Search Results

Search found 28685 results on 1148 pages for 'query performance'.

Page 272/1148 | < Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • Mysql regexp performance question

    - by Tim
    Rumour has it that this; SELECT * FROM lineage_string where lineage like '%179%' and lineage regexp '(^|/)179(/|$)' Would be faster than this; SELECT * FROM lineage_string where lineage regexp '(^|/)179(/|$)' Can anyone confirm ? Or know a decent way to test the speed of such queries. Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Linq generic Expression in query on "element" or on IQueryable (multiple use)

    - by Bogdan Maxim
    Hi, I have the following expression public static Expression<Func<T, bool>> JoinByDateCheck<T>(T entity, DateTime dateToCheck) where T : IDateInterval { return (entityToJoin) => entityToJoin.FromDate.Date <= dateToCheck.Date && (entityToJoin.ToDate == null || entityToJoin.ToDate.Value.Date >= dateToCheck.Date); } IDateInterval interface is defined like this: interface IDateInterval { DateTime FromDate {get;} DateTime? ToDate {get;} } and i need to apply it in a few ways: (1) Query on Linq2Sql Table: var q1 = from e in intervalTable where FunctionThatCallsJoinByDateCheck(e, constantDateTime) select e; or something like this: intervalTable.Where(FunctionThatCallsJoinByDateCheck(e, constantDateTime)) (2) I need to use it in some table joins (as linq2sql doesn't provide comparative join): var q2 = from e1 in t1 join e2 in t2 on e1.FK == e2.PK where OtherFunctionThatCallsJoinByDateCheck(e2, e1.FromDate) or var q2 = from e1 in t1 from e2 in t2 where e1.FK == e2.PK && OtherFunctionThatCallsJoinByDateCheck(e2, e1.FromDate) (3) I need to use it in some queries like this: var q3 = from e in intervalTable.FilterFunctionThatCallsJoinByDateCheck(constantDate); Dynamic linq is not something that I can use, so I have to stick to plain linq. Thank you Clarification: Initially I had just the last method (FilterFunctionThatCallsJoinByDateCheck(this IQueryable<IDateInterval> entities, DateTime dateConstant) ) that contained the code from the expression. The problem is that I get a SQL Translate exception if I write the code in a method and call it like that. All I want is to extend the use of this function to the where clause (see the second query in point 2)

    Read the article

  • For a set of sql-queries, how do you determine which result-set contains a certain row?

    - by ManBugra
    I have a set of sql - queries: List<String> queries = ... queries[0] = "select id from person where ..."; ... queries[8756] = "select id from person where ..."; Each query selects rows from the same table 'person'. The only difference is the where-clause. Table 'person' looks like this: id | name | ... many other columns How can i determine which queries will contain a certain person in their subset? For example: List<Integer> matchingQueries = magicMethod(queries, [23,45]); The list obtained by 'magicMethod' filters all sql queries present in the list 'queries' (defined above) and returns only those that contain either the person with id 23 OR a person with id 45. Why i need it: I am dealing with an application that contains products and categories where the categories are sql queries that define which products belong to them (queries stored in a table also). Now i have a requirement where an admin has to see all categories an item belongs to immediately after the item was created. Btw, over 8.000 categories defined (so far, more to come). language and db: java && postgreSQL Thanks,

    Read the article

  • Passing a WHERE clause for a Linq-to-Sql query as a parameter

    - by Mantorok
    Hi all This is probably pushing the boundaries of Linq-to-Sql a bit but given how versatile it has been so far I thought I'd ask. I have 3 queries that are selecting identical information and only differ in the where clause, now I know I can pass a delegate in but this only allows me to filter the results already returned, but I want to build up the query via parameter to ensure efficiency. Here is the query: from row in DataContext.PublishedEvents join link in DataContext.PublishedEvent_EventDateTimes on row.guid equals link.container join time in DataContext.EventDateTimes on link.item equals time.guid where row.ApprovalStatus == "Approved" && row.EventType == "Event" && time.StartDate <= DateTime.Now.Date.AddDays(1) && (!time.EndDate.HasValue || time.EndDate.Value >= DateTime.Now.Date.AddDays(1)) orderby time.StartDate select new EventDetails { Title = row.EventName, Description = TrimDescription(row.Description) }; The code I want to apply via a parameter would be: time.StartDate <= DateTime.Now.Date.AddDays(1) && (!time.EndDate.HasValue || time.EndDate.Value >= DateTime.Now.Date.AddDays(1)) Is this possible? I don't think it is but thought I'd check out first. Thanks

    Read the article

  • Mysql many to many problem (leaderborad/scoreboard)

    - by zoko2902
    Hi all! I'm working on a small project in regards of the upcoming World Cup. I'm building a roster/leaderboard/scoredboard based on groups with national teams. The idea is to have information on all upcoming matches within the group or in the knockout phase (scores, time of the match, match stats etc.). Currently I'm stuck with the DB in that I can't come up with a query that would return paired teams in a row. I have these 3 tables: CREATE TABLE IF NOT EXISTS `wc_team` ( `id` INT NOT NULL AUTO_INCREMENT , `name` VARCHAR(45) NULL , `description` VARCHAR(250) NULL , `flag` VARCHAR(45) NULL , `image` VARCHAR(45) NULL , `added` TIMESTAMP NULL DEFAULT CURRENT_TIMESTAMP , PRIMARY KEY (`id`) , CREATE TABLE IF NOT EXISTS `wc_match` ( `id` INT NOT NULL AUTO_INCREMENT , `score` VARCHAR(6) NULL , `date` DATE NULL , `time` VARCHAR(45) NULL , `added` TIMESTAMP NULL DEFAULT CURRENT_TIMESTAMP , PRIMARY KEY (`id`) , CREATE TABLE IF NOT EXISTS `wc_team_has_match` ( `wc_team_id` INT NOT NULL , `wc_match_id` INT NOT NULL , PRIMARY KEY (`wc_team_id`, `wc_match_id`) , I've simplified the tables so we don't go in the wrong direction. Now I've tried al kinds of joins and groupings I could think of, but I never seem to get. Example guery: SELECT t.wc_team_id,t.wc_match_id,c.id.c.name,d.id,d.name FROM wc_team_has_match AS t LEFT JOIN wc_match AS s ON t.wc_match_id = s.id LEFT JOIN wc_team AS c ON t.wc_team_id = c.id LEFT JOIN wc_team AS d ON t.wc_team_id = d.id Which returns: wc_team_id wc_match_id id name id name 16 5 16 Brazil 16 Brazil 18 5 18 Argentina 18 Argentina But what I really want is: wc_team_id wc_match_id id name id name 16 5 16 Brazil 18 Argentina Keep in mind that a group has more matches I want to see all those matches not only one. Any pointer or suggestion would be extremly appreciated since I'm stuck like a duck on this one :).

    Read the article

  • Query String to Object with strongly typed properties

    - by Kamar
    Let’s say we track 20 query string parameters in our site. Each request which comes will have only a subset of those 20 parameters. But we definitely look for all/most of the parameters which comes in each request. We do not want to loop through the collection each time we are looking for a particular parameter initially or somewhere down the pipeline in the code. So we loop once through the query string collection, convert string values to their respective types (enums, int, string etc.), populate to QueryString object which is added to the context. After that wherever its needed we will have a strongly typed properties in the QueryString object which is easy to use and we maintain a standard. public class QueryString { public int Key1{ get; private set; } public SomeType Key2{ get; private set; } private QueryString() { } public static QueryString GetQueryString() { QueryString l_QS = new QueryString(); foreach (string l_Key in HttpContext.Current.Request.QueryString.AllKeys) { switch (l_Key) { case "key1": l_QS.Key1= DoSomething(l_Key, HttpContext.Current.Request.QueryString[l_Key]); break; case "key2": l_QS.Key2 = DoAnotherThing(l_Key, HttpContext.Current.Request.QueryString[l_Key]); break; } } return l_QS; } } Any other solution to achieve this?

    Read the article

  • pyInotify performance

    - by tranimatronic
    I have a very large directory tree I am wanting pyInotify to watch. Is it better to have pyInotify watch the entire tree or is it better to have a number of watches reporting changes to specific files ? Thanks

    Read the article

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • How to test my GAE site for performance

    - by Sergey Basharov
    I am building a GAE site that uses AJAX/JSON for almost all its tasks including building the UI elements, all interactions and client-server requests. What is a good way to test it for highloads so that I could have some statistics about how much resources 1000 average users per some period of time would take. I think I can create some Python functions for this purpose. What can you advise? Thanks.

    Read the article

  • Problem with checkboxes, sql select statements & php

    - by smokey20
    I am trying to display some rows from a database table based on choices submitted by the user. Here is my form code <form action="choice.php" method="POST" > <input type="checkbox" name="variable[]" value="Apple">Apple <input type="checkbox" name="variable[]" value="Banana">Banana <input type="checkbox" name="variable[]" value="Orange">Orange <input type="checkbox" name="variable[]" value="Melon">Melon <input type="checkbox" name="variable[]" value="Blackberry">Blackberry From what I understand I am placing the values of these into an array called variable. Two of my columns are called receipe name and ingredients(each field under ingredients can store a number of fruits). What I would like to do is, if a number of checkboxes are selected then the receipe name/s is displayed. Here is my php code. <?php // Make a MySQL Connection mysql_connect("localhost", "*****", "*****") or die(mysql_error()); mysql_select_db("****") or die(mysql_error()); $variable=$_POST['variable']; foreach ($variable as $variablename) { echo "$variablename is checked"; } $query = "SELECT receipename FROM fruit WHERE $variable like ingredients"; $row = mysql_fetch_assoc($result); foreach ($_POST['variabble'] as $ingredients) echo $row[$ingredients] . '<br/>'; ?> I am very new to php and just wish to display the data, I do not need to perform any actions on it. I have tried many select statements but I cannot get any results to display. My db connection is fine and it does print out what variables are checked. Many thanks in advance.

    Read the article

  • Cannot make bind9 forward DNS query to subdomain unless recursive enabled

    - by PP.
    I am trying to develop my own dynamic DNS. I'm running my own custom DNS for the subdomain on port 5353. ASCII diagram: INET --->:53 Bind 9 --->:5353 node.js | V zone_files I have example.com. The node.js DNS is for dyn.example.com. In my /etc/bind/named.conf.local I have: zone "example.com" { type master; file "/etc/bind/db.com.example"; allow-transfer { zonetxfrsafe; }; }; zone "dyn.example.com" IN { # DYNAMIC type forward; forwarders { 127.0.0.1 port 5353; }; forward only; }; I've even gone so far as to add a NS in my example.com zone file: $TTL 86400 @ IN SOA ns.example.com. hostmaster.example.com. ( 2013070104 ; Serial 7200 ; Refresh 1200 ; Retry 2419200 ; Expire 86400 ) ; Negative Cache TTL ; NS ns ; inet of our nameserver ns A 1.2.3.4 ; NS record for subdomain dyn NS ns When I attempt to get a record from the subdomain server it doesn't get forwarded: dig @127.0.0.1 test.dyn.example.com However if I turn recursive on in /etc/bind/named.conf.options: options { recursion yes; } .. then I CAN see the request going to the subdomain server. But I don't want recursion yes; in my Bind configuration as it is poor security practice (and allows all-and-sundry requests that are not related to my managed zones). How does one forward (proxy) zone queries for just one zone? Or do I give up on Bind altogether and find a DNS server that can actually forward specific queries?

    Read the article

  • How can I use SQL to select duplicate records, along with counts of related items?

    - by mipadi
    I know the title of this question is a bit confusing, so bear with me. :) I have a (MySQL) database with a Person record. A Person also has a slug field. Unfortunately, slug fields are not unique. There are a number of duplicate records, i.e., the records have different IDs but the same first name, last name, and slug. A Person may also have 0 or more associated articles, blog entries, and podcast episodes. If that's confusing, here's a diagram of the structure: I would like to produce a list of records that match this criteria: duplicate records (i.e., same slug field) for people who also have at least 1 article, blog entry, or podcast episode. I have a SQL query that will list all records with the same slug fields: SELECT id, first_name, last_name, slug, COUNT(slug) AS person_records FROM people_person GROUP BY slug HAVING (COUNT(slug) > 1) ORDER BY last_name, first_name, id; But this includes records for people that may not have at least 1 article, blog entry, or podcast. Can I tweak this to fit the second criteria?

    Read the article

  • MySQL query returning mysql_error

    - by Sebastian
    This returns mysql_error: <?php $name = $_POST['inputName2']; $email = $_POST['inputEmail2']; $instruments = $_POST['instruments']; $city = $_POST['inputCity']; $country = $_POST['inputCountry']; $distance = $_POST['distance']; // ^^ These all echo properly ^^ // CONNECT TO DB $dbhost = "xxx"; $dbname = "xxx"; $dbuser = "xxx"; $dbpass = "xxx"; $con = mysqli_connect("$dbhost", "$dbuser", "$dbpass", "$dbname"); if (mysqli_connect_errno()) { echo "Failed to connect to MySQL: " . mysqli_connect_error(); } $query = "INSERT INTO depfinder (name, email, instrument1, instrument2, instrument3, instrument4, instrument5, city, country, max_distance) VALUES ($name, $email, $instruments[0], $instruments[1], $instruments[2], $instruments[3], $instruments[4], $city, $country, $max_distance)"; $result = mysqli_query($con, $query) or die(mysqli_error($con)); // script fails here if (!$result) { echo "There was a problem with the signup process. Please try again later."; } else { echo "Success"; } } ?> N.B. I'm not sure whether it's relevant, but the user may not choose five instruments so some $instrument[] array values may be empty. Bonus question: is my script secure enough or is there more I could do?

    Read the article

  • SQL Latest photos from contacts (grouped by contact)

    - by kitsched
    Hello, To short version of this question is that I want to accomplish something along the lines of what's visible on Flickr's homepage once you're logged in. It shows the three latest photos of each of your friends sorted by date but grouped by friend. Here's a longer explanation: For example I have 3 friends: John, George and Andrea. The list I want to extract should look like this: George Photo - 2010-05-18 Photo - 2010-05-18 Photo - 2010-05-12 John Photo - 2010-05-17 Photo - 2010-05-14 Photo - 2010-05-12 Andrea Photo - 2010-05-15 Photo - 2010-05-15 Photo - 2010-05-15 Friend with most recent photo uploaded is on top but his or her 2 next files follow. I'd like to do this from MySQL, and for the time being I got here: SELECT photos.user_id, photos.id, photos.date_uploaded FROM photos WHERE photos.user_id IN (SELECT user2_id FROM user_relations WHERE user1_id = 8) ORDER BY date_uploaded DESC Where user1_id = 8 is the currently logged in user and user2_id are the ids of friends. This query indeed returns the latest files uploaded by the contacts of the user with id = 8 sorted by date. However I'd like to accomplish the grouping and limiting mentioned above. Hopefully this makes sense. Thank you in advance.

    Read the article

  • Performance improvement of client server system

    - by Tanuj
    I have a legacy client server system where the server maintains a record of some data stored in a sqlite database. The data is related to monitoring access patterns of files stored on the server. The client application is basically a remote viewer of the data. When the client is launched, it connects to the server and gets the data from the server to display in a grid view. The data gets updated in real time on the server and the view in the client automatically gets refreshed. There are two problems with the current implementation: When the database gets too big, it takes a lot of time to load the client. What are the best ways to deal with this. One option is to maintain a cache at the client side. How to best implement a cache ? How can the server maintain a diff so that it only sends the diff during the refresh cycle. There can be multiple clients and each client needs to display the latest data available on the server. The server is a windows service daemon. Both the client and the server are implemented in C#

    Read the article

  • SNMP query - operation not permitted

    - by jperovic
    I am working on API that reads a lot of data via SNMP (routes, interfaces, QoS policies, etc...). Lately, I have experienced a random error stating: Operation not permitted Now, I use SNMP4J as core library and cannot really pinpoint the source of error. Some Stackoverflow questions have suggested OS being unable to open sufficient number of file handles but increasing that parameter did not help much. The strange thing is that error occurs only when iptables is up and running. Could it be that firewall is blocking some traffic? I have tried writing JUnit test that mimicked application's logic but no errors were fired... Any help would be appreciated! Thanks! IPTABLES *nat :PREROUTING ACCEPT [2:96] :POSTROUTING ACCEPT [68:4218] :OUTPUT ACCEPT [68:4218] # route redirect za SNMP Trap i syslog -A PREROUTING -i eth0 -p udp -m udp --dport 514 -j REDIRECT --to-ports 33514 -A PREROUTING -i eth0 -p udp -m udp --dport 162 -j REDIRECT --to-ports 33162 COMMIT *filter :INPUT ACCEPT [0:0] :FORWARD ACCEPT [0:0] :OUTPUT ACCEPT [0:0] -A INPUT -m state --state ESTABLISHED,RELATED -j ACCEPT -A INPUT -p icmp -j ACCEPT -A INPUT -i lo -j ACCEPT ..... # SNMP -A INPUT -p udp -m state --state NEW -m udp --dport 161 -j ACCEPT # SNMP trap -A INPUT -p udp -m state --state NEW -m udp --dport 162 -j ACCEPT -A INPUT -p udp -m state --state NEW -m udp --dport 33162 -j ACCEPT ..... -A INPUT -j REJECT --reject-with icmp-host-prohibited -A FORWARD -j REJECT --reject-with icmp-host-prohibited COMMIT

    Read the article

  • cisco asa query dns external

    - by Alpacino
    my lab network asa firewall below 10.10.10.20 -- ASA --- 192.168.1.10 -- website external my client 10.10.10.20 want to access website external and i create nat nat (inside,outside) static 192.168.1.10 and access list access-list outside-acl extended permit tcp any host 10.10.10.20 eq www access-list outside-acl extended permit tcp any host 10.10.10.20 eq domain access-list inside-acl extended permit tcp 10.10.10.0 255.255.255.0 any eq www access-list inside-acl extended permit tcp 10.10.10.0 255.255.255.0 any eq domain access-group outside-acl in interface outside access-group inside-acl in interface inside when i access to website with domain name it can't access but i access website with ip address it work please help me to solve problem thank you

    Read the article

  • How large is the performance loss for a 64-bit VirtualBox guest running on a 32-bit host?

    - by IllvilJa
    I have a 64-bit Virtualbox guest running Gentoo Linux (amd64) and it is currently hosted on a 32-bit Gentoo laptop. I've noticed that the performance of the VM is very slow compared to the performance of the 32-bit host itself. Also when I compare with another 32-bit Linux VM running on the same host, performance is significantly less on the 64-bit VM. I know that running a 64-bit VM on a 32-bit host does incur some performance penalties for the VM, but does anyone have any deeper knowledge of how large a penalty one might expect in this scenario, roughly speaking? Is a 10% slowdown something to expect, or should it be a slowdown in the 90% range (running at 1/10 the normal speed)? Or to phrase it in another way: would it be reasonable to expect that the performance improvement for the 64-bit VM increases so much that it is worth reinstalling the host machine to run 64-bit Gentoo instead? I'm currently seriously considering that upgrade, but am curious about other peoples experience of the current scenario. I am aware that the host OS will require more RAM when running in 64-bit, but that's OK for me. Also, I do know that one usually don't run a 64-bit VM on a 32-bit server (I'm surprised I even got the VM started in the first place) but things turned out that way when I tried to future proof the VM I was setting up and decided to make it 64-bit anyway.

    Read the article

  • NHibernate + Fluent long startup time

    - by PaRa
    Hi all, am new to NHibernate. When performing below test took 11.2 seconds (debug mode) i am seeing this large startup time in all my tests (basically creating the first session takes a tone of time) setup = Windows 2003 SP2 / Oracle10gR2 latest CPU / ODP.net 2.111.7.20 / FNH 1.0.0.636 / NHibernate 2.1.2.4000 / NUnit 2.5.2.9222 / VS2008 SP1 using System; using System.Collections; using System.Data; using System.Globalization; using System.IO; using System.Text; using System.Data; using NUnit.Framework; using System.Collections.Generic; using System.Data.Common; using NHibernate; using log4net.Config; using System.Configuration; using FluentNHibernate; [Test()] public void GetEmailById() { Email result; using (EmailRepository repository = new EmailRepository()) { results = repository.GetById(1111); } Assert.IsTrue(results != null); } public class EmailRepository : RepositoryBase { public EmailRepository():base() { } } In my RepositoryBase public T GetById(object id) { using (var session = sessionFactory.OpenSession()) using (var transaction = session.BeginTransaction()) { try { T returnVal = session.Get(id); transaction.Commit(); return returnVal; } catch (HibernateException ex) { // Logging here transaction.Rollback(); return null; } } } The query time is very small. The resulting entity is really small. Subsequent queries are fine. Its seems to be getting the first session started. Has anyone else seen something similar?

    Read the article

  • T-SQL Query, combine columns from multiple rows into single column

    - by Shayne
    I have seeen some examples of what I am trying to do using COALESCE and FOR XML (seems like the better solution). I just can't quite get the syntax right. Here is what I have (I will shorten the fields to only the key ones): Table Fields ------ ------------------------------- Requisition ID, Number IssuedPO ID, Number Job ID, Number Job_Activity ID, JobID (fkey) RequisitionItems ID, RequisitionID(fkey), IssuedPOID(fkey), Job_ActivityID (fkey) I need a query that will list ONE Requisition per line with its associated Jobs and IssuedPOs. (The requisition number start with "R-" and the Job Number start with "J-"). Example: R-123 | "PO1; PO2; PO3" | "J-12345; J-6780" Sure thing Adam! Here is a query that returns multiple rows. I have to use outer joins, since not all Requisitions have RequisitionItems that are assigned to Jobs and/or IssuedPOs (in that case their fkey IDs would just be null of course). SELECT DISTINCT Requisition.Number, IssuedPO.Number, Job.Number FROM Requisition INNER JOIN RequisitionItem on RequisitionItem.RequisitionID = Requisition.ID LEFT OUTER JOIN Job_Activity on RequisitionItem.JobActivityID = Job_Activity.ID LEFT OUTER JOIN Job on Job_Activity.JobID = Job.ID LEFT OUTER JOIN IssuedPO on RequisitionItem.IssuedPOID = IssuedPO.ID

    Read the article

  • why arrayfun does NOT improve my struct array operation performance

    - by HaveF
    here is the input data: % @param Landmarks: % Landmarks should be 1*m struct. % m is the number of training set. % Landmark(i).data is a n*2 matrix old function: function Landmarks=CenterOfGravity(Landmarks) % align center of gravity for i=1 : length(Landmarks) Landmarks(i).data=Landmarks(i).data - ones(size(Landmarks(i).data,1),1)... *mean(Landmarks(i).data); end end new function which use arrayfun: function [Landmarks] = center_to_gravity(Landmarks) Landmarks = arrayfun(@(struct_data)... struct('data', struct_data.data - repmat(mean(struct_data.data), [size(struct_data.data, 1), 1]))... ,Landmarks); end %function center_to_gravity when using profiler, I find the usage of time is NOT what I expected: Function Total Time Self Time* CenterOfGravity 0.011s 0.004 s center_to_gravity 0.029s 0.001 s Can someone tell me why? BTW...I can't add "arrayfun" as a new tag for my reputation.

    Read the article

< Previous Page | 268 269 270 271 272 273 274 275 276 277 278 279  | Next Page >