it is slow: >>>redshift=np.array([0.92,0.17,0.51,1.33,....,0.41,0.82]) >>>redshift.shape (1225,) exclude=[] k=0 ng=1225 while (k < ng): flag1=0 sq=random.randint(0, ng) while (flag1<1): if sq in exclude: flag1=1 sq=random.randint(0, ng) else: print sq exclude.append(sq) flag1=0 z=redshift[sq] k+=1 It doesn't choose all the sequence number of elements in the list.

  Read the article

• Making swedish characthers show properly in Windows Command Prompt using Python in Notepad++

  - by Alex

  The title explains it well. I have set up Notepad++ to open the python script in the command prompt when I press F8 but all Swedish characters looks messed up when opening in CMD but perfectly fine in e.g IDLE. This simple example code: #!/usr/bin/env python #-*- coding: UTF-8 -*- print "åäö" Looks like this. As you can see the output of the bath file I use to open Python in cmd below shows the characthers correctly but not the python script above it. How do i fic this?

  Read the article

• foreach invalid argument supplied and mysql fetch array issue

  - by La Myse

  i have this code which i use to print some fields from the database. My problem is that i get this error about foreach invalid argument supplied and a mysql fetch array problem. The code is this: foreach( $checked1 as $key => $value){ echo "<th> $value </th>"; } echo "</tr></thead>"; while($row = mysql_fetch_array($result)){ Where $checked1 is an array $checked1 = $_POST['checkbox']; What's the problem here? Thanks..

  Read the article

• How to Get the Method/Function Call Trace for a Specific Run?

  - by JackWM

  Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

  Read the article

• php - How do I get rid of this strange "empty delimiter" message

  - by Steven

  I have some code that uses the stristr function to extract data I need. It works, in that it gives me the results I'm looking for. BUT (you knew there was a but), it gives me this error message for every iteration of the loop: Warning: stristr() [function.stristr]: Empty delimiter in ... line 55 Like I said, the code works apart from this error. Can anyone suggest how i could amend this code to get rid of the message? Thanks in advance $data = stristr("$text", "$key"); $result = string_limit_words($data,2); print "$result<BR>";

  Read the article

• javascript really strange behaviour

  - by teehoo

  I have the following code if (msg.position == 0) //removed for brevity else if (msg.position == txtArea.value.length) //removed for brevity } else { //ERROR: should not reach here. errorDivTag.innerHTML += msg.position + " " + txtArea.value.length; } I'm having some really weird situations where I'm getting the error in the last code block, but the printed positions show that msg.position is in fact equal to the txtArea.value.length. This only happens 1% of the time, almost as if I have some kind of race-condition in my code where the two are NOT equal during the second if statement, but equal when I print in the error message. Any ideas?

  Read the article

• In PHP how do i update values in an asssociative array and store the entire array?

  - by amnesia-55

  Here's a code example: $array = array(); $array['master']['slave'] = "foo"; foreach ($array as $key => $value) { foreach ($value as $key2 => $value2) { if (preg_match('/slave/',$key2)) { $value[$key2] = "bar"; print "$value[$key2] => $key2 => $value2\n"; } } } print_r($array); Output: bar => slave => foo Array ( [master] => Array ( [slave] => foo ) ) Rather i would like to have the following as the final array: Array ( [master] => Array ( [slave] => bar ) ) What wrong am i doing here? Thank you!

  Read the article

• finding the numbers in a given range?

  - by Jamis

  Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

  Read the article

• Bash - replacing targeted files with a specific file, whitespace in directory names

  - by Dispelwolf

  I have a large directory tree of files, and am using the following script to list and replace a searched-for name with a specific file. Problem is, I don't know how to write the createList() for-loop correctly to account for whitespace in a directory name. If all directories don't have spaces, it works fine. The output is a list of files, and then a list of "cp" commands, but reports directories with spaces in them as individual dirs. aindex=1 files=( null ) [ $# -eq 0 ] && { echo "Usage: $0 filename" ; exit 500; } createList(){ f=$(find . -iname "search.file" -print) for i in $f do files[$aindex]=$(echo "${i}") aindex=$( expr $aindex + 1 ) done } writeList() { for (( i=1; i<$aindex; i++ )) do echo "#$i : ${files[$i]}" done for (( i=1; i<$aindex; i++ )) do echo "/usr/bin/cp /cygdrive/c/testscript/TheCorrectFile.file ${files[$filenumber]}" done } createList writeList

  Read the article

• Why do I have to give an identifier?

  - by Knowing me knowing you

  In code: try { System.out.print(fromClient.readLine()); } catch(IOException )//LINE 1 { System.err.println("Error while trying to read from Client"); } In code line marked as LINE 1 compiler forces me to give an identifier even though I'm not using it. Why this unnatural constrain? And then if I type an identifier I'm getting warning that identifier isn't used. It just doesn't make sense to me, forcing a programmer to do something unnecesarry and surplus. And after me someone will revise this code and will be wondering if I didn't use this variable on purpouse or I just forgot. So in order to avoid that I have to write additional comment explaining why I do not use variable which is unnecessary in my code. Thanks

  Read the article

• PHP: HOw to store and retrieve the data entered by a user in a text field from a file?

  - by kishore

  HI all, I want to Store the data entered by user in a file. If a user enters his description in a text field, Then i Have to store the data in a file. All the users data will go to the same file with their user name and description. And I have to retrieve The Data from that file for a particular user. For example if there are two users with their descriptions in the file, Then I have to retrieve a particular users description and print it on the users page. How can I store and retrieve The data from a file?

  Read the article

< Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >