Search Results

Search found 9564 results on 383 pages for 'character encoding'.

Page 28/383 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • requesting ajax via HttpWebRequest

    - by Sami Abdelgadir Mohammed
    Hi guys: I'm writing a simple application that will download some piece of data from a website then I can use it later for any purpose The following is the request and response copied from Firebug as the browser did that... when u type http://x5.travian.com.sa/ajax.php?f=k7&x=18&y=-186&xx=12&yy=-192 you will get a php file has some data.. But when I make a request with HttpWebRequest I get wrong data (some unknown letters) Can anyone help me in that.. and if I have to make some encodings or what?? I will be so appreciated.. Response Server nginx Date Tue, 04 Jan 2011 23:03:49 GMT Content-Type application/json; charset=UTF-8 Transfer-Encoding chunked Connection keep-alive X-Powered-By PHP/5.2.8 Expires Mon, 26 Jul 1997 05:00:00 GMT Last-Modified Tue, 04 Jan 2011 23:03:49 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Pragma no-cache Content-Encoding gzip Vary Accept-Encoding Request Host x5.travian.com.sa User-Agent Mozilla/5.0 (Windows; U; Windows NT 6.1; en-US; rv:1.9.2.13) Gecko/20101203 Firefox/3.6.13 Accept text/html,application/xhtml+xml,application/xml;q=0.9,/;q=0.8 Accept-Language en-us,en;q=0.5 Accept-Encoding gzip,deflate Accept-Charset ISO-8859-1,utf-8;q=0.7,*;q=0.7 Keep-Alive 115 Connection keep-alive Cookie CAD=57878984%231292375897%230%230%23%230; T3E=%3DImYykTN2EzMmhjO5QTM2QDN2oDM1ITOyoDOxIjM4EDN5ITM6gjO4MDOxIWZyQWMipTZu9metl2ctl2c6MDNxADN6MDNxADNjMDNxADNjMDNxADN; orderby_b1=0; orderby_b=0; orderby2=0; orderby=0

    Read the article

  • Foreign/accented characters in sql query

    - by FromCanada
    I'm using Java and Spring's JdbcTemplate class to build an SQL query in Java that queries a Postgres database. However, I'm having trouble executing queries that contain foreign/accented characters. For example the (trimmed) code: JdbcTemplate select = new JdbcTemplate( postgresDatabase ); String query = "SELECT id FROM province WHERE name = 'Ontario';"; Integer id = select.queryForObject( query, Integer.class ); will retrieve the province id, but if instead I did name = 'Québec' then the query fails to return any results (this value is in the database so the problem isn't that it's missing). I believe the source of the problem is that the database I am required to use has the default client encoding set to SQL_ASCII, which according to this prevents automatic character set conversions. (The Java environments encoding is set to 'UTF-8' while I'm told the database uses 'LATIN1' / 'ISO-8859-1') I was able to manually indicate the encoding when the resultSets contained values with foreign characters as a solution to a previous problem with a similar nature. Ex: String provinceName = new String ( resultSet.getBytes( "name" ), "ISO-8859-1" ); But now that the foreign characters are part of the query itself this approach hasn't been successful. (I suppose since the query has to be saved in a String before being executed anyway, breaking it down into bytes and then changing the encoding only muddles the characters further.) Is there a way around this without having to change the properties of the database or reconstruct it? PostScript: I found this function on StackOverflow when making up a title, it didn't seem to work (I might not have used it correctly, but even if it did work it doesn't seem like it could be the best solution.):

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • NSString to NSData Failing in Encoding

    - by Travis
    I'm trying to use NSXmlParser to parse ISO-8859-1 data. Using Apple's own example for parsing ISO-8859-1, I have the following. NSString *xmlFilePath = [[NSBundle mainBundle] pathForResource:sampleFileName ofType:@"xml"]; NSString *xmlFileContents = [NSString stringWithContentsOfFile:xmlFilePath encoding:NSISOLatin1StringEncoding error:nil]; NSLog(@"contents: %@", xmlFileContents); I see that in the console, the contents of the string is accurate. However when I try to convert it to an NSData object (for use with the parser), I do the following. NSData *xmlData = [xmlFileContents dataUsingEncoding:NSISOLatin1StringEncoding]; But then when my didStartElement delegate gets called, I see  showing up which I think is from an encoding discrepancy. Can NSXmlParser handle ISO-8859-1 and if so, what am I doing wrong?

    Read the article

  • Unable to encode to iso-8859-1 encoding for some chars using Perl Encode module

    - by ppant
    I have a HTML string in ISO-8859-1 encoding. I need to pass this string to HTML:Entities::decode_entities() for converting some of the HTML ASCII codes to respective chars. To so i am using a module HTML::Parser::Entities 3.65 but after decode_entities() operation my whole string changes to utf-8 string. This behavior seems fine as the documentation of the HTML::Parse. As i need this string back in ISO-8859-1 format for further processing so i have used Encode::encode("iso-8859-1",$str) to change the string back to ISO-8859-1 encoding. My results are fine excepts for some chars, a question mark is coming instead. One example is single quote ' ASCII code (’) Can anybody help me if there any limitation of Encode module? Any other pointer will also be helpful to solve the problem. Thanks

    Read the article

  • invalid token error while parsing an XML file with UTF-8 encoding

    - by Niranjan
    invalid token error while parsing an XML file with UTF-8 encoding. This error is coming when it encountered extended ASCII character 'â' { "â", "â" }. When I have changed the encoding from UTF-8 to ISO-8859-1 the parsing is successful. But my application should support UTF-8, ASCII and extended ASCII characters. What should I do for this? Any ideas are welcome. Thanks in Advance for your time and solution.

    Read the article

  • Tomcat Compression Does Not Add a Content-Encoding: gzip in the Header

    - by Julien Chastang
    I am using Tomcat to compress my HTML content like this: <Connector port="8080" maxHttpHeaderSize="8192" maxProcessors="150" maxThreads="150" minSpareThreads="25" maxSpareThreads="75" enableLookups="false" redirectPort="8443" acceptCount="150" connectionTimeout="20000" disableUploadTimeout="true" compression="on" compressionMinSize="128" noCompressionUserAgents="gozilla, traviata" compressableMimeType="text/html" URIEncoding="UTF-8" /> In the HTTP header (as observed via YSlow), however, I am not seeing Content-Encoding: gzip resulting in a poor YSlow score. All I see is HeadersPost Response Headers Server: Apache-Coyote/1.1 Content-Type: text/html;charset=ISO-8859-1 Content-Language: en-US Content-Length: 5251 Date: Sat, 14 Feb 2009 23:33:51 GMT I am running an apache mod_jk Tomcat configuration. How do I compress HTML content with Tomcat, and also have it add "Content-Encoding: gzip" in the header?

    Read the article

  • Can not set Character Encoding using sun-web.xml

    - by stck777
    I am trying to send special characters like spanish chars from my page to a JSP page as a form parameter. When I try get the parameter which I sent, it shows that as "?" (Question mark). After searching on java.net thread I came to know that I should have following entry in my sun-web.xml <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE sun-web-app PUBLIC "-//Sun Microsystems, Inc.//DTD Sun ONE Application Server 8.0 Servlet 2.4//EN" "http://www.sun.com/software/sunone/appserver/dtds/sun-web-app_2_4-0.dtd"> <sun-web-app> <locale-charset-info default-locale="es"> <locale-charset-map locale="es" charset="UTF-8"/> <parameter-encoding default-charset="UTF-8"/> </locale-charset-info> </sun-web-app> But it did not work with this approach still the character goes as "?".

    Read the article

  • Intra-Unicode "lean" Encoding Converters

    - by Mystagogue
    Windows provides encoding conversion functions ("MultiByteToWideChar" and "WideCharToMultiByte") which are capable of UTF-8 to/from UTF-16 conversions, among other things. But I've seen people offer home-grown 30 to 40 line functions that claim also to perform UTF-8 / UTF-16 encoding conversions. My question is, how reliable are such tiny converters? Can such a tiny amount of code handle problems such as converting a UTF-16 surrogate pair (such as ) into a UTF-8 single four byte sequence (rather than making the mistake of converting into a pair of three byte sequences)? Can they correctly spot "unpaired" surrogate input, and provide an error? In short, are such tiny converters mere toys, or can they be taken seriously? For that matter, why does unicode.org seemingly offer no advice on an algorithm for accomplishing such conversions?

    Read the article

  • Syncronize an SVN repo (svnsync) with encoding errors

    - by Hamish
    Is it possible to fix/bypass non-UTF8 encoded svn:log records when syncronizing repositories with svnsync? Background I'm in the process of taking over the maintenance of an open source module that is stored within a large (well over 10,000 revisions) subversion (1.5.5) repository. I do not have admin access to the remote repository to dump/filter/load the module. The old repository is being discontinued and I am trying to sync the original sub module to my local (1.6+) repository with svnsync. For example: svnsync file://home/svn/temp-repo/ http://path.to.repo/modulename/ The problem is that the old repository didn't enforce UTF8 encoding and I'm hitting errors like: svnsync: Cannot accept 'svn:log' property because it is not encoded in UTF-8 I can't modify the log property in the source repository so I need to somehow modify or ignore the property value when the encoding is unknown/invalid. Any ideas? For example, is it possible to write a pre-revprop-change script to modify the log property in transit?

    Read the article

  • Php/ODBC encoding problem

    - by JohnM2
    I use ODBC to connect to SQL Server from PHP. In PHP I read some string (nvarchar column) data from SQL Server and then want to insert it to mysql database. When I try to insert such value to mysql database table I get this mysql error: Incorrect string value: '\xB3\xB9ow...' for column 'name' at row 1 For string with all ASCII characters everything is fine, the problem occurs when non-ASCII characters (from some European languages) exist. So, in more general terms: there is a Unicode string in MS SQL Server database, which is retrieved by PHP trough ODBC. Then it is put in sql insert query (as value for utf-8 varchar column) which is executed for mysql database. Can someone explain to me what is happening in this situation in terms of encoding? At which step what character encoding convertions may take place? I use: PHP 5.2.5, MySQL5.0.45-community-nt, MS Sql Server 2005.

    Read the article

  • Video encoding by servlet with MEncoder

    - by Andrey
    Hello. I was developing an application for video encoding on the server and got a problem with encoding video with MEncoder. This decoder doesn't work correctly when runned by a command line with Runtime.getRuntime().exec(“D:\mencoder\mnc\mencoder.exe video1.avi -o outvideo1.flv -of lavf -oac mp3lame -lameopts abr:br=64 -srate 22050 -ovc lavc -lavcopts vcodec=flv:vbitrate=300:mbd=2:mv0:trell:v4mv:cbp:last_pred=3 -vf scale=320:240,harddup -quiet”) ; The decoder launches and works in windows console with my parameters, but when it's run from a servlet it just hangs in process list and doesn't do anything before the web-server is stopped. When trying to use decoder from a simple java applcation, it runs correctly. Thanks for help.

    Read the article

  • FFmpeg + iPhone - Interesting (incorrect?) video encoding results

    - by jtrim
    I'm encoding some video on the iPhone by running the png image data through swscale to get YUV420P data then encoding that frame using the MSMPEG4V1 codec. In the api docs, avcodec_encode_video should return the number of bytes used from the output buffer by that encode operation. There are 234,000 bytes going into the encoder, but the result returned by avcodec_encode_video is simply "4". The result is exactly the same over 24 frames. Something seems fishy here...any insight? Here's a pastebin link to the code: http://pastebin.com/ht94FWva (sorry for the link away from SO, I just didn't want to have the code duplicated in several places) EDIT: Also, I've set up a custom log callback for ffmpeg to use and I have the log level set to "Verbose" (libavutil/log.h), so libavcodec should be logging any goofs to the console, but avcodec is quiet throught he whole operation. (note: I did test to make sure my log callback was working)

    Read the article

  • Loading xml with encoding UTF 16 using XDocument

    - by Sangram
    Hi, I am trying to read the xml document using XDocument method . but i am getting an error when xml has <?xml version="1.0" encoding="utf-16"?> When i removed encoding manually.It works perfectly. I am getting error " There is no Unicode byte order mark. Cannot switch to Unicode. " i tried searching and i landed up here-- Why does C# XmlDocument.LoadXml(string) fail when an XML header is included? But could not solve my problem. My code : XDocument xdoc = XDocument.Load(path); Any suggestions ?? thank you.

    Read the article

  • If a command line program is unsure of stdout's encoding, what encoding should it output?

    - by mackstann
    I have a command line program written in Python, and when I pipe it through another program on the command line, sys.stdout.encoding is None. This makes sense, I suppose -- the output could be another program, or a file you're redirecting it into, or whatever, and it doesn't know what encoding is desired. But neither do I! This program will be used by many different people (humor me) in different ways. Should I play it safe and output only ascii (replacing non-ascii chars with question marks)? Or should I output UTF-8, since it's so widespread these days?

    Read the article

  • RegEx - Take all numeric characters following a text character

    - by Simon
    Given a string in the format: XXX999999v99 (where X is any alpha character and v is any numeric character and v is a literal v character) how can I get a regex to match the numeric characters following the v? So far I've got 'v\d\d' which includes the v but ideally I'd like just the numeric part. As an aside does anyone know of a tool in which you can specify a string to match and have the regex generated? Modifying an existing regex is one thing but I find starting from scratch painful! Edit: Re-reading this question I realise it reads like a homework assignment! However I can assure you it's not, the strings I'm trying to match represent product versions appended to product codes. The current code uses all sorts of substring expressions to retrieve the version part.

    Read the article

  • Tomcat gzip while chunked issue

    - by hoodoos
    I'm expiriencing some problem with one of my data source services. As it says in HTTP response headers it's running on Apache-Coyote/1.1. Server gives responses with Transfer-Encoding: chunked, here sample response: HTTP/1.1 200 OK Server: Apache-Coyote/1.1 Content-Type: text/xml;charset=utf-8 Transfer-Encoding: chunked Content-Encoding: gzip Date: Tue, 30 Mar 2010 06:13:52 GMT And problem is when I'm requesting server to send gzipped request it often sends not full response. I recieve response, see that last chunk recieved, but then after ungzipping I see that response is partial. I never seen such behavior with gzip turned off in request headers. So my question is: is it common tomcat issue? maybe one of it's mod which is doing compression? Or maybe it maybe some kind of proxy issue? I can't tell about versions of tomcat or what gzip mod they use, but feel free to ask, i'll try ask my service provider. Thanks.

    Read the article

  • 3D Character/Model Creator

    - by Click Ok
    I'm in a project to create a 3d game using XNA/C#, and the game will use a lot of 3d characters. Looking at the current 3d games, in some they create near to hundreds of characters, what lead me to think that there are some good 3d character/model creator. To narrow the sample, the game will have characters like the game "Grand Chase". There are some good (and easy) character model creator for to use in XNA development? Free is better, of course, but I will get payed versions too. EDIT: Another question is about the movements of the characters. The movements like walk, jump, sit, etc are "created" by the "character creator tool" or by the game?

    Read the article

  • Preserving multi-byte characters in Flex XML object

    - by Dan Petker
    I'm having an issue with the Flex XML object type mangling multi-byte characters (such as Japanese or Chinese characters). The basic setup is this. I'm getting an XML-formatted string from the server, and in that string there can be multi-byte characters. A lot of the time, these characters are in attributes, for example: <example id="foo" name="[some multi-byte characters]"/> Now, when I examine the raw string, the multi-byte characters display just fine. However, as soon as I convert the string to an XML object using the top-level XML() function, all the multi-byte characters become mangled. I've tried setting the XML's encoding by including an <?xml version="1.0" encoding="utf-8"?> element in the XML-formatted string, but this doesn't seem to have any effect on the resulting XML object. Is there a way to get the XML object to respect the encoding of the XML-formatted string and prevent the multi-byte characters from being mangled?

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >