Search Results

Search found 8942 results on 358 pages for 'print r'.

Page 272/358 | < Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >

  • Returning a list in this recursive coi function in python.

    - by Nate
    Hello. I'm having trouble getting my list to return in my code. Instead of returning the list, it keeps returning None, but if I replace the return with print in the elif statement, it prints the list just fine. How can I repair this? def makeChange2(amount, coinDenomination, listofcoins = None): #makes a list of coins from an amount given by using a greedy algorithm coinDenomination.sort() #reverse the list to make the largest position 0 at all times coinDenomination.reverse() #assigns list if listofcoins is None: listofcoins = [] if amount >= coinDenomination[0]: listofcoins = listofcoins + [coinDenomination[0]] makeChange2((amount - coinDenomination[0]), coinDenomination, listofcoins) elif amount == 0: return listofcoins else: makeChange2(amount, coinDenomination[1:], listofcoins)

    Read the article

  • Matching id's in BeautifulSoup

    - by Ockonal
    Hello, I'm using BeautifulSoup - python module. I have to find any reference to the div's with id like: 'post-#'. For example: <div id="post-45">...</div> <div id="post-334">...</div> How can I filter this? html = '<div id="post-45">...</div> <div id="post-334">...</div>' soupHandler = BeautifulSoup(html) print soupHandler.findAll('div', id='post-*') > []

    Read the article

  • How can i pass an object to a new thread generated anonymously in a button listener

    - by WaterBoy
    I would like to pass an object (docket for printing) to a new thread which will print the docket. My code is: private final Button.OnClickListener cmdPrintOnClickListener = new Button.OnClickListener() { public void onClick(View v) { new Thread(new Runnable() { public void run() { enableTestButton(false); Looper.prepare(); doConnectionTest(); Looper.loop(); Looper.myLooper().quit(); } }).start(); } }; How do I pass the object to it? Also - I need to generate the object in the UI thread, just before starting the new thread so where could I put this method (e.g. getDocketObject()) in relation to my code below thanks, anton

    Read the article

  • Search one element of a list in another list recursively

    - by androidnoob
    I have 2 lists old_name_list = [a-1234, a-1235, a-1236] new_name_list = [(a-1235, a-5321), (a-1236, a-6321), (a-1234, a-4321), ... ] I want to search recursively if the elements in old_name_list exist in new_name_list and returns the associated value with it, for eg. the first element in old_name_list returns a-4321, second element returns a-5321, and so on until old_name_list finishes. I have tried the following and it doesn't work for old_name, new_name in zip(old_name_list, new_name_list): if old_name in new_name[0]: print new_name[1] Is the method I am doing wrong or I have to make some minor changes to it? Thank you in advance.

    Read the article

  • Programmatic binding of accelerators in wxPython

    - by Inductiveload
    I am trying to programmatically create and bind a table of accelerators in wxPython in a loop so that I don't need to worry about getting and assigning new IDs to each accelerators (and with a view to inhaling the handler list from some external resource, rather than hard-coding them). I also pass in some arguments to the handler via a lambda since a lot of my handlers will be the same but with different parameters (move, zoom, etc). The class is subclassed from wx.Frame and setup_accelerators() is called during initialisation. def setup_accelerators(self): bindings = [ (wx.ACCEL_CTRL, wx.WXK_UP, self.on_move, 'up'), (wx.ACCEL_CTRL, wx.WXK_DOWN, self.on_move, 'down'), (wx.ACCEL_CTRL, wx.WXK_LEFT, self.on_move, 'left'), (wx.ACCEL_CTRL, wx.WXK_RIGHT, self.on_move, 'right'), ] accelEntries = [] for binding in bindings: eventId = wx.NewId() accelEntries.append( (binding[0], binding[1], eventId) ) self.Bind(wx.EVT_MENU, lambda event: binding[2](event, binding[3]), id=eventId) accelTable = wx.AcceleratorTable(accelEntries) self.SetAcceleratorTable(accelTable) def on_move(self, e, direction): print direction However, this appears to bind all the accelerators to the last entry, so that Ctrl+Up prints "right", as do all the other three. How to correctly bind multiple handlers in this way?

    Read the article

  • What host do I have to bind a listening socket to?

    - by herrturtur
    I used python's socket module and tried to open a listening socket using import socket import sys def getServerSocket(host, port): for r in socket.getaddrinfo(host, port, socket.AF_UNSPEC, socket.SOCK_STREAM, 0, socket.AI_PASSIVE): af, socktype, proto, canonname, sa = r try: s = socket.socket(af, socktype, proto) except socket.error, msg: s = None continue try: s.bind(sa) s.listen(1) except socket.error, msg: s.close() s = None continue break if s is None: print 'could not open socket' sys.exit(1) return s Where host was None and port was 15000. The program would then accept connections, but only from connections on the same machine. What do I have to do to accept connections from the internet?

    Read the article

  • Silverlight Windows Phone 7: Load Images From URL

    - by Lennie De Villiers
    Hi, I got the code below that is trying to load an image from the web into an Image control, when I run it I get an error on the given line that no network access is allowed: private void button1_Click(object sender, RoutedEventArgs e) { WebClient webClientImgDownloader = new WebClient(); webClientImgDownloader.OpenReadCompleted += new OpenReadCompletedEventHandler(webClientImgDownloader_OpenReadCompleted); webClientImgDownloader.OpenReadAsync(new Uri("http://dilbert.com/dyn/str_strip/000000000/00000000/0000000/000000/80000/5000/100/85108/85108.strip.print.gif", UriKind.Absolute)); } void webClientImgDownloader_OpenReadCompleted(object sender, OpenReadCompletedEventArgs e) { BitmapImage bitmap = new BitmapImage(); bitmap.SetSource(e.Result); // ERROR HERE! image1.Source = bitmap; } Silverlight for Windows Phone 7

    Read the article

  • AppEngine: Can I write a Dynamic property (db.Expando) with a name chosen at runtime?

    - by MarcoB
    If I have an entity derived from db.Expando I can write Dynamic property by just assigning a value to a new property, e.g. "y" in this example: class MyEntity(db.Expando): x = db.IntegerProperty() my_entity = MyEntity(x=1) my_entity.y = 2 But suppose I have the name of the dynamic property in a variable... how can I (1) read and write to it, and (2) check if the Dynamic variable exists in the entity's instance? e.g. class MyEntity(db.Expando): x = db.IntegerProperty() my_entity = MyEntity(x=1) # choose a var name: var_name = "z" # assign a value to the Dynamic variable whose name is in var_name: my_entity.property_by_name[var_name] = 2 # also, check if such a property esists if my_entity.property_exists(var_name): # read the value of the Dynamic property whose name is in var_name print my_entity.property_by_name[var_name] Thanks...

    Read the article

  • Create a basic matrix in C (input by user !)

    - by DM
    Hi there, Im trying to ask the user to enter the number of columns and rows they want in a matrix, and then enter the values in the matrix...Im going to let them insert numbers one row at a time. How can I create such function ? #include<stdio.h> main(){ int mat[10][10],i,j; for(i=0;i<2;i++) for(j=0;j<2;j++){ scanf("%d",&mat[i][j]); } for(i=0;i<2;i++) for(j=0;j<2;j++) printf("%d",mat[i][j]); } This works for inputting the numbers, but it displays them all in one line... The issue here is that I dont know how many columns or rows the user wants, so I cant print out %d %d %d in a matrix form .. Any thoughts ? Thanks :)

    Read the article

  • PHP: HOw to store and retrieve the data entered by a user in a text field from a file?

    - by kishore
    HI all, I want to Store the data entered by user in a file. If a user enters his description in a text field, Then i Have to store the data in a file. All the users data will go to the same file with their user name and description. And I have to retrieve The Data from that file for a particular user. For example if there are two users with their descriptions in the file, Then I have to retrieve a particular users description and print it on the users page. How can I store and retrieve The data from a file?

    Read the article

  • Project Euler: problem 8

    - by Marijus
    n = # some ridiculously large number, omitted N = [int(i) for i in str(n)] maxProduct = 0 for i in range(0,len(N)-4): newProduct = 1 is_cons = 0 for j in range(i,i+4): if N[j] == N[j+1] - 1: is_cons += 1 if is_cons == 5: for j in range(i,i+5): newProduct *= N[j] if newProduct > maxProduct: maxProduct = newProduct print maxProduct I've been working on this problem for hours now and I can't get this to work. I've tried doing this algorithm on paper and it works just fine.. Could you give me hints what's wrong ?

    Read the article

  • Regex for template tag with attributes

    - by Funkmyer
    Hi, I haven't found my answer after reading through all of these posts, so I'm hoping one of you heavy hitter regex folks can help me out. I'm trying to isolate the tag name and any attributes from the following string format: {TAG:TYPE attr1="foo" attr2="bar" attr3="zing" attr4="zang" attr5="zoom" ...} NOTE: in the above example, TAG will always be the same and TYPE will be one of several preset strings (e.g. share,print,display etc...). TAG and TYPE are uppercased only for the example but will not be case sensitive for real.

    Read the article

  • dreferencing 2 d array

    - by ashish-sangwan
    Please look at this peice of code :- #include<stdio.h> int main() { int arr[2][2]={1,2,3,4}; printf("%d %u %u",**arr,*arr,arr); return 0; } When i compiled and executed this program i got same value for arr and *arr which is the starting address of the 2 d array. For example:- 1 3214506 3214506 My question is why does dereferencing arr ( *arr ) does not print the value stored at the address contained in arr ?

    Read the article

  • In PHP how do i update values in an asssociative array and store the entire array?

    - by amnesia-55
    Here's a code example: $array = array(); $array['master']['slave'] = "foo"; foreach ($array as $key => $value) { foreach ($value as $key2 => $value2) { if (preg_match('/slave/',$key2)) { $value[$key2] = "bar"; print "$value[$key2] => $key2 => $value2\n"; } } } print_r($array); Output: bar => slave => foo Array ( [master] => Array ( [slave] => foo ) ) Rather i would like to have the following as the final array: Array ( [master] => Array ( [slave] => bar ) ) What wrong am i doing here? Thank you!

    Read the article

  • simple php script

    - by Nerdysyntax
    New to php and taking a class for it. Bought php6 and mysql 6 bible to get started. Of course the hello world script is the first you get and it doesn't show. It just reads part of my script and I'm not sure the problem. Link to test - http://harden6615.com/ I am using a hosted server I bought for class, but I have also check it using MAMP. I figured my script is wrong, but I have copied and pasted and still no Hello World. Any suggestions? What I copied: <?php print("Hello, World<BR />\n"); phpinfo(); ?>

    Read the article

  • Python metaclass to run a class method automatically on derived class

    - by Barry Steyn
    I want to automatically run a class method defined in a base class on any derived class during the creation of the class. For instance: class Base(object): @classmethod def runme(): print "I am being run" def __metclass__(cls,parents,attributes): clsObj = type(cls,parents,attributes) clsObj.runme() return clsObj class Derived(Base): pass: What happens here is that when Base is created, ''runme()'' will fire. But nothing happens when Derived is created. The question is: How can I make ''runme()'' also fire when creating Derived. This is what I have thought so far: If I explicitly set Derived's metclass to Base's, it will work. But I don't want that to happen. I basically want Derived to use the Base's metaclass without me having to explicitly set it so.

    Read the article

  • PHP, login to pop3-server

    - by Ockonal
    Hi guys, I have another one problem with pop3. Here is connection to pop3-server: $pop3Server = '62.113.86.215'; // mail.roller.ru $pop3User = 'mail-robot%roller.ru'; $pop_conn = fsockopen($pop3Server, 110, $errno, $errstr, 30); echo fgets($pop_conn, 1024); It returns OK. The next step is login: fputs($pop_conn, 'USER '.$pop3User.'\r\n'); //stream_set_timeout($pop_conn, 3); print fgets($pop_conn, 1024); And I get time-out. Why? p.s. Here is full code: http://pastie.org/934170

    Read the article

  • Bash - replacing targeted files with a specific file, whitespace in directory names

    - by Dispelwolf
    I have a large directory tree of files, and am using the following script to list and replace a searched-for name with a specific file. Problem is, I don't know how to write the createList() for-loop correctly to account for whitespace in a directory name. If all directories don't have spaces, it works fine. The output is a list of files, and then a list of "cp" commands, but reports directories with spaces in them as individual dirs. aindex=1 files=( null ) [ $# -eq 0 ] && { echo "Usage: $0 filename" ; exit 500; } createList(){ f=$(find . -iname "search.file" -print) for i in $f do files[$aindex]=$(echo "${i}") aindex=$( expr $aindex + 1 ) done } writeList() { for (( i=1; i<$aindex; i++ )) do echo "#$i : ${files[$i]}" done for (( i=1; i<$aindex; i++ )) do echo "/usr/bin/cp /cygdrive/c/testscript/TheCorrectFile.file ${files[$filenumber]}" done } createList writeList

    Read the article

  • Creating interruptible process in python

    - by Glycerine
    I'm creating a python script of which parses a large (but simple) CSV. It'll take some time to process. I would like the ability to interrupt the parsing of the CSV so I can continue at a later stage. Currently I have this - of which lives in a larger class: (unfinished) Edit: I have some changed code. But the system will parse over 3 million rows. def parseData(self) reader = csv.reader(open(self.file)) for id, title, disc in reader: print "%-5s %-50s %s" % (id, title, disc) l = LegacyData() l.old_id = int(id) l.name = title l.disc_number = disc l.parsed = False l.save() This is the old code. def parseData(self): #first line start fields = self.data.next() for row in self.data: items = zip(fields, row) item = {} for (name, value) in items: item[name] = value.strip() self.save(item) Thanks guys.

    Read the article

  • How can I insert a line at the beginning of a file with Perl's Tie::File?

    - by thebourneid
    I'm trying to insert/add a line 'COMMENT DUMMY' at the beginnig of a file as a first row if /PATTERN/ not found. I know how to do this with OPEN CLOSE function. Probably after reading the file it should look something like this: open F, ">", $fn or die "could not open file: $!"; ; print F "COMMENT DUMMY\n", @array; close F; But I have a need to implement this with the use of the Tie::File function and don't know how. use strict; use warnings; use Tie::File; my $fn = 'test.txt'; tie my @lines, 'Tie::File', $fn or die "could not tie file: $!"; untie @lines;

    Read the article

  • PHP callback function not being called

    - by Industrial
    Hi everyone, I've got the following code: function _callback_memcache_failure($host, $port) { print "memcache '$host:$port' failed"; } $this->memcache = new Memcache; $this->memcache->addServer('192.168.1.35', '11211', 0, 50, 10, TRUE, _callback_memcache_failure('192.168.1.35','11211')); The server is online and running (verified!), but the Failure callback function is being called at each connection. Why is that? Reference: PHP documentation: Memcache::addServer - failure_callback Allows the user to specify a callback function to run upon encountering an error. The callback is run before failover is attempted. The function takes two parameters, the hostname and port of the failed server .

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • How to Get the Method/Function Call Trace for a Specific Run?

    - by JackWM
    Given a Java or JavaScript program, after its execution, print out a sequence of calls. The calls are in invocation order. E.g. main() { A(); } A() { B(); C(); } Then the call trace should be: main -> A() -> B() -> C() Is there any tool that can profile and output this kind of information? It seems this is common a need for debugging or performance tuning. I noticed that some profilers can do this, but I prefer a simpler/easy-to-use one. Thanks!

    Read the article

  • javascript really strange behaviour

    - by teehoo
    I have the following code if (msg.position == 0) //removed for brevity else if (msg.position == txtArea.value.length) //removed for brevity } else { //ERROR: should not reach here. errorDivTag.innerHTML += msg.position + " " + txtArea.value.length; } I'm having some really weird situations where I'm getting the error in the last code block, but the printed positions show that msg.position is in fact equal to the txtArea.value.length. This only happens 1% of the time, almost as if I have some kind of race-condition in my code where the two are NOT equal during the second if statement, but equal when I print in the error message. Any ideas?

    Read the article

  • Several modules in a package importing one common module

    - by morpheous
    I am writing a python package. I am using the concept of plugins - where each plugin is a specialization of a Worker class. Each plugin is written as a module (script?) and spawned in a separate process. Because of the base commonality between the plugins (e.g. all extend a base class 'Worker'), The plugin module generally looks like this: import commonfuncs def do_work(data): # do customised work for the plugin print 'child1 does work with %s' % data In C/C++, we have include guards, which prevent a header from being included more than once. Do I need something like that in Python, and if yes, how may I make sure that commonfuncs is not 'included' more than once?

    Read the article

< Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >