Search Results

Search found 22631 results on 906 pages for 'null character'.

Page 28/906 | < Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >

  • Setting nested object to null when combobox has empty value

    - by Javi
    Hello, I have a Class which models a User and another which models his country. Something like this: public class User{ private Country country; //other attributes and getter/setters } public class Country{ private Integer id; private String name; //other attributes and getter/setters } I have a Spring form where I have a combobox so the user can select his country or can select the undefined option to indicate he doen't want to provide this information. So I have something like this: <form:select path="country"> <form:option value="">-Select one-</form:option> <form:options items="${countries}" itemLabel="name" itemValue="id"/> </form:select> In my controller I get the autopopulated object with the user information and I want to have country set to null when the "-Select one-" option has been selected. So I have set a initBinder with a custom editor like this: @InitBinder protected void initBinder(WebDataBinder binder) throws ServletException { binder.registerCustomEditor(Country.class, "country", new CustomCountryEditor()); } and my editor do something like this: public class CustomCountryEditor(){ @Override public String getAsText() { //I return the Id of the country } @Override public void setAsText(String str) { //I search in the database for a country with id = new Integer(str) //and set country to that value //or I set country to null in case str == null } } When I submit the form it works because when I have country set to null when I have selected "-Select one-" option or the instance of the country selected. The problem is that when I load the form I have a method like the following one to load the user information. @ModelAttribute("user") public User getUser(){ //loads user from database } The object I get from getUser() has country set to a specific country (not a null value), but in the combobox is not selected any option. I've debugged the application and the CustomCountryEditor works good when setting and getting the text, thoughgetAsText method is called for every item in the list "countries" not only for the "country" field. Any idea? Is there a better way to set null the country object when I select no country option in the combobox? Thanks

    Read the article

  • what is called KEY

    - by Bharanikumar
    CREATE TABLE `ost_staff` ( `staff_id` int(11) unsigned NOT NULL auto_increment, `group_id` int(10) unsigned NOT NULL default '0', `dept_id` int(10) unsigned NOT NULL default '0', `username` varchar(32) collate latin1_german2_ci NOT NULL default '', `firstname` varchar(32) collate latin1_german2_ci default NULL, `lastname` varchar(32) collate latin1_german2_ci default NULL, `passwd` varchar(128) collate latin1_german2_ci default NULL, `email` varchar(128) collate latin1_german2_ci default NULL, `phone` varchar(24) collate latin1_german2_ci NOT NULL default '', `phone_ext` varchar(6) collate latin1_german2_ci default NULL, `mobile` varchar(24) collate latin1_german2_ci NOT NULL default '', `signature` varchar(255) collate latin1_german2_ci NOT NULL default '', `isactive` tinyint(1) NOT NULL default '1', `isadmin` tinyint(1) NOT NULL default '0', `isvisible` tinyint(1) unsigned NOT NULL default '1', `onvacation` tinyint(1) unsigned NOT NULL default '0', `daylight_saving` tinyint(1) unsigned NOT NULL default '0', `append_signature` tinyint(1) unsigned NOT NULL default '0', `change_passwd` tinyint(1) unsigned NOT NULL default '0', `timezone_offset` float(3,1) NOT NULL default '0.0', `max_page_size` int(11) NOT NULL default '0', `created` datetime NOT NULL default '0000-00-00 00:00:00', `lastlogin` datetime default NULL, `updated` datetime NOT NULL default '0000-00-00 00:00:00', PRIMARY KEY (`staff_id`), UNIQUE KEY `username` (`username`), KEY `dept_id` (`dept_id`), **KEY `issuperuser` (`isadmin`),** **KEY `group_id` (`group_id`,`staff_id`)** ) ENGINE=MyISAM AUTO_INCREMENT=35 DEFAULT CHARSET=latin1 COLLATE=latin1_german2_ci; Hi the above query is the osticket open source one, i know primary key , foreign key , unique but AM NOT SURE WHAT IS THIS KEY group_id (group_id,staff_id) Please tell me, this constraints name....

    Read the article

  • When running PowerShell script as a scheduled task some Exchange 2010 database properties are null

    - by barophobia
    Hello, I've written a script that intends to retrieve the DatabaseSize of a database from Exchange 2010. I created a new AD user for this script to run under as a scheduled task. I gave this user admin rights to the Exchange Organization (as a last resort during my testing) and local admin rights on the Exchange machine. When I run this script manually by starting powershell (with runas /noprofile /user:domain\user powershell) everything works fine. All the database properties are available. When I run the script as a scheduled task a lot of the properties are null including the one I want: DatabaseSize. I've also tried running the script as the domain admin account with the same results. There must be something different in the two contexts but I can't figure out what it is. My script: Add-PSSnapin Microsoft.Exchange.Management.PowerShell.E2010 Write-EventLog 'Windows PowerShell' -source PowerShell -eventid 100 -message "Starting script" $databases = get-mailboxdatabase -status if($databases -ne $null) { Write-EventLog 'Windows PowerShell' -source PowerShell -eventid 100 -message "Object created" $databasesize_text = $databases.databasesize.tomb().tostring() if($databasesize_text -ne $null) { $output = "echo "+$databasesize_text+":ok" Write-EventLog 'Windows PowerShell' -source PowerShell -eventid 100 -message "Path check" if(test-path "\\mon-01\prtgsensors\EXE\") { Write-EventLog 'Windows PowerShell' -source PowerShell -eventid 100 -message "Path valid" Set-Content \\mon-01\prtgsensors\EXE\ex-05_db_size.bat -value $output } Write-EventLog 'Windows PowerShell' -source PowerShell -eventid 100 -message "Exiting program" } else { Write-EventLog 'Windows PowerShell' -source PowerShell -eventid 100 -message "databasesize_text is empty. nothing to do" } } else { Write-EventLog 'Windows PowerShell' -source PowerShell -eventid 100 -message "object not created. nothing to do" } exit 0

    Read the article

  • FastCGI and Apache 500 error intermittently

    - by benkorn1
    Hello, I have a FastCGI (mod_fastcgi)problem. It happens every once in a while, and does not casue a complete server meltdown, just 500 errors. Here are a couple things. First I am using APC so PHP is in control of it's own processes, not FastCGI. Also, I have the webroot set as: /var/www/html And the fcgi-bin inside: /var/www/html/fcgi-bin First off here is the apache error_log: [Fri Jan 07 10:22:39 2011] [error] [client 50.16.222.82] (4)Interrupted system call: FastCGI: comm with server "/var/www/html/fcgi-bin/php.fcgi" aborted: select() failed, referer: http://www.domain.com/ I also ran strace on the 'fcgi-pm' process. Here is a snip from the trace around the time it bombs out: 21725 gettimeofday({1294420603, 14360}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 6503 38*", 16384) = 46 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 96595}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 6154 23*C /var/www/html/fcgi-bin/php.fcgi - - 6483 28*", 16384) = 92 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 270744}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 5741 38*", 16384) = 46 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 311502}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 6064 32*", 16384) = 46 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 365598}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 6179 33*C /var/www/html/fcgi-bin/php.fcgi - - 5906 59*", 16384) = 92 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 454405}, NULL) = 0 I noticed that the 'select()' seems to stay the same regardless, however the read() changes its return from 46 to some other number while it is bombing out. Has anyone seen anything like this. Could this be some sort of file locking? Thanks, Ben

    Read the article

  • findViewById returns null for EditText

    - by jayesh
    public class MainActivity extends Activity { private EditText editText; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); editText = (EditText) findViewById(R.id.etext); if(editText == null) { Log.v("editText", "booohooo"); } else { Log.v("editText", "Success"); } final Button button = (Button) findViewById(R.id.gobutton); button.setOnClickListener(new View.OnClickListener() { public void onClick(View v) { if(editText != null) { Log.v("editText", "is not NULL"); } else { Log.v("editText", "is NULL :("); } // Perform action on click if(editText != null) { editText.getText(); } else { Log.v("editText", "is NULL"); } Log.v("url", editText.getText().toString().trim()); Intent browserIntent = new Intent(Intent.ACTION_VIEW, Uri.parse(editText.getText().toString().trim())); startActivity(browserIntent); } }); } } <?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent" > <TextView android_id="@+id/websiteurlheading" android:layout_width="fill_parent" android:layout_height="wrap_content" android:text="Enter web site URL" /> <EditText android_id="@+id/etext" android:layout_width="fill_parent" android:layout_height="wrap_content" android:layout_below="@id/websiteurlheading" /> <Button android:id="@+id/gobutton" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="Enter" /> </LinearLayout> Any help is appreciated.

    Read the article

  • FastCGI and Apache 500 error intermittently

    - by benkorn1
    I have a FastCGI (mod_fastcgi)problem. It happens every once in a while, and does not casue a complete server meltdown, just 500 errors. Here are a couple things. First I am using APC so PHP is in control of it's own processes, not FastCGI. Also, I have the webroot set as: /var/www/html And the fcgi-bin inside: /var/www/html/fcgi-bin First off here is the apache error_log: [Fri Jan 07 10:22:39 2011] [error] [client 50.16.222.82] (4)Interrupted system call: FastCGI: comm with server "/var/www/html/fcgi-bin/php.fcgi" aborted: select() failed, referer: http://www.domain.com/ I also ran strace on the 'fcgi-pm' process. Here is a snip from the trace around the time it bombs out: 21725 gettimeofday({1294420603, 14360}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 6503 38*", 16384) = 46 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 96595}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 6154 23*C /var/www/html/fcgi-bin/php.fcgi - - 6483 28*", 16384) = 92 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 270744}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 5741 38*", 16384) = 46 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 311502}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 6064 32*", 16384) = 46 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 365598}, NULL) = 0 21725 read(14, "C /var/www/html/fcgi-bin/php.fcgi - - 6179 33*C /var/www/html/fcgi-bin/php.fcgi - - 5906 59*", 16384) = 92 21725 alarm(131) = 0 21725 select(15, [14], NULL, NULL, NULL) = 1 (in [14]) 21725 alarm(0) = 131 21725 gettimeofday({1294420603, 454405}, NULL) = 0 I noticed that the 'select()' seems to stay the same regardless, however the read() changes its return from 46 to some other number while it is bombing out. Has anyone seen anything like this. Could this be some sort of file locking? Thanks, Ben

    Read the article

  • SQL Server 2008: Comparing similar records - Need to still display an ID for a record when the JOIN has no matches

    - by aleppke
    I'm writing a SQL Server 2008 report that will compare genetic test results for animals. A genetic test consists of an animalId, a gene and a result. Not all animals will have the same genes tested but I need to be able to display the results side-by-side for a given set of animals and only include the genes that are present for at least one of the selected animals. My TestResult table has the following data in it: animalId gene result 1 a CC 1 b CT 1 d TT 2 a CT 2 b CT 2 c TT 3 a CT 3 b TT 3 c CC 3 d CC 3 e TT I need to generate a result set that looks like the following. Note that Animal 3 is not being displayed (user doesn't want to see its results) and neither are results for Gene "e" since neither Animal 1 nor Animal 2 have a result for that gene: SireID SireResult CalfID CalfResult Gene 1 CC 2 CT a 1 CT 2 CT b 1 NULL 2 TT c 1 TT 2 NULL d But I can only manage to get this: SireID SireResult CalfID CalfResult Gene 1 CC 2 CT a 1 CT 2 CT b NULL NULL 2 TT c 1 TT NULL NULL d This is the query I'm using. SELECT sire.animalId AS 'SireID' ,sire.result AS 'SireResult' ,calf.animalId AS 'CalfID' ,calf.result AS 'CalfResult' ,sire.gene AS 'Gene' FROM (SELECT s.animalId ,s.result ,m1.gene FROM (SELECT [animalId ] ,result ,gene FROM TestResult WHERE animalId IN (1)) s FULL JOIN (SELECT DISTINCT gene FROM TestResult WHERE animalId IN (1, 2)) m1 ON s.marker = m1.marker) sire FULL JOIN (SELECT c.animalId ,c.result ,m2.gene FROM (SELECT animalId ,result ,gene FROM TestResult WHERE animalId IN (2)) c FULL JOIN (SELECT DISTINCT gene FROM TestResult WHERE animalId IN (1, 2)) m2 ON c.gene = m2.gene) calf ON sire.gene = calf.gene How do I get the SireIDs and CalfIDs to display their values when they don't have a record associated with a particular Gene? I was thinking of using COALESCE but I can't figure out how to specify the correct animalId to pass in. Any help would be appreciated.

    Read the article

  • List.Sort in C#: comparer being called with null object

    - by cbp
    I am getting strange behaviour using the built-in C# List.Sort function with a custom comparer. For some reason it sometimes calls the comparer class's Compare method with a null object as one of the parameters. But if I check the list with the debugger there are no null objects in the collection. My comparer class looks like this: public class DelegateToComparer<T> : IComparer<T> { private readonly Func<T,T,int> _comparer; public int Compare(T x, T y) { return _comparer(x, y); } public DelegateToComparer(Func<T, T, int> comparer) { _comparer = comparer; } } This allows a delegate to be passed to the List.Sort method, like this: mylist.Sort(new DelegateToComparer<MyClass>( (x, y) => { return x.SomeProp.CompareTo(y.SomeProp); }); So the above delegate will throw a null reference exception for the x parameter, even though no elements of mylist are null. UPDATE: Yes I am absolutely sure that it is parameter x throwing the null reference exception! UPDATE: Instead of using the framework's List.Sort method, I tried a custom sort method (i.e. new BubbleSort().Sort(mylist)) and the problem went away. As I suspected, the List.Sort method passes null to the comparer for some reason.

    Read the article

  • findViewById returns null in new Intent

    - by drozzy
    I am having a problem where in the started Intent, the findViewById returns null. Is there anything special I should know about starting a new intent? It goes something like this for me: //in the MainList class Intent stuffList = new Intent(this, StuffList.class); then in the new Stuff's constructor: public class StuffList extends ListActivity { @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); this.setContentView(R.layout.stuff_list); ... this.setListAdapter(new StuffAdapter(this, my_cursor)); and in the StuffAdapter I do my usual view and data retrieval. Note the line where findViewById returns null: class ViewWrapper{ View base; TextView label = null; ViewWrapper(View base){ this.base = base; } TextView getLabel(){ if(label == null){ label = (TextView)base.findViewById(R.id.my_label); // returns NULL } return label;} } class StuffAdapter extends CursorAdapter{ StuffAdapter(Context context, Cursor cursor){ super(context, cursor); } @Override public View newView(Context context, Cursor cursor, ViewGroup parent) { LayoutInflater inflater = getLayoutInflater(); View row = inflater.inflate(R.layout.stuff_list, parent, false); ViewWrapper wrapper = new ViewWrapper(row); row.setTag(wrapper); return(row); } @Override public void bindView(View row, Context context, Cursor cursor) { ViewWrapper wrapper = (ViewWrapper)row.getTag(); TextView label = wrapper.getLabel(); // also NULL //this throws exception of course label.setText(cursor.getString("title")); } } The curious thing is that in the class that calls intent (MainList class), I do Exactly the same thing (i list a bunch of objects), and it Works! however when I try to do it in an Intent - it can't seem to find the view by id.

    Read the article

  • Setting nested object to null when selected option has empty value

    - by Javi
    Hello, I have a Class which models a User and another which models his country. Something like this: public class User{ private Country country; //other attributes and getter/setters } public class Country{ private Integer id; private String name; //other attributes and getter/setters } I have a Spring form where I have a combobox so the user can select his country or can select the undefined option to indicate he doen't want to provide this information. So I have something like this: <form:select path="country"> <form:option value="">-Select one-</form:option> <form:options items="${countries}" itemLabel="name" itemValue="id"/> </form:select> In my controller I get the autopopulated object with the user information and I want to have country set to null when the "-Select one-" option has been selected. So I have set a initBinder with a custom editor like this: @InitBinder protected void initBinder(WebDataBinder binder) throws ServletException { binder.registerCustomEditor(Country.class, "country", new CustomCountryEditor()); } and my editor do something like this: public class CustomCountryEditor(){ @Override public String getAsText() { //I return the Id of the country } @Override public void setAsText(String str) { //I search in the database for a country with id = new Integer(str) //and set country to that value //or I set country to null in case str == null } } When I submit the form it works because when I have country set to null when I have selected "-Select one-" option or the instance of the country selected. The problem is that when I load the form I have a method like the following one to load the user information. @ModelAttribute("user") public User getUser(){ //loads user from database } The object I get from getUser() has country set to a specific country (not a null value), but in the combobox is not selected any option. I've debugged the application and the CustomCountryEditor works good when setting and getting the text, thoughgetAsText method is called for every item in the list "countries" not only for the "country" field. Any idea? Is there a better way to set null the country object when I select no country option in the combobox? Thanks

    Read the article

  • Null Pointer Exception in Primavera P6 8.1

    - by gwrichard
    I am getting a null pointer exception in a Primavera P6 8.1 installation. The exception only occurs in one section of the web-client: Application settings.P6 web and the P6 API are deployed on the same WebLogic (10.3.5) node running on a Windows Server 2008 R2 installation. I have done this installation using this same software stack a dozen times and don't have this issue on any of the other installs. Exact error below: Match: beginTraversal Match: digest selected JREDesc: JREDesc[version 1.6.0_20+, heap=-1--1, args=null, href=http://java.sun.com/products/autodl/j2se, sel=false, null, null], JREInfo: JREInfo for index 0: platform is: 1.7 product is: 1.7.0_17 location is: http://java.sun.com/products/autodl/j2se path is: C:\Program Files (x86)\Java\jre7\bin\javaw.exe args is: null native platform is: Windows, x86 [ x86, 32bit ] JavaFX runtime is: JavaFX 2.2.7 found at C:\Program Files (x86)\Java\jre7\ enabled is: true registered is: true system is: true Match: ignoring maxHeap: -1 Match: ignoring InitHeap: -1 Match: digesting vmargs: null Match: digested vmargs: [JVMParameters: isSecure: true, args: ] Match: JVM args after accumulation: [JVMParameters: isSecure: true, args: ] Match: digest LaunchDesc: http://localhost:7001/p6/action/jnlp/appletsjnlp.jnlp?mainClass=com.primavera.pvapplets.adminpreferences.AdminPreferencesApplet&classPath=adminpreferences.jar,prm-applets-common.jar,forms-1.0.7.jar,prm-guisupport.jar,prm-to.jar,jide.jar,tablesupport.jar,formsupport.jar,applets-bo.jar,commons-lang.jar,prm-common.jar,resource_strings.jar,prm-img.jar,commons-logging.jar&name=AdminPreferences&version=8.1.2.0.0602 Match: digest properties: [] Match: JVM args: [JVMParameters: isSecure: true, args: ] Match: endTraversal .. Match: JVM args final: Match: Running JREInfo Version match: 1.7.0.17 == 1.7.0.17 Match: Running JVM args match: have:<> satisfy want:<> Java Plug-in 10.17.2.02 Using JRE version 1.7.0_17-b02 Java HotSpot(TM) Client VM User home directory = C:\Users\gwrichard ---------------------------------------------------- c: clear console window f: finalize objects on finalization queue g: garbage collect h: display this help message l: dump classloader list m: print memory usage o: trigger logging q: hide console r: reload policy configuration s: dump system and deployment properties t: dump thread list v: dump thread stack x: clear classloader cache 0-5: set trace level to <n> ----------------------------------------------------

    Read the article

  • Selecting date NOT NULL records between a specific range with Propel

    - by Jon Winstanley
    Using Propel I would like to find records which have a date field which is not null and also between a specific range. However, Propel seems to overwrite the criteria with the NOTNULL criteria. Is it possible to do this? //create the date ranges $start_date = mktime(0, 0, 0, date("m") , date("d")+$start, date("Y")); $end_date = mktime(0, 0, 0, date("m") , date("d")+$end, date("Y")); //add the start of the range $c1 = $c->getNewCriterion(TaskPeer::DUE_DATE, null); $c1->addAnd($c->getNewCriterion(TaskPeer::DUE_DATE, $end_date, Criteria::LESS_EQUAL)); $c->add($c1); //add the end of the range $c2 = $c->getNewCriterion(TaskPeer::DUE_DATE, null); $c2->addAnd($c->getNewCriterion(TaskPeer::DUE_DATE, $start_date, Criteria::GREATER_EQUAL)); $c->add($c2); //remove the null entries $c3 = $c->getNewCriterion(TaskPeer::DUE_DATE, null); $c3->addAnd($c->getNewCriterion(TaskPeer::DUE_DATE, null, Criteria::ISNULL)); $c->add($c3);

    Read the article

  • Groovy htmlunit getFirstByXPath returning null

    - by StartingGroovy
    I have had a few issues with HtmlUnit returning nulls lately and am looking for guidance. each of my results for grabbing the first row of a website have returned null. I am wondering if someone can A) explain why they might be returning null B) explain better ways (if there are some) to go about getting the information Here is my current code (URL is in the source): client = new WebClient(BrowserVersion.FIREFOX_3) client.javaScriptEnabled = false def url = "http://www.hidemyass.com/proxy-list/" page = client.getPage(url) IpAddress = page.getFirstByXPath("//html/body/div/div/form/table/tbody/tr/td[2]").getValue() println "IP Address is: $data" //returns null //Port_Number is an Image Country = page.getFirstByXPath("//html/body/div/div/form/table/tbody/tr/td[4][@class='country']/@rel").getValue() println "Country abbreviation is: $Country" //differentiate speed and connection by name of gif? Type = page.getFirstByXPath("//html/body/div/div/form/table/tbody/tr/td[7]").getValue() println "Proxy type is: $Type" Anonymity = page.getFirstByXPath("//html/body/div/div/form/table/tbody/tr/td[8]").getValue() println "Anonymity Level is: $Anonymity" client.closeAllWindows() Right now all of my XPaths return null and .getValue() obviously doesn't work on null. I also have questions as to what I should do about the PORT since it is an image? Is there a better alternative than downloading it and attempting to solve it by OCR? Side Note There is no significance in this site, I was just looking for a site that I could practice scraping on (the last one I ran into issues of fragment identities and couldn't get an answer to: HtmlUnit getByXpath returns null and HtmlUnit and Fragment Identities )

    Read the article

  • Double null-terminated string

    - by wengseng
    I need to format a string to be double null-terminated string in order to use SHFileOperation. Interesting part is i found one of the following working, but not both: // Example 1 CString szDir(_T("D:\\Test")); szDir = szDir + _T('\0') + _T('\0'); // Example 2 CString szDir(_T("D:\\Test")); szDir = szDir + _T("\0\0"); //Delete folder SHFILEOPSTRUCT fileop; fileop.hwnd = NULL; // no status display fileop.wFunc = FO_DELETE; // delete operation fileop.pFrom = szDir; // source file name as double null terminated string fileop.pTo = NULL; // no destination needed fileop.fFlags = FOF_NOCONFIRMATION|FOF_SILENT; // do not prompt the user fileop.fAnyOperationsAborted = FALSE; fileop.lpszProgressTitle = NULL; fileop.hNameMappings = NULL; int ret = SHFileOperation(&fileop); Does anyone has idea on this? Is there other way to append double-terminated string?

    Read the article

  • Validating parameters according to a fixed reference

    - by James P.
    The following method is for setting the transfer type of an FTP connection. Basically, I'd like to validate the character input (see comments). Is this going overboard? Is there a more elegant approach? How do you approach parameter validation in general? Any comments are welcome. public void setTransferType(Character typeCharacter, Character optionalSecondCharacter) throws NumberFormatException, IOException { // http://www.nsftools.com/tips/RawFTP.htm#TYPE // Syntax: TYPE type-character [second-type-character] // // Sets the type of file to be transferred. type-character can be any // of: // // * A - ASCII text // * E - EBCDIC text // * I - image (binary data) // * L - local format // // For A and E, the second-type-character specifies how the text should // be interpreted. It can be: // // * N - Non-print (not destined for printing). This is the default if // second-type-character is omitted. // * T - Telnet format control (<CR>, <FF>, etc.) // * C - ASA Carriage Control // // For L, the second-type-character specifies the number of bits per // byte on the local system, and may not be omitted. final Set<Character> acceptedTypeCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'A','E','I','L'} )); final Set<Character> acceptedOptionalSecondCharacters = new HashSet<Character>(Arrays.asList( new Character[] {'N','T','C'} )); if( acceptedTypeCharacters.contains(typeCharacter) ) { if( new Character('A').equals( typeCharacter ) || new Character('E').equals( typeCharacter ) ){ if( acceptedOptionalSecondCharacters.contains(optionalSecondCharacter) ) { executeCommand("TYPE " + typeCharacter + " " + optionalSecondCharacter ); } } else { executeCommand("TYPE " + typeCharacter ); } } }

    Read the article

  • Vim move cursor one character in insert mode without arrow keys

    - by bolov
    This might seem a little too overboard, but I switched to vim and I so happy about the workflow now. I try to discipline myself not to use the arrow keys, as keeping the hands on the alfa-keys all the time is such a big thing when writing. So when I need to navigate I get out of insert mode, move in normal mode and get back in insert mode. There is an exception where this is actually more disrupting: I use clang complete with snippets and super tab which is great. Except every time I get a function auto completed after I fill in the parameters I am left with the cursor before ) so to continue I have to move the cursor one character to the right. As you can imagine this happens very often. The only options I have (as far as I know) are : Escla or ?, and I am not happy about neither of them. The first one makes me hit 3 keys for just a simple 1 character cursor move, the second one makes me move my hand to the arrow keys. A third option would be to map CTRL-L or smth to ?. So what is the best way of doing this? //snippets (clang complete + supertab): foo($`param1`, $`param2`) //after completion: foo(var1, var2|) ^ ^ | | I am here | Need to be here | denotes cursor position

    Read the article

  • Error when call 'qb.query(db, projection, selection, selectionArgs, null, null, orderBy);'

    - by smalltalk1960s
    Hi all, I make a content provider named 'DictionaryProvider' (Based on NotepadProvider). When my program run to command 'qb.query(db, projection, selection, selectionArgs, null, null, orderBy);', error happen. I don't know how to fix. please help me. Below is my code // file main calling DictionnaryProvider @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.dictionary); final String[] PROJECTION = new String[] { DicColumns._ID, // 0 DicColumns.KEY_WORD, // 1 DicColumns.KEY_DEFINITION // 2 }; Cursor c = managedQuery(DicColumns.CONTENT_URI, PROJECTION, null, null, DicColumns.DEFAULT_SORT_ORDER); String str = ""; if (c.moveToFirst()) { int wordColumn = c.getColumnIndex("KEY_WORD"); int defColumn = c.getColumnIndex("KEY_DEFINITION"); do { // Get the field values str = ""; str += c.getString(wordColumn); str +="\n"; str +=c.getString(defColumn); } while (c.moveToNext()); } Toast.makeText(this, str, Toast.LENGTH_SHORT).show(); } // file DictionaryProvider.java package com.example.helloandroid; import java.util.HashMap; import android.content.ContentProvider; import android.content.ContentValues; import android.content.UriMatcher; import android.database.Cursor; import android.database.sqlite.SQLiteDatabase; import android.database.sqlite.SQLiteQueryBuilder; import android.net.Uri; import android.text.TextUtils; import com.example.helloandroid.Dictionary.DicColumns; public class DictionaryProvider extends ContentProvider { //private static final String TAG = "DictionaryProvider"; private DictionaryOpenHelper dbdic; static final int DATABASE_VERSION = 1; static final String DICTIONARY_DATABASE_NAME = "dictionarydb"; static final String DICTIONARY_TABLE_NAME = "dictionary"; private static final UriMatcher sUriMatcher; private static HashMap<String, String> sDicProjectionMap; @Override public int delete(Uri arg0, String arg1, String[] arg2) { // TODO Auto-generated method stub return 0; } @Override public String getType(Uri arg0) { // TODO Auto-generated method stub return null; } @Override public Uri insert(Uri arg0, ContentValues arg1) { // TODO Auto-generated method stub return null; } @Override public boolean onCreate() { // TODO Auto-generated method stub dbdic = new DictionaryOpenHelper(getContext(), DICTIONARY_DATABASE_NAME, null, DATABASE_VERSION); return true; } @Override public Cursor query(Uri uri, String[] projection, String selection, String[] selectionArgs, String sortOrder) { SQLiteQueryBuilder qb = new SQLiteQueryBuilder(); qb.setTables(DICTIONARY_TABLE_NAME); switch (sUriMatcher.match(uri)) { case 1: qb.setProjectionMap(sDicProjectionMap); break; case 2: qb.setProjectionMap(sDicProjectionMap); qb.appendWhere(DicColumns._ID + "=" + uri.getPathSegments().get(1)); break; default: throw new IllegalArgumentException("Unknown URI " + uri); } // If no sort order is specified use the default String orderBy; if (TextUtils.isEmpty(sortOrder)) { orderBy = DicColumns.DEFAULT_SORT_ORDER; } else { orderBy = sortOrder; } // Get the database and run the query SQLiteDatabase db = dbdic.getReadableDatabase(); Cursor c = qb.query(db, projection, selection, selectionArgs, null, null, orderBy); // Tell the cursor what uri to watch, so it knows when its source data changes c.setNotificationUri(getContext().getContentResolver(), uri); return c; } @Override public int update(Uri uri, ContentValues values, String selection, String[] selectionArgs) { // TODO Auto-generated method stub return 0; } static { sUriMatcher = new UriMatcher(UriMatcher.NO_MATCH); sUriMatcher.addURI(Dictionary.AUTHORITY, "dictionary", 1); sUriMatcher.addURI(Dictionary.AUTHORITY, "dictionary/#", 2); sDicProjectionMap = new HashMap<String, String>(); sDicProjectionMap.put(DicColumns._ID, DicColumns._ID); sDicProjectionMap.put(DicColumns.KEY_WORD, DicColumns.KEY_WORD); sDicProjectionMap.put(DicColumns.KEY_DEFINITION, DicColumns.KEY_DEFINITION); // Support for Live Folders. /*sLiveFolderProjectionMap = new HashMap<String, String>(); sLiveFolderProjectionMap.put(LiveFolders._ID, NoteColumns._ID + " AS " + LiveFolders._ID); sLiveFolderProjectionMap.put(LiveFolders.NAME, NoteColumns.TITLE + " AS " + LiveFolders.NAME);*/ // Add more columns here for more robust Live Folders. } } // file Dictionary.java package com.example.helloandroid; import android.net.Uri; import android.provider.BaseColumns; /** * Convenience definitions for DictionaryProvider */ public final class Dictionary { public static final String AUTHORITY = "com.example.helloandroid.provider.Dictionary"; // This class cannot be instantiated private Dictionary() {} /** * Dictionary table */ public static final class DicColumns implements BaseColumns { // This class cannot be instantiated private DicColumns() {} /** * The content:// style URL for this table */ public static final Uri CONTENT_URI = Uri.parse("content://" + AUTHORITY + "/dictionary"); /** * The MIME type of {@link #CONTENT_URI} providing a directory of notes. */ //public static final String CONTENT_TYPE = "vnd.android.cursor.dir/vnd.google.note"; /** * The MIME type of a {@link #CONTENT_URI} sub-directory of a single note. */ //public static final String CONTENT_ITEM_TYPE = "vnd.android.cursor.item/vnd.google.note"; /** * The default sort order for this table */ public static final String DEFAULT_SORT_ORDER = "modified DESC"; /** * The key_word of the dictionary * <P>Type: TEXT</P> */ public static final String KEY_WORD = "KEY_WORD"; /** * The key_definition of word * <P>Type: TEXT</P> */ public static final String KEY_DEFINITION = "KEY_DEFINITION"; } } thanks so much

    Read the article

  • mysql match against russain

    - by Devenv
    Hey, Trying to solve this for a very long time now... SELECT MATCH(name) AGAINST('????????') (russian) doesn't work, but SELECT MATCH(name) AGAINST('abraxas') (english) work perfectly. I know it's something with character-set, but I tried all kind of settings and it didn't work. For now it's latin-1. LIKE works This is the show variables charset related: character_set_client - latin1 character_set_connection - latin1 character_set_database - latin1 character_set_filesystem - binary character_set_results - latin1 character_set_server - latin1 character_set_system - utf8 character_sets_dir - /usr/share/mysql/charsets/ collation_connection - latin1_swedish_ci collation_database - latin1_swedish_ci collation_server - latin1_swedish_ci chunk of /etc/my.cnf default-character-set=latin1 skip-character-set-client-handshake chunk of the dump: /*!40101 SET @OLD_CHARACTER_SET_CLIENT=@@CHARACTER_SET_CLIENT */; /*!40101 SET @OLD_CHARACTER_SET_RESULTS=@@CHARACTER_SET_RESULTS */; /*!40101 SET @OLD_COLLATION_CONNECTION=@@COLLATION_CONNECTION */; /*!40101 SET NAMES utf8 */; DROP TABLE IF EXISTS `scenes_raw`; /*!40101 SET @saved_cs_client = @@character_set_client */; /*!40101 SET character_set_client = utf8 */; CREATE TABLE `scenes_raw` ( `scene_name` varchar(40) DEFAULT NULL, ...blabla... ) ENGINE=MyISAM AUTO_INCREMENT=901 DEFAULT CHARSET=utf8; (I did tests without skip-character-set-client-handshake too) SHOW TABLE STATUS WHERE Name = 'scenes_raw'\G Name: scenes_raw Engine: MyISAM Version: 10 Row_format: Dynamic Index_length: 23552 Collation: utf8_general_ci Checksum: NULL Create_options:

    Read the article

  • Pinyin Character entry on a touchscreen keyboard

    - by mmr
    The app I'm developing requires that it be deployed in China, which means that it needs to have Pinyin and Chinese character handling. I'm told that the way that our customers handle character entry is like so: Enter in the pinyin character, like 'zhang' As they enter the characters, a list of possible Chinese (Mandarin?) characters are presented to the user, like: The user will then select '1' to enter the family name that is roughly translated to 'zhang' How can I hook such programs (I believe one is called 'mspy.exe', from Microsoft, which I'm lead to believe comes with Microsoft versions of XP) into a WPF text box? Right now, the user can enter text either by using their keyboard or by using an on-screen keyboard, so I will probably need to capture the event of a keypress from either source and feed it to some OS event or to MSPY.exe or some similar program. Or is there some other way to enter pinyin and have it converted to Mandarin? Is there a program other than MSPY I should look at? EDIT: For those of you who think that this should 'just work', it does not. Chinese character entry will work just fine if entering text into notepad or the start-run menu or whatever, but it will not work in WPF. That's the key to this question: how do I enable WPF entry? There's the Google Pinyin and Sogou pinyin, but the websites are in Mandarin or Chinese or something similar and I don't read the language.

    Read the article

  • latin1/unicode conversion problem with ajax request and special characters

    - by mfn
    Server is PHP5 and HTML charset is latin1 (iso-8859-1). With regular form POST requests, there's no problem with "special" characters like the em dash (–) for example. Although I don't know for sure, it works. Probably because there exists a representable character for the browser at char code 150 (which is what I see in PHP on the server for a literal em dash with ord). Now our application also provides some kind of preview mechanism via ajax: the text is sent to the server and a complete HTML for a preview is sent back. However, the ordinary char code 150 em dash character when sent via ajax (tested with GET and POST) mutates into something more: %E2%80%93. I see this already in the apache log. According to various sources I found, e.g. http://www.tachyonsoft.com/uc0020.htm , this is the UTF8 byte representation of em dash and my current knowledge is that JavaScript handles everything in Unicode. However within my app, I need everything in latin1. Simply said: just like a regular POST request would have given me that em dash as char code 150, I would need that for the translated UTF8 representation too. That's were I'm failing, because with PHP on the server when I try to decode it with either utf8_decode(...) or iconv('UTF-8', 'iso-8859-1', ...) but in both cases I get a regular ? representing this character (and iconv also throws me a notice: Detected an illegal character in input string ). My goal is to find an automated solution, but maybe I'm trying to be überclever in this case? I've found other people simply doing manual replacing with a predefined input/output set; but that would always give me the feeling I could loose characters. The observant reader will note that I'm behind on understanding the full impact/complexity with things about Unicode and conversion of chars and I definitely prefer to understand the thing as a whole then a simply manual mapping. thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Java Appending a character to a textarea

    - by adam08
    I'm looking to appends a character to a textarea in. I have a simple GUI designed to look like like a mobile phone and I want to be able to click on one of the buttons and update the textarea with that character. If I click another button, I want to be able to append that character to the first. How do I do this? Obviously right now it is just setting the character for that button in the textarea and will be replaced when another button is clicked. public void actionPerformed(ActionEvent e) { String source = e.getActionCommand(); if (source.equals("1")) { TextArea.setText("1"); } else if (source.equals("2abc")) { TextArea.setText("a"); } else if (source.equals("3def")) { TextArea.setText("e"); } else if (source.equals("4ghi")) { TextArea.setText("i"); } else if (source.equals("5jkl")) { TextArea.setText("k"); } else if (source.equals("6mno")) { TextArea.setText("o"); } else if (source.equals("7pqrs")) { TextArea.setText("s"); } else if (source.equals("8tuv")) { TextArea.setText("t"); } else if (source.equals("9wxyz")) { TextArea.setText("x"); }

    Read the article

  • If I use Unicode on a ISO-8859-1 site, how will that be interpreted by a browser?

    - by grg-n-sox
    So I got a site that uses ISO-8859-1 encoding and I can't change that. I want to be sure that the content I enter into the web app on the site gets parsed correctly. The parser works on a character by character basis. I also cannot change the parser, I am just writing files for it to handle. The content in my file I am telling the app to display after parsing contains Unicode characters (or at least I assume so, even if they were produced by Windows Alt Codes mapped to CP437). Using entities is not an option due to the character by character operation of the parser. The only characters that the parser escapes upon output are markup sensitive ones like ampersand, less than, and greater than symbols. I would just go ahead and put this through to see what it looks like, but output can only be seen on a publishing, which has to spend a couple days getting approved and such, and that would be asking too much for just a test case. So, long story short, if I told a site to output ?ÇÑ¥?? on a site with a meta tag stating it is supposed to use ISO-8859-1, will a browser auto-detect the Unicode and display it or will it literally translate it as ISO-8859-1 and get a different set of characters?

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • CakePHP access indirectly related model - beginner's question

    - by user325077
    Hi everyone, I am writing a CakePHP application to log the work I do for various clients, but after trying for days I seem unable to get it to do what I want. I have read most of the book CakePHP's website. and googled for all I'm worth, so I presume I am missing something obvious! Every 'log item' belongs to a 'sub-project, which in turn belongs to a 'project', which in turn belongs to a 'sub-client' which finally belongs to a client. These are the 5 MySQL tables I am using: mysql> DESCRIBE log_items; +-----------------+--------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +-----------------+--------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | date | date | NO | | NULL | | | time | time | NO | | NULL | | | time_spent | int(11) | NO | | NULL | | | sub_projects_id | int(11) | NO | MUL | NULL | | | title | varchar(100) | NO | | NULL | | | description | text | YES | | NULL | | | created | datetime | YES | | NULL | | | modified | datetime | YES | | NULL | | +-----------------+--------------+------+-----+---------+----------------+ mysql> DESCRIBE sub_projects; +-------------+--------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +-------------+--------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | name | varchar(100) | NO | | NULL | | | projects_id | int(11) | NO | MUL | NULL | | | created | datetime | YES | | NULL | | | modified | datetime | YES | | NULL | | +-------------+--------------+------+-----+---------+----------------+ mysql> DESCRIBE projects; +----------------+--------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +----------------+--------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | name | varchar(100) | NO | | NULL | | | sub_clients_id | int(11) | NO | MUL | NULL | | | created | datetime | YES | | NULL | | | modified | datetime | YES | | NULL | | +----------------+--------------+------+-----+---------+----------------+ mysql> DESCRIBE sub_clients; +------------+--------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------+--------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | name | varchar(100) | NO | | NULL | | | clients_id | int(11) | NO | MUL | NULL | | | created | datetime | YES | | NULL | | | modified | datetime | YES | | NULL | | +------------+--------------+------+-----+---------+----------------+ mysql> DESCRIBE clients; +----------+--------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +----------+--------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | name | varchar(100) | NO | | NULL | | | created | datetime | YES | | NULL | | | modified | datetime | YES | | NULL | | +----------+--------------+------+-----+---------+----------------+ I have set up the following associations in CakePHP: LogItem belongsTo SubProjects SubProject belongsTo Projects Project belongsTo SubClients SubClient belongsTo Clients Client hasMany SubClients SubClient hasMany Projects Project hasMany SubProjects SubProject hasMany LogItems Using 'cake bake' I have created the models, controllers (index, view add, edit and delete) and views, and things seem to function - as in I am able to perform simple CRUD operations successfully. The Question When editing a 'log item' at www.mydomain/log_items/edit I am presented with the view you would all suspect; namely the columns of the log_items table with the appropriate textfields/select boxes etc. I would also like to incorporate select boxes to choose the client, sub-client, project and sub-project in the 'log_items' edit view. Ideally the 'sub-client' select box should populate itself depending upon the 'client' chosen, the 'project' select box should also populate itself depending on the 'sub-client' selected etc, etc. I guess the way to go about populating the select boxes with relevant options is Ajax, but I am unsure of how to go about actually accessing a model from the child view of a indirectly related model, for example how to create a 'sub-client' select box in the 'log_items' edit view. I have have found this example: http://forum.phpsitesolutions.com/php-frameworks/cakephp/ajax-cakephp-dynamically-populate-html-select-dropdown-box-t29.html where someone achieves something similar for US states, counties and cities. However, I noticed in the database schema - which is downloadable from the site above link - that the database tables don't have any foreign keys, so now I'm wondering if I'm going about things in the correct manner. Any pointers and advice would be very much appreciated. Kind regards, Chris

    Read the article

< Previous Page | 24 25 26 27 28 29 30 31 32 33 34 35  | Next Page >