Search Results

Search found 7702 results on 309 pages for 'nested includes'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 278/309 | < Previous Page | 274 275 276 277 278 279 280 281 282 283 284 285  | Next Page >

  • Browser displays page without styles for a short moment (visual glitch)

    - by Pierre
    I have observed that, very infrequently, Internet Explorer (7 or 8, it does not matter) displays our web pages (www.epsitec.ch) a short time without applying the CSS. The layout appears completely broken, with everything displayed sequentially from top to bottom. When the page has finished loading, everything finally gets displayed properly. Our web pages do not use any fancy scripting, just two javascript inclusions for QuantCast and Google Analytics, done at the end of the page. By the way, we already had the issue before adding the QuantCast script. The CSS gets linked in the <head> section: <head> <title>Crésus Comptabilité</title> <link rel="icon" href="/favicon.ico" type="image/x-icon" /> <link rel="shortcut icon" href="http://www.epsitec.ch/favicon.ico" /> <link href="../../style.css" rel="stylesheet" type="text/css" /> ... </head> and then follows static HTML up to the final chunk which includes the JavaScript: ... <div id="account"> <a class="deselect" href="/account/login">Identifiez-vous</a> <script type="text/javascript"> _qoptions={qacct:"..."}; </script> <script type="text/javascript" src="http://edge.quantserve.com/quant.js"> </script> <noscript> <img src="..." style="display: none;" border="0" height="1" width="1"/> </noscript> </div> <div id="contact"> <a href="/support/contact">Contactez-nous</a> </div> <div id="ending"><!-- --></div> </div> <script type="text/javascript"> ... </script> <script type="text/javascript"> var pageTracker = _gat._getTracker("..."); pageTracker._initData(); pageTracker._trackPageview(); </script> </body> As this is a very short visual glitch, I have no idea what provokes it. Worse, I cannot reproduce it and it appears only on seldom occasions. How can I further investigate the cause of the glitch? Are there any best practices I should be aware of?

    Read the article

  • How to design a C / C++ library to be usable in many client languages?

    - by Brian Schimmel
    I'm planning to code a library that should be usable by a large number of people in on a wide spectrum of platforms. What do I have to consider to design it right? To make this questions more specific, there are four "subquestions" at the end. Choice of language Considering all the known requirements and details, I concluded that a library written in C or C++ was the way to go. I think the primary usage of my library will be in programs written in C, C++ and Java SE, but I can also think of reasons to use it from Java ME, PHP, .NET, Objective C, Python, Ruby, bash scrips, etc... Maybe I cannot target all of them, but if it's possible, I'll do it. Requirements It would be to much to describe the full purpose of my library here, but there are some aspects that might be important to this question: The library itself will start out small, but definitely will grow to enormous complexity, so it is not an option to maintain several versions in parallel. Most of the complexity will be hidden inside the library, though The library will construct an object graph that is used heavily inside. Some clients of the library will only be interested in specific attributes of specific objects, while other clients must traverse the object graph in some way Clients may change the objects, and the library must be notified thereof The library may change the objects, and the client must be notified thereof, if it already has a handle to that object The library must be multi-threaded, because it will maintain network connections to several other hosts While some requests to the library may be handled synchronously, many of them will take too long and must be processed in the background, and notify the client on success (or failure) Of course, answers are welcome no matter if they address my specific requirements, or if they answer the question in a general way that matters to a wider audience! My assumptions, so far So here are some of my assumptions and conclusions, which I gathered in the past months: Internally I can use whatever I want, e.g. C++ with operator overloading, multiple inheritance, template meta programming... as long as there is a portable compiler which handles it (think of gcc / g++) But my interface has to be a clean C interface that does not involve name mangling Also, I think my interface should only consist of functions, with basic/primitive data types (and maybe pointers) passed as parameters and return values If I use pointers, I think I should only use them to pass them back to the library, not to operate directly on the referenced memory For usage in a C++ application, I might also offer an object oriented interface (Which is also prone to name mangling, so the App must either use the same compiler, or include the library in source form) Is this also true for usage in C# ? For usage in Java SE / Java EE, the Java native interface (JNI) applies. I have some basic knowledge about it, but I should definitely double check it. Not all client languages handle multithreading well, so there should be a single thread talking to the client For usage on Java ME, there is no such thing as JNI, but I might go with Nested VM For usage in Bash scripts, there must be an executable with a command line interface For the other client languages, I have no idea For most client languages, it would be nice to have kind of an adapter interface written in that language. I think there are tools to automatically generate this for Java and some others For object oriented languages, it might be possible to create an object oriented adapter which hides the fact that the interface to the library is function based - but I don't know if its worth the effort Possible subquestions is this possible with manageable effort, or is it just too much portability? are there any good books / websites about this kind of design criteria? are any of my assumptions wrong? which open source libraries are worth studying to learn from their design / interface / souce? meta: This question is rather long, do you see any way to split it into several smaller ones? (If you reply to this, do it as a comment, not as an answer)

    Read the article

  • MVC3/Razor Client Validation Not firing

    - by Jason Gerstorff
    I am trying to get client validation working in MVC3 using data annotations. I have looked at similar posts including this MVC3 Client side validation not working for the answer. I'm using an EF data model. I created a partial class like this for my validations. [MetadataType(typeof(Post_Validation))] public partial class Post { } public class Post_Validation { [Required(ErrorMessage = "Title is required")] [StringLength(5, ErrorMessage = "Title may not be longer than 5 characters")] public string Title { get; set; } [Required(ErrorMessage = "Text is required")] [DataType(DataType.MultilineText)] public string Text { get; set; } [Required(ErrorMessage = "Publish Date is required")] [DataType(DataType.DateTime)] public DateTime PublishDate { get; set; } } My cshtml page includes the following. <h2>Create</h2> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> @using (Html.BeginForm()) { @Html.ValidationSummary(true) Post <div class="editor-label"> @Html.LabelFor(model => model.Title) </div> <div class="editor-field"> @Html.EditorFor(model => model.Title) @Html.ValidationMessageFor(model => model.Title) </div> <div class="editor-label"> @Html.LabelFor(model => model.Text) </div> <div class="editor-field"> @Html.EditorFor(model => model.Text) @Html.ValidationMessageFor(model => model.Text) Web Config: <appSettings> <add key="ClientValidationEnabled" value="true" /> <add key="UnobtrusiveJavaScriptEnabled" value="true" /> Layout: <head> <title>@ViewBag.Title</title> <link href="@Url.Content("~/Content/Site.css")" rel="stylesheet" type="text/css" /> <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> So, the Multiline Text annotation works and creates a text area. But none of the validations work client side. I don't know what i might be missing. Any ideas?? i can post more information if needed. Thanks!

    Read the article

  • UITabBarContrtoller achieve from a different class in iPhone

    - by baluedo
    Hi! I have the following problem: There is a class that includes five tabs in the following way: mainMenuClient.h #import <UIKit/UIKit.h> @interface MainMenuClient : UIViewController { UITabBarController *tabBarController; } @property (nonatomic, retain) UITabBarController *tabBarController; @end mainMenuClient.m -(void)viewDidLoad { UIView *contentView = [[UIView alloc] initWithFrame:[[UIScreen mainScreen] applicationFrame]]; contentView.backgroundColor = [UIColor blackColor]; self.view = contentView; [contentView release]; ContactListTab *contactTab = [[ContactListTab alloc] init]; ChatTab *chat = [[ChatTab alloc]init]; DialerTab *dialer = [[DialerTab alloc]init]; MenuTab *menu = [[MenuTab alloc]init]; TesztingFile *teszting = [[TesztingFile alloc]init]; contactTab.title = @"Contact List"; chat.title = @"Chat"; dialer.title = @"Dialer"; menu.title = @"Menu"; teszting.title = @"TesztTab"; contactTab.tabBarItem.image = [UIImage imageNamed:@"Contacts_icon.png"]; chat.tabBarItem.image = [UIImage imageNamed:@"Chat_icon.png"]; dialer.tabBarItem.image = [UIImage imageNamed:@"Dialer_icon.png"]; menu.tabBarItem.image = [UIImage imageNamed:@"Menu_icon.png"]; teszting.tabBarItem.image = [UIImage imageNamed:@"Contacts_icon.png"]; chat.tabBarItem.badgeValue = @"99"; tabBarController = [[UITabBarController alloc]init]; tabBarController.view.frame = CGRectMake(0, 0, 320, 460); [tabBarController setViewControllers:[NSArray arrayWithObjects:contactTab, chat, dialer, menu, teszting, nil]]; [contactTab release]; [chat release]; [dialer release]; [menu release]; [teszting release]; [self.view addSubview:tabBarController.view]; [super viewDidLoad]; } In the contactTab class there are a UITableViewController. contactTab.h - (void)updateCellData; - (void)configureCell:(UITableViewCell *)cell forIndexPath:(NSIndexPath *)indexPath; There is a third class, which I would like to achieve is a method of UITableViewController's (from ContactTab). So far I tried this: When I tried to achieve the UItabbarController: MainMenuClient *menu; UITabBarController *tabBarControllerchange = [[UITabBarController alloc] init]; tabBarControllerchange = menu.tabBarController; [tabBarControllerchange setSelectedIndex:0]; When I tried to achieve the UITableViewController: ContactListTab *contactListTab; [contactListTab updateCellData]; Does anybody have an idea for this problem? Thanks. Balazs.

    Read the article

  • JSON.Net: deserializing polymorphic types without specifying the assembly

    - by Frank Schwieterman
    I see that using JSON.Net, I can decode polymorphic objects if a $type attribute specifies the specific type of the JSON object. In all the examples I've seen, $type includes the namespace. Is it possible to make this work including just a simple typename without the assembly? I'd be happy to specify a default assembly to the JsonSerializer if thats possible I am able to deserialize the JSON using: public class SingleAssemblyJsonTypeBinder : SerializationBinder { private readonly Assembly _assembly; private Dictionary _typesBySimpleName = new Dictionary(StringComparer.OrdinalIgnoreCase); private Dictionary _simpleNameByType = new Dictionary(); public SingleAssemblyJsonTypeBinder(Assembly assembly) { _assembly = assembly; _typesBySimpleName = new Dictionary<string, Type>(); foreach (var type in _assembly.GetTypes().Where(t => t.IsPublic)) { if (_typesBySimpleName.ContainsKey(type.Name)) throw new InvalidOperationException("Cannot user PolymorphicBinder on a namespace where multiple public types have same name."); _typesBySimpleName[type.Name] = type; _simpleNameByType[type] = type.Name; } } public override Type BindToType(string assemblyName, string typeName) { Type result; if (_typesBySimpleName.TryGetValue(typeName.Trim(), out result)) return result; return null; } public override void BindToName(Type serializedType, out string assemblyName, out string typeName) { string name; if (_simpleNameByType.TryGetValue(serializedType, out name)) { typeName = name; assemblyName = null;// _assembly.FullName; } else { typeName = null; assemblyName = null; } } } ... public static JsonSerializerSettings GetJsonSerializationSettings() { var settings = new JsonSerializerSettings(); settings.Binder = new SingleAssemblyJsonTypeBinder(typeof(MvcApplication).Assembly); settings.TypeNameHandling = TypeNameHandling.Objects; return settings; } .... var serializer = JsonSerializer.Create(settings); I haven't been able to make this work with MVC though, I'm configuring json deserialization per the code below in Application_Start, and the object is deserialized, but using the base type one. GlobalConfiguration.Configuration.Formatters.JsonFormatter.SerializerSettings.Binder = new SingleAssemblyJsonTypeBinder(this.GetType().Assembly); GlobalConfiguration.Configuration.Formatters.JsonFormatter.SerializerSettings.TypeNameHandling = TypeNameHandling.All; GlobalConfiguration.Configuration.Formatters.JsonFormatter.SerializerSettings.TypeNameAssemblyFormat = FormatterAssemblyStyle.Simple;

    Read the article

  • Entity Framework looking for wrong column

    - by m.edmondson
    I'm brand new to the Entity Framework and trying to learn all it can offer. I'm currently working my way through the MVC Music Store tutorial which includes the following code: public ActionResult Browse(string genre) { // Retrieve Genre and its Associated Albums from database var genreModel = storeDB.Genres.Include("Albums") .Single(g => g.Name == genre); return View(genreModel); } as I'm working in VB I converted it like so: Function Browse(ByVal genre As String) As ActionResult 'Retrieve Genre and its Associated Albums from database Dim genreModel = storeDB.Genres.Include("Albums"). _ Single(Function(g) g.Name = genre) Return(View(genreModel)) End Function The problem is I'm getting the following exception: Invalid column name 'GenreGenreId'. Which I know is true, but I can't for the life of my work out where it's getting 'GenreGenreId' from. Probably a basic question but I'll appreciate any help in the right direction. As per requested here is the source for my classes: Album.vb Public Class Album Private _title As String Private _genre As Genre Private _AlbumId As Int32 Private _GenreId As Int32 Private _ArtistId As Int32 Private _Price As Decimal Private _AlbumArtUrl As String Public Property Title As String Get Return _title End Get Set(ByVal value As String) _title = value End Set End Property Public Property AlbumId As Int16 Get Return _AlbumId End Get Set(ByVal value As Int16) _AlbumId = value End Set End Property Public Property GenreId As Int16 Get Return _GenreId End Get Set(ByVal value As Int16) _GenreId = value End Set End Property Public Property ArtistId As Int16 Get Return _ArtistId End Get Set(ByVal value As Int16) _ArtistId = value End Set End Property Public Property AlbumArtUrl As String Get Return _AlbumArtUrl End Get Set(ByVal value As String) _AlbumArtUrl = value End Set End Property Public Property Price As Decimal Get Return _Price End Get Set(ByVal value As Decimal) _Price = value End Set End Property Public Property Genre As Genre Get Return _genre End Get Set(ByVal value As Genre) _genre = value End Set End Property End Class Genre.vb Public Class Genre Dim _genreId As Int32 Dim _Name As String Dim _Description As String Dim _Albums As List(Of Album) Public Property GenreId As Int32 Get Return _genreId End Get Set(ByVal value As Int32) _genreId = value End Set End Property Public Property Name As String Get Return _Name End Get Set(ByVal value As String) _Name = value End Set End Property Public Property Description As String Get Return _Description End Get Set(ByVal value As String) _Description = value End Set End Property Public Property Albums As List(Of Album) Get Return _Albums End Get Set(ByVal value As List(Of Album)) _Albums = value End Set End Property End Class MusicStoreEntities.vb Imports System.Data.Entity Namespace MvcApplication1 Public Class MusicStoreEntities Inherits DbContext Public Property Albums As DbSet(Of Album) Public Property Genres As DbSet(Of Genre) End Class End Namespace

    Read the article

  • Why does Module::Build's testcover gives me "use of uninitialized value" warnings?

    - by Kurt W. Leucht
    I'm kinda new to Module::Build, so maybe I did something wrong. Am I the only one who gets warnings when I change my dispatch from "test" to "testcover"? Is there a bug in Devel::Cover? Is there a bug in Module::Build? I probably just did something wrong. I'm using ActiveState Perl v5.10.0 with Module::Build version 0.31012 and Devel::Cover 0.64 and Eclipse 3.4.1 with EPIC 0.6.34 for my IDE. UPDATE: I upgraded to Module::Build 0.34 and the warnings are still output. *UPDATE: Looks like a bug in B::Deparse. Hope it gets fixed someday.* Here's my unit test build file: use strict; use warnings; use Module::Build; my $build = Module::Build->resume ( properties => { config_dir => '_build', }, ); $build->dispatch('test'); When I run this unit test build file, I get the following output: t\MyLib1.......ok t\MyLib2.......ok t\MyLib3.......ok All tests successful. Files=3, Tests=24, 0 wallclock secs ( 0.00 cusr + 0.00 csys = 0.00 CPU) But when I change the dispatch line to 'testcover' I get the following output which always includes a bunch of "use of uninitialized value in bitwise and" warning messages: Deleting database D:/Documents and Settings/<username>/My Documents/<SNIP>/cover_db t\MyLib1.......ok Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. t\MyLib2.......ok Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. t\MyLib3.......ok Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. Use of uninitialized value in bitwise and (&) at D:/Perl/lib/B/Deparse.pm line 4252. All tests successful. Files=3, Tests=24, 0 wallclock secs ( 0.00 cusr + 0.00 csys = 0.00 CPU) Reading database from D:/Documents and Settings/<username>/My Documents/<SNIP>/cover_db ---------------------------- ------ ------ ------ ------ ------ ------ ------ File stmt bran cond sub pod time total ---------------------------- ------ ------ ------ ------ ------ ------ ------ .../lib/ActivePerl/Config.pm 0.0 0.0 0.0 0.0 0.0 n/a 0.0 ...l/lib/ActiveState/Path.pm 0.0 0.0 0.0 0.0 100.0 n/a 4.8 <SNIP> blib/lib/<SNIP>/MyLib2.pm 100.0 90.0 n/a 100.0 100.0 0.0 98.5 blib/lib/<SNIP>/MyLib3.pm 100.0 90.9 100.0 100.0 100.0 0.6 98.0 Total 14.4 6.7 3.8 18.3 20.0 100.0 11.6 ---------------------------- ------ ------ ------ ------ ------ ------ ------ Writing HTML output to D:/Documents and Settings/<username>/My Documents/<SNIP>/cover_db/coverage.html ... done.

    Read the article

  • How do I use a custom #theme function to a fieldset in a drupal module?

    - by Rob Crowell
    I have a module that builds a form that includes a fieldset. Instead of using the <legend> element to render the fieldset title, I want to place this content in a <div> element instead. But I want to change the behavior only for the form returned by my module, so I don't want to place any new functionality into my theme's template.php file. In mymod.module I have defined: // custom rendering function for fieldset elements function theme_mymod_fieldset($element) { return 'test'; } // implement hook_theme function mymod_theme() { return array( 'mymod_fieldset' => array('arguments' => array('element' => NULL)), 'mymod_form' => array('arguments' => array()) ); } // return a form that is based on the 'Basic Account Info' category of the user profile function mymod_form() { // load the user's profile global $user; $account = user_load($user->uid); // load the profile form, and then edit it $form_state = array(); $form = drupal_retrieve_form('user_profile_form', $form_state, $account, 'Basic Account Info'); // set the custom #theme function for this fieldset $form['Basic Account Info']['#theme'] = 'mymod_fieldset'; // more form manipulations // ... return $form; } When my page gets rendered, I expected to see the fieldset representing 'Basic Account Info' to be wholly replaced by my test message 'test'. Instead what happens is that the <fieldset> and <legend> elements are rendered as normal, but with the body of the fieldset replaced by the test message instead, like this: <fieldset> <legend>Basic Account Info</legend> test </fieldset> Why doesn't my #theme function have the chance to replace the entire <fieldset> element? If I wrap a textfield in this function instead, I am able to completely replace the <input> element along with its label. Furthermore, if I provide an override in my site's template.php for theme_fieldset, it works as expected and I am able to completely replace the <fieldset>, so I know it is possible. What's different about providing #theme functions to fieldsets inside a module?

    Read the article

  • Dojo and Ajax - rendering widgets

    - by Michael Merchant
    I'm trying to load content into a Dojo content pane in a specific html tag and not replace the entire content pane. The html I'm loading includes a markup defined widget that I'd like to have rendered when the new row is loaded. So, I have a table that is being dynamically filled via ajax,ie: <body> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/dojo/1.5/dojo/dojo.xd.js" djConfig="parseOnLoad: true, isDebug:true"></script> <div id="table-pane" dojoType="dijit.layout.ContentPane"> <table class="test"> <tbody> <tr><td>Name</td><td>Year</td><td>Age</td></tr> <tr> <td><span dojoType="dijit.InlineEditBox" editor="dijit.form.Textarea">Mike</span> </td> <td>2010</td> <td>12</td> </tr> </tbody> </table> </div> </body> <script> var html ='<tr><td><span dojoType="dijit.InlineEditBox" editor="dijit.form.Textarea">John</span></td><td>2011</td><td>22</td></tr>'; dojo.require("dijit.layout.ContentPane"); dojo.require("dijit.InlineEditBox"); dojo.require("dijit.form.Textarea"); dojo.addOnLoad(function(){ pane = dijit.byId("table-pane"); add_elem(); }); function add_elem(){ var node = $(".test tr:last"); node.after(html); dojo.addOnLoad(function(){ //Here I want to initiate any widgets that haven't been initiated pane.buildRendering(); }); }</script> How do I render the Dojo widget in the new table row?

    Read the article

  • How to copy this portion of a text file out and put into a hash using rails? (VATsim datafile)

    - by Rusty Broderick
    Hi I'm trying to work out how i can cut out the section between !CLIENTS and the '; ;' and then to parse it into a hash in order to make an xml file. Honestly have no idea how to do it. The file is as follows: vatsim-data.txt original file here ; Created at 30/12/2010 01:29:14 UTC by Data Server V4.0 ; ; Data is the property of VATSIM.net and is not to be used for commercial purposes without the express written permission of the VATSIM.net Founders or their designated agent(s ). ; ; Sections are: ; !GENERAL contains general settings ; !CLIENTS contains informations about all connected clients ; !PREFILE contains informations about all prefiled flight plans ; !SERVERS contains a list of all FSD running servers to which clients can connect ; !VOICE SERVERS contains a list of all running voice servers that clients can use ; ; Data formats of various sections are: ; !GENERAL section - VERSION is this data format version ; RELOAD is time in minutes this file will be updated ; UPDATE is the last date and time this file has been updated. Format is yyyymmddhhnnss ; ATIS ALLOW MIN is time in minutes to wait before allowing manual Atis refresh by way of web page interface ; CONNECTED CLIENTS is the number of clients currently connected ; !CLIENTS section - callsign:cid:realname:clienttype:frequency:latitude:longitude:altitude:groundspeed:planned_aircraft:planned_tascruise:planned_depairport:planned_altitude:planned_destairport:server:protrevision:rating:transponder:facilitytype:visualrange:planned_revision:planned_flighttype:planned_deptime:planned_actdeptime:planned_hrsenroute:planned_minenroute:planned_hrsfuel:planned_minfuel:planned_altairport:planned_remarks:planned_route:planned_depairport_lat:planned_depairport_lon:planned_destairport_lat:planned_destairport_lon:atis_message:time_last_atis_received:time_logon:heading:QNH_iHg:QNH_Mb: ; !PREFILE section - callsign:cid:realname:clienttype:frequency:latitude:longitude:altitude:groundspeed:planned_aircraft:planned_tascruise:planned_depairport:planned_altitude:planned_destairport:server:protrevision:rating:transponder:facilitytype:visualrange:planned_revision:planned_flighttype:planned_deptime:planned_actdeptime:planned_hrsenroute:planned_minenroute:planned_hrsfuel:planned_minfuel:planned_altairport:planned_remarks:planned_route:planned_depairport_lat:planned_depairport_lon:planned_destairport_lat:planned_destairport_lon:atis_message:time_last_atis_received:time_logon:heading:QNH_iHg:QNH_Mb: ; !SERVERS section - ident:hostname_or_IP:location:name:clients_connection_allowed: ; !VOICE SERVERS section - hostname_or_IP:location:name:clients_connection_allowed:type_of_voice_server: ; ; Field separator is : character ; ; !GENERAL: VERSION = 8 RELOAD = 2 UPDATE = 20101230012914 ATIS ALLOW MIN = 5 CONNECTED CLIENTS = 515 ; ; !VOICE SERVERS: voice2.vacc-sag.org:Nurnberg:Europe-CW:1:R: voice.vatsim.fi:Finland - Sponsored by Verkkokauppa.com and NBL Solutions:Finland:1:R: rw.liveatc.net:USA, California:Liveatc:1:R: rw1.vatpac.org:Melbourne, Australia:Oceania:1:R: spain.vatsim.net:Spain:Vatsim Spain Server:1:R: voice.nyartcc.org:Sponsored by NY ARTCC:NY-ARTCC:1:R: voice.zhuartcc.net:Sponsored by Houston ARTCC:ZHU-ARTCC:1:R: ; ; !CLIENTS: 01PD:1090811:prentis gibbs KJFK:PILOT::40.64841:-73.81030:15:0::0::::USA-E:100:1:1200::::::::::::::::::::20101230010851:28:30.1:1019: 4X-BRH:1074589:george sandoval LLJR:PILOT::50.05618:-125.84429:10819:206:C337/G:150:CYAL:FL120:CCI9:EUROPE-C2:100:1:6043:::2:I:110:110:1:26:2:59:: /T/:DCT:0:0:0:0:::20101230005323:129:29.76:1007: 50125:1109107:Dave Frew KEDU:PILOT::46.52736:-121.95317:23877:471:B/B744/F:530:KTCM:30000:KLSV:USA-E:100:1:7723:::1:I:0:116:0:0:0:0:::GPS DIRECT.:0:0:0:0:::20101230012346:164:29.769:1008: 85013:1126003:Dmitry Abramov UWWW:PILOT::76.53819:71.54782:33444:423:T/ZZZZ/G:500:UUDD:FL330:ULAA:EUROPE-C2:100:1:2200:::2:I:0:2139:0:0:0:0:ULLI::BITSA DCT WM/N0485S1010 DCT KS DCT NE R22 ULWW B153 LAPEK B210 SU G476 OLATA:0:0:0:0:::20101229215815:62:53.264:1803: ; ; !SERVERS: EUROPE-C2:88.198.19.202:Europe:Center Europe Server Two:1: ; ; END I want to format the html with the tags with client being the parent and the nested tags as follows: callsign:cid:realname:clienttype:frequency:latitude:longitude:altitude:groundspeed:planned_aircraft:planned_tascruise:planned_depairport:planned_altitude:planned_destairport:server:protrevision:rating:transponder:facilitytype:visualrange:planned_revision:planned_flighttype:planned_deptime:planned_actdeptime:planned_hrsenroute:planned_minenroute:planned_hrsfuel:planned_minfuel:planned_altairport:planned_remarks:planned_route:planned_depairport_lat:planned_depairport_lon:planned_destairport_lat:planned_destairport_lon:atis_message:time_last_atis_received:time_logon:heading:QNH_iHg:QNH_Mb: Any help in solving this would be much appreciated!

    Read the article

  • CSS Collapsing/Hiding divs with no data in <span>

    - by Chance
    I am trying to display an address which includes the following information: Title, division, address1, address2, town/state/zip, and country (5 seperate lines worth of data). The problem is sometimes the company may only have the title, address1, and town/state/zip yet other times it may be all but address2. This is determined upon a db record request server side. Therefore how can I make my output look proper when some of my labels will be blank? I would like div's that contain an empty span to be essentially collapsed/removed. My only idea of how was to use jquery and a selector to find all divs with blank spans (since thats all an asp.net label really is) and then remove those divs however this seems like such bad form. Is there any way to do this with css? Possible Code would be something like: $('span:empty:only-child').parent('div').remove(); Picture Examples (Ignore spacing/indentation issues which I will fix) Missing Division, Address2, and Country All Possible Fields The Html <asp:Label runat="server" ID="lblBillingAddressHeader" CssClass="lblBillingAddressHeader" Text="Billing Address:" /> <div style="position:relative; top:150px; left: 113px;"> <div class="test"> <asp:Label runat="server" ID="lblBillingDivision" CssClass="lblBillingShippingDivisionFont" /> </div> <div class="test"> <asp:Label runat="server" ID="lblBillingAddress" CssClass="lblBillingShippingFont" /> </div> <div class="test"> <asp:Label runat="server" ID="lblBillingAddress2" CssClass="lblBillingShippingFont" /> </div> <div class="test"> <asp:Label runat="server" ID="lblBillingAddress3" CssClass="lblBillingShippingFont" /> </div> <div class="test"> <asp:Label runat="server" ID="lblBillingAddress4" CssClass="lblBillingShippingFont" /> </div> </div> The CSS .test { position: relative; top: 0px; left: 0px; height: 12px; width: 300px; } .lblBillingShippingDivisionFont { font-size: small; font-weight: bold; } .lblBillingShippingFont { font-size: 10.6px; }

    Read the article

  • Internet Explorer buggy when accessing a custom weblogic provider

    - by James
    I've created a custom Weblogic Security Authentication Provider on version 10.3 that includes a custom login module to validate users. As part of the provider, I've implemented the ServletAuthenticationFilter and added one filter. The filter acts as a common log on page for all the applications within the domain. When we access any secured URLs by entering them in the address bar, this works fine in IE and Firefox. But when we bookmark the link in IE an odd thing happens. If I click the bookmark, you will see our log on page, then after you've successfully logged into the system the basic auth page will display, even though the user is already authenticated. This never happens in Firefox, only IE. It's also intermittent. 1 time out of 5 IE will correctly redirect and not show the basic auth window. Firefox and Opera will correctly redirect everytime. We've captured the response headers and compared the success and failures, they are identical. final boolean isAuthenticated = authenticateUser(userName, password, req); // Send user on to the original URL if (isAuthenticated) { res.sendRedirect(targetURL); return; } As you can see, once the user is authenticated I do a redirect to the original URL. Is there a step I'm missing? The authenticateUser() method is taken verbatim from an example in Oracle's documents. private boolean authenticateUser(final String userName, final String password, HttpServletRequest request) { boolean results; try { ServletAuthentication.login(new CallbackHandler() { @Override public void handle(Callback[] callbacks) throws IOException, UnsupportedCallbackException { for (Callback callback : callbacks) { if (callback instanceof NameCallback) { NameCallback nameCallback = (NameCallback) callback; nameCallback.setName(userName); } if (callback instanceof PasswordCallback) { PasswordCallback passwordCallback = (PasswordCallback) callback; passwordCallback.setPassword(password.toCharArray()); } } } }, request); results = true; } catch (LoginException e) { results = false; } return results; I am asking the question here because I don't know if the issue is with the Weblogic config or the code. If this question is more suited to ServerFault please let me know and I will post there. It is odd that it works everytime in Firefox and Opera but not in Internet Explorer. I wish that not using Internet Explorer was an option but it is currently the company standard. Any help or direction would be appreciated. I have tested against IE 6 & 8 and deployed the custom provider on 3 different environments and I can still reproduce the bug.

    Read the article

  • IE6 rendering bug. Some parsed <li> elements are losing their closing tags.

    - by Jeff Fohl
    I have been working with IE6 for many years [sob], but have never seen this particular bug before, and I can't seem to find a reference to it on the Web. The problem appears to be with how IE6 is parsing the HTML of a nested list. Even though the markup is correct, IE6 somehow munges the code when it is parsed, and drops the closing tags of some of the <li> elements. For example, take the following code: <!DOCTYPE html> <head> <title>My Page</title> </head> <body> <div> <ul> <li><a href=''>Child A</a> <div> <ul> <li><a href=''>Grandchild A</a></li> </ul> </div> </li> <li><a href=''>The Child B Which Is Not A</a> <div> <ul> <li><a href=''>Grandchild B</a></li> <li><a href=''>Grandchild C</a></li> </ul> </div> </li> <li><a href=''>Deep Purple</a></li> <li><a href=''>Led Zeppelin</a></li> </ul> </div> </body> </html> Now take a look at how IE6 renders this code, after it has run it through the IE6 rendering engine: <HTML> <HEAD> <TITLE>My Page</TITLE></HEAD> <BODY> <DIV> <UL> <LI><A href="">Child A</A> <DIV> <UL> <LI><A href="">Grandchild A</A> </LI> </UL> </DIV> <LI><A href="">The Child B Which Is Not A</A> <DIV> <UL> <LI><A href="">Grandchild B</A> <LI><A href="">Grandchild C</A> </LI> </UL> </DIV> <LI><A href="">Deep Purple</A> <LI><A href="">Led Zeppelin</A> </LI> </UL> </DIV> </BODY> </HTML> Note how on some of the <li> elements there are no longer any closing tags, even though it existed in the source HTML. Does anyone have any idea what could be triggering this bug, and if it is possible to avoid it? It seems to be the source of some visual display problems in IE6. Many thanks for any advice.

    Read the article

  • java multipart POST library

    - by tom
    Is there a multipart POST library out there that achieve the same effect of doing a POST from a html form? for example - upload a file programmingly in Java versus upload the file using a html form. And on the server side, it just blindly expect the request from client side to be a multipart POST request and parse out the data as appropriate. Has anyone tried this? specifically, I am trying to see if I can simulate the following with Java The user creates a blob by submitting an HTML form that includes one or more file input fields. Your app sets blobstoreService.createUploadUrl() as the destination (action) of this form, passing the function a URL path of a handler in your app. When the user submits the form, the user's browser uploads the specified files directly to the Blobstore. The Blobstore rewrites the user's request and stores the uploaded file data, replacing the uploaded file data with one or more corresponding blob keys, then passes the rewritten request to the handler at the URL path you provided to blobstoreService.createUploadUrl(). This handler can do additional processing based on the blob key. Finally, the handler must return a headers-only, redirect response (301, 302, or 303), typically a browser redirect to another page indicating the status of the blob upload. Set blobstoreService.createUploadUrl as the form action, passing the application path to load when the POST of the form is completed. <body> <form action="<%= blobstoreService.createUploadUrl("/upload") %>" method="post" enctype="multipart/form-data"> <input type="file" name="myFile"> <input type="submit" value="Submit"> </form> </body> Note that this is how the upload form would look if it were created as a JSP. The form must include a file upload field, and the form's enctype must be set to multipart/form-data. When the user submits the form, the POST is handled by the Blobstore API, which creates the blob. The API also creates an info record for the blob and stores the record in the datastore, and passes the rewritten request to your app on the given path as a blob key.

    Read the article

  • How do I use accepts_nested_attributes_for?

    - by Angela
    Editing my question for conciseness and to update what I've done: How do I model having multiple Addresses for a Company and assign a single Address to a Contact, and be able to assign them when creating or editing a Contact? I want to use nested attributes to be able to add an address at the time of creating a new contact. That address exists as its own model because I may want the option to drop-down from existing addresses rather than entering from scratch. I can't seem to get it to work. I get a undefined method `build' for nil:NilClass error Here is my model for Contacts: class Contact < ActiveRecord::Base attr_accessible :first_name, :last_name, :title, :phone, :fax, :email, :company, :date_entered, :campaign_id, :company_name, :address_id, :address_attributes belongs_to :company belongs_to :address accepts_nested_attributes_for :address end Here is my model for Address: class Address < ActiveRecord::Base attr_accessible :street1, :street2, :city, :state, :zip has_many :contacts end I would like, when creating an new contact, access all the Addresses that belong to the other Contacts that belong to the Company. So here is how I represent Company: class Company < ActiveRecord::Base attr_accessible :name, :phone, :addresses has_many :contacts has_many :addresses, :through => :contacts end Here is how I am trying to create a field in the View for _form for Contact so that, when someone creates a new Contact, they pass the address to the Address model and associate that address to the Contact: <% f.fields_for :address, @contact.address do |builder| %> <p> <%= builder.label :street1, "Street 1" %> </br> <%= builder.text_field :street1 %> <p> <% end %> When I try to Edit, the field for Street 1 is blank. And I don't know how to display the value from show.html.erb. At the bottom is my error console -- can't seem to create values in the address table: My Contacts controller is as follows: def new @contact = Contact.new @contact.address.build # Iundefined method `build' for nil:NilClass @contact.date_entered = Date.today @campaigns = Campaign.find(:all, :order => "name") if params[:campaign_id].blank? else @campaign = Campaign.find(params[:campaign_id]) @contact.campaign_id = @campaign.id end if params[:company_id].blank? else @company = Company.find(params[:company_id]) @contact.company_name = @company.name end end def create @contact = Contact.new(params[:contact]) if @contact.save flash[:notice] = "Successfully created contact." redirect_to @contact else render :action => 'new' end end def edit @contact = Contact.find(params[:id]) @campaigns = Campaign.find(:all, :order => "name") end Here is a snippet of my error console: I am POSTING the attribute, but it is not CREATING in the Address table.... Processing ContactsController#create (for 127.0.0.1 at 2010-05-12 21:16:17) [POST] Parameters: {"commit"="Submit", "authenticity_token"="d8/gx0zy0Vgg6ghfcbAYL0YtGjYIUC2b1aG+dDKjuSs=", "contact"={"company_name"="Allyforce", "title"="", "campaign_id"="2", "address_attributes"={"street1"="abc"}, "fax"="", "phone"="", "last_name"="", "date_entered"="2010-05-12", "email"="", "first_name"="abc"}} Company Load (0.0ms)[0m [0mSELECT * FROM "companies" WHERE ("companies"."name" = 'Allyforce') LIMIT 1[0m Address Create (16.0ms)[0m [0;1mINSERT INTO "addresses" ("city", "zip", "created_at", "street1", "updated_at", "street2", "state") VALUES(NULL, NULL, '2010-05-13 04:16:18', NULL, '2010-05-13 04:16:18', NULL, NULL)[0m Contact Create (0.0ms)[0m [0mINSERT INTO "contacts" ("company", "created_at", "title", "updated_at", "campaign_id", "address_id", "last_name", "phone", "fax", "company_id", "date_entered", "first_name", "email") VALUES(NULL, '2010-05-13 04:16:18', '', '2010-05-13 04:16:18', 2, 2, '', '', '', 5, '2010-05-12', 'abc', '')[0m

    Read the article

  • Python File Search Line And Return Specific Number of Lines after Match

    - by Simos Anderson
    I have a text file that has lines representing some data sets. The file itself is fairly long but it contains certain sections of the following format: Series_Name INFO Number of teams : n1 | Team | # | wins | | TeamName1 | x | y | . . . | TeamNamen1 | numn | numn | Some Irrelevant lines Series_Name2 INFO Number of teams : n1 | Team | # | wins | | TeamName1 | num1 | num2 | . where each section has a header that begins with the Series_Name. Each Series_Name is different. The line with the header also includes the number of teams in that series, n1. Following the header line is a set of lines that represents a table of data. For each series there are n1+1 rows in the table, where each row shows an individual team name and associated stats. I have been trying to implement a function that will allow the user to search for a Team name and then print out the line in the table associated with that team. However, certain team names show up under multiple series. To resolve this, I am currently trying to write my code so that the user can search for the header line with series name first and then print out just the following n1+1 lines that represent the data associated with the series. Here's what I have come up with so far: import re print fname = raw_input("Enter filename: ") seriesname = raw_input("Enter series: ") def findcounter(fname, seriesname): logfile = open(fname, "r") pat = 'INFO Number of teams :' for line in logfile: if seriesname in line: if pat in line: s=line pattern = re.compile(r"""(?P<name>.*?) #starting name \s*INFO #whitespace and success \s*Number\s*of\s*teams #whitespace and strings \s*\:\s*(?P<n1>.*)""",re.VERBOSE) match = pattern.match(s) name = match.group("name") n1 = int(match.group("n1")) print name + " has " + str(n1) + " teams" lcount = 0 for line in logfile: if line.startswith(name): if pat in line: while lcount <= n1: s.append(line) lcount += 1 return result The first part of my code works; it matches the header line that the person searches for, parses the line, and then prints out how many teams are in that series. Since the header line basically tells me how many lines are in the table, I thought that I could use that information to construct a loop that would continue printing each line until a set counter reached n1. But I've tried running it, and I realize that the way I've set it up so far isn't correct. So here's my question: How do you return a number of lines after a matched line when given the number of desired lines that follow the match? I'm new to programming, and I apologize if this question seems silly. I have been working on this quite diligently with no luck and would appreciate any help.

    Read the article

  • Can this way of storing typed objects be improved?

    - by Pindatjuh
    This is an "can it be improved"-question. Topic: Storing typed objects in memory. Background information: I'm building a compiler for the x86-32 Windows platform for my language. My goal includes typed objects. Idea: Every primitive is a semi-class (it can be used as if it was a normal class, but it's stored more compact). Every class is represented by primitives and some meta-data (containing class-properties, inheritance stuff, etc.). The meta-data is complex: it doesn't use fields but instead context-switches. For primitives, the meta-data is very small, compared to a "real" class, which is alot bigger. This enables another idea that "primitives are objects", in my language, which I found nessecairy. Example: If I have an array of 32 booleans, then the pure content of this array is exactly 4 byte (32 bits of booleans). The meta-data will contain flags that the type is an array of booleans, which contains 32 entries. The meta-data is very compacted, on bit-level: using a sort of "packing" mechanism, which is read by a FSM at runtime, when doing inspection of the type (like when passing the object to methods for checking, etc.) For instance (read from left to right, top to bottom, remember vertical position when going to the right, and check nearest column header for meaning of switch): Primitive? Array? Type-Meta 1 Byte? || Size (1 byte) 1 1 [...] 1 [...] done 0 2 Bytes? || Size (2 bytes) 1 [...] done || Size (4 bytes) 0 [...] done Integer? 1 Byte? 2 Bytes? 0 1 0 1 done 1 done 0 done Boolean? Byte? 0 1 0 done 1 done More-Primitives 0 .... Class-Stuff (Huge) 0 ... (After reaching done the data is inserted. || = byte alignment. [...] is variable sized. ... is not described here, for simplicity. And let's call them cost-based-data-structures.) For an array of 32 booleans containing all true values, the memory for this type would be (read top-down): 1 Primitive 1 Array 1 ArrayType: Primitive 0 Not-Array 0 Not-Integer 1 Boolean 0 Not-Byte (thus bit) 1 Integer Size: 1 Byte 00100000 Array size 01010101 01010101 01010101 01010101 Data (user defined) Thus, 8 bytes represent 32 booleans in an array: 11100101 00100000 01010101 01010101 01010101 01010101 How can I improve this? (Both performance- and memory-consumption wise)

    Read the article

  • Hide public method used to help test a .NET assembly

    - by ChrisW
    I have a .NET assembly, to be released. Its release build includes: A public, documented API of methods which people are supposed to use A public but undocumented API of other methods, which exist only in order to help test the assembly, and which people are not supposed to use The assembly to be released is a custom control, not an application. To regression-test it, I run it in a testing framework/application, which uses (in addition to the public/documented API) some advanced/undocumented methods which are exported from the control. For the public methods which I don't want people to use, I excluded them from the documentation using the <exclude> tag (supported by the Sandcastle Help File Builder), and the [EditorBrowsable] attribute, for example like this: /// <summary> /// Gets a <see cref="IEditorTransaction"/> instance, which helps /// to combine several DOM edits into a single transaction, which /// can be undone and redone as if they were a single, atomic operation. /// </summary> /// <returns>A <see cref="IEditorTransaction"/> instance.</returns> IEditorTransaction createEditorTransaction(); /// <exclude/> [EditorBrowsable(EditorBrowsableState.Never)] void debugDumpBlocks(TextWriter output); This successfully removes the method from the API documentation, and from Intellisense. However, if in a sample application program I right-click on an instance of the interface to see its definition in the metadata, I can still see the method, and the [EditorBrowsable] attribute as well, for example: // Summary: // Gets a ModelText.ModelDom.Nodes.IEditorTransaction instance, which helps // to combine several DOM edits into a single transaction, which can be undone // and redone as if they were a single, atomic operation. // // Returns: // A ModelText.ModelDom.Nodes.IEditorTransaction instance. IEditorTransaction createEditorTransaction(); // [EditorBrowsable(EditorBrowsableState.Never)] void debugDumpBlocks(TextWriter output); Questions: Is there a way to hide a public method, even from the meta data? If not then instead, for this scenario, would you recommend making the methods internal and using the InternalsVisibleTo attribute? Or would you recommend some other way, and if so what and why? Thank you.

    Read the article

  • Hibernate - H2 db -- Could not parse mapping document from resource

    - by user1849757
    * Each of below files are in same location * Error : SLF4J: Failed to load class "org.slf4j.impl.StaticLoggerBinder". SLF4J: Defaulting to no-operation (NOP) logger implementation SLF4J: See http://www.slf4j.org/codes.html#StaticLoggerBinder for further details. org.hibernate.InvalidMappingException: Could not parse mapping document from resource ./employee.hbm.xml at org.hibernate.cfg.Configuration.addResource(Configuration.java:616) at org.hibernate.cfg.Configuration.parseMappingElement(Configuration.java:1635) at org.hibernate.cfg.Configuration.parseSessionFactory(Configuration.java:1603) at org.hibernate.cfg.Configuration.doConfigure(Configuration.java:1582) at org.hibernate.cfg.Configuration.doConfigure(Configuration.java:1556) at org.hibernate.cfg.Configuration.configure(Configuration.java:1476) at org.hibernate.cfg.Configuration.configure(Configuration.java:1462) at com.yahoo.hibernatelearning.FirstExample.main(FirstExample.java:19) Caused by: org.hibernate.InvalidMappingException: Could not parse mapping document from input stream at org.hibernate.cfg.Configuration.addInputStream(Configuration.java:555) at org.hibernate.cfg.Configuration.addResource(Configuration.java:613) ... 7 more Caused by: org.dom4j.DocumentException: http://hibernate.sourceforge.net/%0Ahibernate-mapping-3.0.dtd Nested exception: http://hibernate.sourceforge.net/%0Ahibernate-mapping-3.0.dtd at org.dom4j.io.SAXReader.read(SAXReader.java:484) at org.hibernate.cfg.Configuration.addInputStream(Configuration.java:546) ... 8 more Exception in thread "main" java.lang.NullPointerException at com.yahoo.hibernatelearning.FirstExample.main(FirstExample.java:33) Hibernate Config: hibernate.cfg.xml <?xml version='1.0' encoding='utf-8'?> <!DOCTYPE hibernate-configuration PUBLIC "-//Hibernate/Hibernate Configuration DTD//EN" "http://hibernate.sourceforge.net/hibernate-configuration-3.0.dtd"> <hibernate-configuration> <session-factory> <property name="hibernate.connection.driver_class">org.h2.Driver</property> <property name="hibernate.connection.url">jdbc:h2:./db/repository</property> <property name="hibernate.connection.username">sa</property> <property name="hibernate.connection.password"></property> <property name="hibernate.default_schema">PUBLIC</property> <property name="hibernate.dialect">org.hibernate.dialect.H2Dialect</property> <property name="hibernate.show_sql">true</property> <property name="hibernate.hbm2ddl.auto">update</property> <!-- Mapping files --> <mapping resource="./employee.hbm.xml"/> </session-factory> </hibernate-configuration> Mapping Config: employee.hbm.xml <?xml version="1.0"?> <!DOCTYPE hibernate-mapping PUBLIC "-//Hibernate/Hibernate Mapping DTD 3.0//EN" "http://hibernate.sourceforge.net/ hibernate-mapping-3.0.dtd"> <hibernate-mapping> <class name="com.yahoo.hibernatelearning.Employee" table="employee"> <id name="empId" type="int" column="emp_id" > <generator class="native"/> </id> <property name="empName"> <column name="emp_name" /> </property> <property name="empSal"> <column name="emp_sal" /> </property> </class> </hibernate-mapping>

    Read the article

  • Change the Session Variable Output

    - by user567230
    Hello I am using Dreamweaver CS5 with Coldfusion 9 to build a dynamic website. I have a MS Access Database that stores login information which includes ID, FullName, FirstName, LastName, Username, Pawword, AcessLevels. My question is this: I currently have session variable to track the Username when it is entered into the login page. However I would like to use that Username to pull the User's FullName to display throughout the web pages and use for querying data. How do I change the session variable to read that when they are not entering their FullName on the login page but only Username and password. I have listed my login information code below if there is any additional information needed please let me know. This is the path for which the FullName values reside DataSource "Access" Table "Logininfo" Field "FullName" I want the FullName to be unique based on the Username submitted from the Login page. I apologize in advance for any rookie mistake I may have made I am new to this but learning fast! Ha. <cfif IsDefined("FORM.username")> <cfset MM_redirectLoginSuccess="members_page.cfm"> <cfset MM_redirectLoginFailed="sorry.cfm"> <cfquery name="MM_rsUser" datasource="Access"> SELECT FullName, Username,Password,AccessLevels FROM Logininfo WHERE Username=<cfqueryparam value="#FORM.username#" cfsqltype="cf_sql_clob" maxlength="50"> AND Password=<cfqueryparam value="#FORM.password#" cfsqltype="cf_sql_clob" maxlength="50"> </cfquery> <cfif MM_rsUser.RecordCount NEQ 0> <cftry> <cflock scope="Session" timeout="30" type="Exclusive"> <cfset Session.MM_Username=FORM.username> <cfset Session.MM_UserAuthorization=MM_rsUser.AccessLevels[1]> </cflock> <cfif IsDefined("URL.accessdenied") AND false> <cfset MM_redirectLoginSuccess=URL.accessdenied> </cfif> <cflocation url="#MM_redirectLoginSuccess#" addtoken="no"> <cfcatch type="Lock"> <!--- code for handling timeout of cflock ---> </cfcatch> </cftry> </cfif> <cflocation url="#MM_redirectLoginFailed#" addtoken="no"> <cfelse> <cfset MM_LoginAction=CGI.SCRIPT_NAME> <cfif CGI.QUERY_STRING NEQ ""> <cfset MM_LoginAction=MM_LoginAction & "?" & XMLFormat(CGI.QUERY_STRING)> </cfif> </cfif>

    Read the article

  • Windows Question: RunOnce/Second Boot Issues [closed]

    - by Greg
    Moved to Super User: Windows Question: RunOnce/Second Boot Issues I am attempting to create a Windows XP SP3 image that will run my application on Second Boot. Here is the intended workflow. 1) Run Image Prep Utility (I wrote) on windows to add my runonce entries and clean a few things up. 2) Reboot to ghost, make image file. 3) Package into my ISO and distribute. 4) System will be imaged by user. 5) On first boot, I have about 5 things that run, one of which includes a driver updater (I wrote) for my own specific devices. 6) One of the entries inside of HKCU/../runonce is a reg file, which adds another key to HKLM/../runonce. This is how second boot is acquired. 7) As a result of the driver updater, user is prompted to reboot. 8) My application is then launched from HKLM/../runonce on second boot. This workflow works perfectly, except for a select few legacy systems that contain devices that cause the add hardware wizard to pop up. When the add hardware wizard pops up is when I begin to see problems. It's important to note, that if I manually inspect the registry after the add hardware wizard pops up, it appears as I would expect, with all the first boot scripts having run, and it's sitting in a state I would correctly expect it to be in for a second boot scenario. The problem comes when I click next on the add hardware wizard, it seems to re-run the single entry I've added, and re-executes the runonce scripts. (only one script now as it's already executed and cleared out the initial entries). This causes my application to open as if it were a second boot, only when next is clicked on the add hardware wizard. If I click cancel, and reboot, then it also works as expected. I don't care as much about other solutions, because I could design a system that doesn't fully rely on Microsoft's registry. I simply can't find any information as to WHY this is happening. I believe this is some type of Microsoft issue that's presenting itself as a result of an overstretched image that's expected to support too many legacy platforms, but any help that can be provided would be appreciated. Thanks,

    Read the article

  • session management: problem displaying username in the header

    - by aeonsleo
    hi, I am working on a simple login and logout module for my website without any security. I am using wamp on a windows xp machine. I am creating session when a user submits the login informaton it redirects to a process.php file which creates the session variables and starts session. Now if the login is successful user is redirected to the welcome page which includes a header file(which displays the header involving signin logout help options) The problem is the header is not changing the signin link to logout as the user logs successfully. The below code is from process.php which initiates a login. $username = $_POST['username']; $password = $_POST['password']; //echo "{$username}:{$password}"; $connection = mysql_connect("localhost","root",""); if(!$connection) { die("Database Connection Failed".mysql_error()); } $db_select = mysql_select_db("tester",$connection); if(!$db_select) { die("Database Selection Failed".mysql_error()); } $result = mysql_query("SELECT * FROM user",$connection); if(!$result) { die("Database Selection Failed".mysql_error()); } $q = "SELECT * FROM user " ."WHERE Name='".$username."' AND Password='".$password. "' "; // Run query $r = mysql_query($q); if ( $obj = @mysql_fetch_object($r) ) { session_start(); // Login good, create session variables $_SESSION["valid_id"] = session_id(); $_SESSION["valid_user"] = $_POST["username"]; $_SESSION["valid_time"] = time(); Header('Location: welcome.php'); The following code is from header.php which is included in welcome.php </div> <div id = "userdetail"> <?php if(isset($_SESSION["valid_user"])) { echo($_SESSION["valid_user"]." " ); echo("<a href=logout.php>Logout</a>"); } else { echo("<a href = login.php>Sign In</a>"); } ?> | Help | Search <input type = "text" name = "searchbox" value = "" /> </div> </div>

    Read the article

  • PHP - JSON Steam API query

    - by Hunter
    First time using "JSON" and I've just been working away at my dissertation and I'm integrating a few features from the steam API.. now I'm a little bit confused as to how to create arrays. function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530'); $test = decode_url($api); var_dump($test['response']['players'][0]['personaname']['steamid']); } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $data = file_get_contents($url); $data_output = json_decode($data, true); return $data_output; } So ea I've wrote a simple method to decode Json as I'll be doing a fair bit.. But just wondering the best way to print out arrays.. I can't for the life of me get it to print more than 1 element without it retunring an error e.g. Warning: Illegal string offset 'steamid' in /opt/lampp/htdocs/lan/lan-includes/scripts/class.steam.php on line 48 string(1) "R" So I can print one element, and if I add another it returns errors. EDIT -- Thanks for help, So this was my solution: function test_steamAPI() { $api = ('http://api.steampowered.com/ISteamUser/GetPlayerSummaries/v0002/?key='.get_Steam_api().'&steamids=76561197960435530,76561197960435530'); $data = decode_url($api); foreach($data ['response']['players'] as $player) { echo "Steam id:" . $player['steamid'] . "\n"; echo "Community visibility :" . $player['communityvisibilitystate'] . "\n"; echo "Player profile" . $player['profileurl'] ."\n"; } } //Function to decode and return the data. function decode_url($url) { $decodeURL = $url; $json = file_get_contents($decodeURL); $data_output = json_decode($json, true); return $data_output; } Worked this out by taking a look at the data.. and a couple json examples, this returns an array based on the Steam API URL (It works for multiple queries.... just FYI) and you can insert loops inside for items etc.. (if anyone searches for this).

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 274 275 276 277 278 279 280 281 282 283 284 285  | Next Page >