Search Results

Search found 7851 results on 315 pages for 'mobile computing'.

Page 295/315 | < Previous Page | 291 292 293 294 295 296 297 298 299 300 301 302  | Next Page >

  • Unable to verify body hash for DKIM

    - by Joshua
    I'm writing a C# DKIM validator and have come across a problem that I cannot solve. Right now I am working on calculating the body hash, as described in Section 3.7 Computing the Message Hashes. I am working with emails that I have dumped using a modified version of EdgeTransportAsyncLogging sample in the Exchange 2010 Transport Agent SDK. Instead of converting the emails when saving, it just opens a file based on the MessageID and dumps the raw data to disk. I am able to successfully compute the body hash of the sample email provided in Section A.2 using the following code: SHA256Managed hasher = new SHA256Managed(); ASCIIEncoding asciiEncoding = new ASCIIEncoding(); string rawFullMessage = File.ReadAllText(@"C:\Repositories\Sample-A.2.txt"); string headerDelimiter = "\r\n\r\n"; int headerEnd = rawFullMessage.IndexOf(headerDelimiter); string header = rawFullMessage.Substring(0, headerEnd); string body = rawFullMessage.Substring(headerEnd + headerDelimiter.Length); byte[] bodyBytes = asciiEncoding.GetBytes(body); byte[] bodyHash = hasher.ComputeHash(bodyBytes); string bodyBase64 = Convert.ToBase64String(bodyHash); string expectedBase64 = "2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8="; Console.WriteLine("Expected hash: {1}{0}Computed hash: {2}{0}Are equal: {3}", Environment.NewLine, expectedBase64, bodyBase64, expectedBase64 == bodyBase64); The output from the above code is: Expected hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Computed hash: 2jUSOH9NhtVGCQWNr9BrIAPreKQjO6Sn7XIkfJVOzv8= Are equal: True Now, most emails come across with the c=relaxed/relaxed setting, which requires you to do some work on the body and header before hashing and verifying. And while I was working on it (failing to get it to work) I finally came across a message with c=simple/simple which means that you process the whole body as is minus any empty CRLF at the end of the body. (Really, the rules for Body Canonicalization are quite ... simple.) Here is the real DKIM email with a signature using the simple algorithm (with only unneeded headers cleaned up). Now, using the above code and updating the expectedBase64 hash I get the following results: Expected hash: VnGg12/s7xH3BraeN5LiiN+I2Ul/db5/jZYYgt4wEIw= Computed hash: ISNNtgnFZxmW6iuey/3Qql5u6nflKPTke4sMXWMxNUw= Are equal: False The expected hash is the value from the bh= field of the DKIM-Signature header. Now, the file used in the second test is a direct raw output from the Exchange 2010 Transport Agent. If so inclined, you can view the modified EdgeTransportLogging.txt. At this point, no matter how I modify the second email, changing the start position or number of CRLF at the end of the file I cannot get the files to match. What worries me is that I have been unable to validate any body hash so far (simple or relaxed) and that it may not be feasible to process DKIM through Exchange 2010.

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to work?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • How to split HTML code with javascript or JQuery

    - by Dean
    Hi I'm making a website using JSP and servlets and I have to now break up a list of radio buttons to insert a textarea and a button. I have got the button and textarea to hide and show when you click on the radio button it shows the text area and button. But this only appears at the top and when there are hundreds on the page this will become awkward so i need a way for it to appear underneath. Here is what my HTML looks like when complied: <form action="addSpotlight" method="POST"> <table> <tr><td><input type="radio" value="29" name="publicationIDs" ></td><td>A System For Dynamic Server Allocation in Application Server Clusters, IEEE International Symposium on Parallel and Distributed Processsing with Applications, 2008</td> </tr> <tr><td><input type="radio" value="30" name="publicationIDs" ></td><td>Analysing BitTorrent's Seeding Strategies, 7th IEEE/IFIP International Conference on Embedded and Ubiquitous Computing (EUC-09), 2009</td> </tr> <tr><td><input type="radio" value="31" name="publicationIDs" ></td><td>The Effect of Server Reallocation Time in Dynamic Resource Allocation, UK Performance Engineering Workshop 2009, 2009</td> </tr> <tr><td><input type="radio" value="32" name="publicationIDs" ></td><td>idk, hello, 1992</td> </tr> <tr><td><input type="radio" value="33" name="publicationIDs" ></td><td>sad, safg, 1992</td> </tr> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Now here is what my JSP looks like: <form action="addSpotlight" method="POST"> <table> <%int i = 0; while(i<ids.size()){%> <tr><td><input type="radio" value="<%=ids.get(i)%>" name="publicationIDs" ></td><td><%=info.get(i)%></td> </tr> <%i++; }%> <div class="abstractWriteup"><textarea name="abstract"></textarea> <input type="submit" value="Add Spotlight"></div> </table> </form> Thanks in Advance Dean

    Read the article

  • Advice for Architecture Design Logic for software application

    - by Prasad
    Hi, I have a framework of basic to complex set of objects/classes (C++) running into around 500. With some rules and regulations - all these objects can communicate with each other and hence can cover most of the common queries in the domain. My Dream: I want to provide these objects as icons/glyphs (as I learnt recently) on a workspace. All these objects can be dragged/dropped into the workspace. They have to communicate only through their methods(interface) and in addition to few iterative and conditional statements. All these objects are arranged finally to execute a protocol/workflow/dataflow/process. After drawing the flow, the user clicks the Execute/run button. All the user interaction should be multi-touch enabled. The best way to show my dream is : Jeff Han's Multitouch Video. consider Jeff is playing with my objects instead of the google maps. :-) it should be like playing a jigsaw puzzle. Objective: how can I achieve the following while working on this final product: a) the development should be flexible to enable provision for web services b) the development should enable easy web application development c) The development should enable client-server architecture - d) further it should also enable mouse based drag/drop desktop application like Adobe programs etc. I mean to say: I want to economize on investments. Now I list my efforts till now in design : a) Created an Editor (VB) where the user writes (manually) the object / class code b) On Run/Execute, the code is copied into a main() function and passed to interpreter. c) Catch the output and show it in the console. The interpreter can be separated to become a server and the Editor can become the client. This needs lot of standard client-server architecture work. But some how I am not comfortable in the tightness of this system. Without interpreter is there much faster and better embeddable solution to this? - other than writing a special compiler for these objects. Recently learned about AXIS-C++ can help me - looks like - a friend suggested. Is that the way to go ? Here are my questions: (pl. consider me a self taught programmer and NOT my domain) a) From the stage of C++ objects to multi-touch product, how can I make sure I will develop the parallel product/service models as well.? What should be architecture aspects I should consider ? b) What technologies are best suited for this? c) If I am thinking of moving to Cloud Computing, how difficult/ how redundant / how unnecessary my efforts will be ? d) How much time in months would it take to get the first beta ? I take the liberty to ask if any of the experts here are interested in this project, please email me: [email protected] Thank you for any help. Looking forward.

    Read the article

  • fit a ellipse in Python given a set of points xi=(xi,yi)

    - by Gianni
    I am computing a series of index from a 2D points (x,y). One index is the ratio between minor and major axis. To fit the ellipse i am using the following post when i run these function the final results looks strange because the center and the axis length are not in scale with the 2D points center = [ 560415.53298363+0.j 6368878.84576771+0.j] angle of rotation = (-0.0528033467597-5.55111512313e-17j) axes = [0.00000000-557.21553487j 6817.76933256 +0.j] thanks in advance for help import numpy as np from numpy.linalg import eig, inv def fitEllipse(x,y): x = x[:,np.newaxis] y = y[:,np.newaxis] D = np.hstack((x*x, x*y, y*y, x, y, np.ones_like(x))) S = np.dot(D.T,D) C = np.zeros([6,6]) C[0,2] = C[2,0] = 2; C[1,1] = -1 E, V = eig(np.dot(inv(S), C)) n = np.argmax(np.abs(E)) a = V[:,n] return a def ellipse_center(a): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] num = b*b-a*c x0=(c*d-b*f)/num y0=(a*f-b*d)/num return np.array([x0,y0]) def ellipse_angle_of_rotation( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] return 0.5*np.arctan(2*b/(a-c)) def ellipse_axis_length( a ): b,c,d,f,g,a = a[1]/2, a[2], a[3]/2, a[4]/2, a[5], a[0] up = 2*(a*f*f+c*d*d+g*b*b-2*b*d*f-a*c*g) down1=(b*b-a*c)*( (c-a)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) down2=(b*b-a*c)*( (a-c)*np.sqrt(1+4*b*b/((a-c)*(a-c)))-(c+a)) res1=np.sqrt(up/down1) res2=np.sqrt(up/down2) return np.array([res1, res2]) if __name__ == '__main__': points = [(560036.4495758876, 6362071.890493258), (560036.4495758876, 6362070.890493258), (560036.9495758876, 6362070.890493258), (560036.9495758876, 6362070.390493258), (560037.4495758876, 6362070.390493258), (560037.4495758876, 6362064.890493258), (560036.4495758876, 6362064.890493258), (560036.4495758876, 6362063.390493258), (560035.4495758876, 6362063.390493258), (560035.4495758876, 6362062.390493258), (560034.9495758876, 6362062.390493258), (560034.9495758876, 6362061.390493258), (560032.9495758876, 6362061.390493258), (560032.9495758876, 6362061.890493258), (560030.4495758876, 6362061.890493258), (560030.4495758876, 6362061.390493258), (560029.9495758876, 6362061.390493258), (560029.9495758876, 6362060.390493258), (560029.4495758876, 6362060.390493258), (560029.4495758876, 6362059.890493258), (560028.9495758876, 6362059.890493258), (560028.9495758876, 6362059.390493258), (560028.4495758876, 6362059.390493258), (560028.4495758876, 6362058.890493258), (560027.4495758876, 6362058.890493258), (560027.4495758876, 6362058.390493258), (560026.9495758876, 6362058.390493258), (560026.9495758876, 6362057.890493258), (560025.4495758876, 6362057.890493258), (560025.4495758876, 6362057.390493258), (560023.4495758876, 6362057.390493258), (560023.4495758876, 6362060.390493258), (560023.9495758876, 6362060.390493258), (560023.9495758876, 6362061.890493258), (560024.4495758876, 6362061.890493258), (560024.4495758876, 6362063.390493258), (560024.9495758876, 6362063.390493258), (560024.9495758876, 6362064.390493258), (560025.4495758876, 6362064.390493258), (560025.4495758876, 6362065.390493258), (560025.9495758876, 6362065.390493258), (560025.9495758876, 6362065.890493258), (560026.4495758876, 6362065.890493258), (560026.4495758876, 6362066.890493258), (560026.9495758876, 6362066.890493258), (560026.9495758876, 6362068.390493258), (560027.4495758876, 6362068.390493258), (560027.4495758876, 6362068.890493258), (560027.9495758876, 6362068.890493258), (560027.9495758876, 6362069.390493258), (560028.4495758876, 6362069.390493258), (560028.4495758876, 6362069.890493258), (560033.4495758876, 6362069.890493258), (560033.4495758876, 6362070.390493258), (560033.9495758876, 6362070.390493258), (560033.9495758876, 6362070.890493258), (560034.4495758876, 6362070.890493258), (560034.4495758876, 6362071.390493258), (560034.9495758876, 6362071.390493258), (560034.9495758876, 6362071.890493258), (560036.4495758876, 6362071.890493258)] a_points = np.array(points) x = a_points[:, 0] y = a_points[:, 1] from pylab import * plot(x,y) show() a = fitEllipse(x,y) center = ellipse_center(a) phi = ellipse_angle_of_rotation(a) axes = ellipse_axis_length(a) print "center = ", center print "angle of rotation = ", phi print "axes = ", axes from pylab import * plot(x,y) plot(center[0:1],center[1:], color = 'red') show() each vertex is a xi,y,i point plot of 2D point and center of fit ellipse

    Read the article

  • ImageMagick on Mac OSX Snow Leopard. Is there any way to get it to compile and run?

    - by ?????
    It seems that I have more trouble getting standard Unix things to run on Snow Leopard than any other platform--including Windows cygwin For the past couple of days, I've been trying to get ImageMagick to run on Snow Leopard. The most obvious way, Mac Ports, fails: tppllc-Mac-Pro:ImageMagick-sl swirsky$ sudo port install imagemagick ---> Computing dependencies for p5-locale-gettext ---> Configuring p5-locale-gettext Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_perl_p5-locale-gettext/work/gettext-1.05" && /opt/local/bin/perl Makefile.PL INSTALLDIRS=vendor " returned error 2 Command output: checking for gettext... no checking for gettext in -I/opt/local/include -arch i386 -L/opt/local/lib -lintl...gettext function not found. Please install libintl at Makefile.PL line 18. no Error: Unable to upgrade port: 1 Error: Unable to execute port: upgrade xorg-libXt failed Before reporting a bug, first run the command again with the -d flag to get complete output. tppllc-Mac-Pro:ImageMagick-sl swirsky$ Not wanting to spend another two days figuring out why my libintl doesn't have a "gettext" function, I tried a different route: the script mentioned here: http://github.com/masterkain/ImageMagick-sl This script downloads and installs an ImageMagic independently of MacPorts issues tppllc-Mac-Pro:ImageMagick-sl swirsky$ /usr/local/bin/convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap It downloads everything and compiles fine, but fails when I try to run it, with the message above. So now I'm two steps away from ImageMagick, trying to get a newer libiconv on my machine. I downloaded the latest libiconv, compiled and built it. I put the resulting library in /opt/local/lib, and I still get the same error message: tppllc-Mac-Pro:.libs swirsky$ sudo mv libiconv.2.dylib /opt/local/lib/libiconv.2.dylib tppllc-Mac-Pro:.libs swirsky$ convert dyld: Library not loaded: /opt/local/lib/libiconv.2.dylib Referenced from: /opt/local/lib/libfontconfig.1.dylib Reason: Incompatible library version: libfontconfig.1.dylib requires version 8.0.0 or later, but libiconv.2.dylib provides version 7.0.0 Trace/BPT trap Now here's something interesting. The error message shows it's looking in /opt/local/lib/libiconv.2.dylib. otools -L shows that this does implement 8.0.0: tppllc-Mac-Pro:.libs swirsky$ otool -L /opt/local/lib/libiconv.2.dylib /opt/local/lib/libiconv.2.dylib: /usr/local/lib/libiconv.2.dylib (compatibility version 8.0.0, current version 8.0.0) /usr/lib/libSystem.B.dylib (compatibility version 1.0.0, current version 125.0.0) tppllc-Mac-Pro:.libs swirsky$ And, for good measure, I set the DYLD_LIBRARY_PATH to make sure this directory is the one for dynamic libraries. So even though I do have a library that provides 8.0.0, it's being seen as 7.0.0! Any ideas why this would happen? So here's my question: Is it possible to get ImageMagick to run on OSX Snow Leopard? Are there any binary distributions that have static libraries baked in so I don't have to worry about these issue/

    Read the article

  • segmented reduction with scattered segments

    - by Christian Rau
    I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

    Read the article

  • MacPorts 1.8.2 fails to build db46 on Mac OS X 1.6.3

    - by themoch
    I'm trying to put a development environment on my Mac, and to do so I need to install several packages which require db46. When running sudo port install db46 I get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. I have removed my /usr/local folder completely and it does not seem to help.

    Read the article

  • Macports 1.8.2 fails to build db46 on os x 1.6.3

    - by themoch
    i'm trying to put a dev environment on my mac, and to do so i need to install several packages which require db46 when running sudo port install db46 i get the following error: ---> Computing dependencies for db46 ---> Fetching db46 ---> Attempting to fetch patch.4.6.21.1 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.2 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.3 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch patch.4.6.21.4 from http://www.oracle.com/technology/products/berkeley-db/db/update/4.6.21/ ---> Attempting to fetch db-4.6.21.tar.gz from http://distfiles.macports.org/db4/4.6.21_6 ---> Verifying checksum(s) for db46 ---> Extracting db46 ---> Applying patches to db46 ---> Configuring db46 ---> Building db46 Error: Target org.macports.build returned: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_databases_db46/work/db-4.6.21/build_unix" && /usr/bin/make -j2 all " returned error 2 Command output: ../dist/../libdb_java/db_java_wrap.c:9464: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9487: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9509: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9532: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9563: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9588: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9613: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:9638: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9666: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9691: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jlong' ../dist/../libdb_java/db_java_wrap.c:9716: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9739: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9771: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9796: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9819: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9842: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9867: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jobject' ../dist/../libdb_java/db_java_wrap.c:9899: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9920: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9943: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:9966: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jstring' ../dist/../libdb_java/db_java_wrap.c:9991: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'jint' ../dist/../libdb_java/db_java_wrap.c:10010: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10046: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' ../dist/../libdb_java/db_java_wrap.c:10071: error: expected '=', ',', ';', 'asm' or '__attribute__' before 'void' make: *** [db_java_wrap.lo] Error 1 make: *** Waiting for unfinished jobs.... Note: Some input files use unchecked or unsafe operations. Note: Recompile with -Xlint:unchecked for details. cd ./classes && jar cf ../db.jar ./com/sleepycat Error: Status 1 encountered during processing. i have removed my /usr/local folder completely and it does not seem to help

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • jQuery: Giving each matched element an unique ID

    - by AnGafraidh
    I am writing an 'inline translator' application to be used with a cloud computing platform to extend non-supported languages. The majority of this uses jQuery to find the text value, replace it with the translation, then append the element with a span tag that has an unique ID, to be used elsewhere within the application. The problem arises however, when there are more than one element, say , that have the exact same value to be translated (matched elements). What happens in the function in question is that it puts all matched elements in the same span, taking the second, third, fourth, etc. out of their parent tags. My code is pretty much like this example: <script src='jquery-1.4.2.js'></script> <script> jQuery.noConflict(); var uniqueID='asdfjkl'; jQuery(window).ready(function() { var myQ1 = jQuery("input[id~=test1]"); myClone=myQ1.clone(); myClone.val('Replaced this button'); myQ1.replaceWith('<span id='+uniqueID+'></span>'); jQuery('#'+uniqueID).append(myClone); }); </script> <table> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> &nbsp; <input id='test2' type='button' value="And so am I"></input> </tr></td> <tr><td> <input id='test1' type='button' value="I'm a button!"></input> </tr></td> </table> As a workaround, I've experimented with using a loop to create a class for each span, rising in increment until jQuery("input[id~=test1]").length, but I can't seem to get anything I do to work. Is there any way to give each matched element an unique ID? My fluency in jQuery is being put to the test! Thanks for any help in advance. Aaron

    Read the article

  • Ubuntu suddenly freezes

    - by tapan
    I've a strange problem with my ubuntu 10.04 installation. Whenever i boot into ubuntu the entire system freezes / hangs soon after (~ 2 mins in). This problem exists on my windows 7 installation too. However if i start World of Warcraft or Warcraft on windows it doesnt hang for the duration i'm playing the game. After i stop playing and exit the game my laptop hangs inside 2 mins. Here is when it gets weirder. If i disconnect the charger, the laptop doesn't hang. However when I start it in ubuntu recovery mode and drop to root shell and use the 'startx' command everything works perfectly. I cannot figure out what the problem is. i have an intel core2duo 2.2ghz processor, intel mobile 965 graphics, 2 GB RAM for more details here is the output of cat /proc/cpuinfo : processor : 0 vendor_id : GenuineIntel cpu family : 6 model : 15 model name : Intel(R) Core(TM)2 Duo CPU T7500 @ 2.20GHz stepping : 11 cpu MHz : 2201.000 cache size : 4096 KB physical id : 0 siblings : 2 core id : 0 cpu cores : 2 apicid : 0 initial apicid : 0 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 10 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe nx lm constant_tsc arch_perfmon pebs bts pni dtes64 monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr pdcm lahf_lm ida tpr_shadow vnmi flexpriority bogomips : 4389.80 clflush size : 64 power management: processor : 1 vendor_id : GenuineIntel cpu family : 6 model : 15 model name : Intel(R) Core(TM)2 Duo CPU T7500 @ 2.20GHz stepping : 11 cpu MHz : 2201.000 cache size : 4096 KB physical id : 0 siblings : 2 core id : 1 cpu cores : 2 apicid : 1 initial apicid : 1 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 10 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe nx lm constant_tsc arch_perfmon pebs bts pni dtes64 monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr pdcm lahf_lm ida tpr_shadow vnmi flexpriority bogomips : 4388.96 clflush size : 64 power management: here is the output of cat /proc/meminfo MemTotal: 2052440 kB MemFree: 55924 kB Buffers: 579352 kB Cached: 821752 kB SwapCached: 704 kB Active: 897124 kB Inactive: 1032256 kB Active(anon): 412140 kB Inactive(anon): 264804 kB Active(file): 484984 kB Inactive(file): 767452 kB Unevictable: 0 kB Mlocked: 0 kB HighTotal: 1178440 kB HighFree: 6012 kB LowTotal: 874000 kB LowFree: 49912 kB SwapTotal: 995988 kB SwapFree: 986616 kB Dirty: 8928 kB Writeback: 0 kB AnonPages: 527596 kB Mapped: 76536 kB Slab: 39480 kB SReclaimable: 21100 kB SUnreclaim: 18380 kB PageTables: 5672 kB NFS_Unstable: 0 kB Bounce: 0 kB WritebackTmp: 0 kB CommitLimit: 2022208 kB Committed_AS: 1856400 kB VmallocTotal: 122880 kB VmallocUsed: 11928 kB VmallocChunk: 104644 kB HugePages_Total: 0 HugePages_Free: 0 HugePages_Rsvd: 0 HugePages_Surp: 0 Hugepagesize: 4096 kB DirectMap4k: 16376 kB DirectMap4M: 892928 kB Also the kern.log doesn't show any errors. What I want to know is what might be the problem, how i could test for it and if there are any solutions I could try. Thanks :).

    Read the article

  • Ubuntu/Windows suddenly freezes

    - by tapan
    I've a strange problem with my ubuntu 10.04 installation. Whenever i boot into ubuntu the entire system freezes / hangs soon after (~ 2 mins in). This problem exists on my windows 7 installation too. However if i start World of Warcraft or Warcraft on windows it doesnt hang for the duration i'm playing the game. After i stop playing and exit the game my laptop hangs inside 2 mins. Here is when it gets weirder. If i disconnect the charger, the laptop doesn't hang. However when I start it in ubuntu recovery mode and drop to root shell and use the 'startx' command everything works perfectly. I cannot figure out what the problem is. i have an intel core2duo 2.2ghz processor, intel mobile 965 graphics, 2 GB RAM for more details here is the output of cat /proc/cpuinfo : processor : 0 vendor_id : GenuineIntel cpu family : 6 model : 15 model name : Intel(R) Core(TM)2 Duo CPU T7500 @ 2.20GHz stepping : 11 cpu MHz : 2201.000 cache size : 4096 KB physical id : 0 siblings : 2 core id : 0 cpu cores : 2 apicid : 0 initial apicid : 0 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 10 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe nx lm constant_tsc arch_perfmon pebs bts pni dtes64 monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr pdcm lahf_lm ida tpr_shadow vnmi flexpriority bogomips : 4389.80 clflush size : 64 power management: processor : 1 vendor_id : GenuineIntel cpu family : 6 model : 15 model name : Intel(R) Core(TM)2 Duo CPU T7500 @ 2.20GHz stepping : 11 cpu MHz : 2201.000 cache size : 4096 KB physical id : 0 siblings : 2 core id : 1 cpu cores : 2 apicid : 1 initial apicid : 1 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 10 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe nx lm constant_tsc arch_perfmon pebs bts pni dtes64 monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr pdcm lahf_lm ida tpr_shadow vnmi flexpriority bogomips : 4388.96 clflush size : 64 power management: here is the output of cat /proc/meminfo MemTotal: 2052440 kB MemFree: 55924 kB Buffers: 579352 kB Cached: 821752 kB SwapCached: 704 kB Active: 897124 kB Inactive: 1032256 kB Active(anon): 412140 kB Inactive(anon): 264804 kB Active(file): 484984 kB Inactive(file): 767452 kB Unevictable: 0 kB Mlocked: 0 kB HighTotal: 1178440 kB HighFree: 6012 kB LowTotal: 874000 kB LowFree: 49912 kB SwapTotal: 995988 kB SwapFree: 986616 kB Dirty: 8928 kB Writeback: 0 kB AnonPages: 527596 kB Mapped: 76536 kB Slab: 39480 kB SReclaimable: 21100 kB SUnreclaim: 18380 kB PageTables: 5672 kB NFS_Unstable: 0 kB Bounce: 0 kB WritebackTmp: 0 kB CommitLimit: 2022208 kB Committed_AS: 1856400 kB VmallocTotal: 122880 kB VmallocUsed: 11928 kB VmallocChunk: 104644 kB HugePages_Total: 0 HugePages_Free: 0 HugePages_Rsvd: 0 HugePages_Surp: 0 Hugepagesize: 4096 kB DirectMap4k: 16376 kB DirectMap4M: 892928 kB Also the kern.log doesn't show any errors. What I want to know is what might be the problem, how i could test for it and if there are any solutions I could try. Thanks :).

    Read the article

  • Error installing pkgconfig via macports

    - by Greg K
    I installed Macports 1.8.2 from a DMG. That seemed to install fine. I ran sudo port selfupdate to make sure my ports tree was current. I then tried to install bindfs as I want to mount some directories in my OS X file system (like you can do with mount --bind in linux). pkgconfig and macfuse are two dependencies of bindfs. I had trouble installing bindfs due to errors installing pkgconfig, so I tried to just install pkgconfig, here's the debug output from sudo port install pkgconfig: $ sudo port -d install pkgconfig DEBUG: Found port in file:///opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: Changing to port directory: /opt/local/var/macports/sources/rsync.macports.org/release/ports/devel/pkgconfig DEBUG: OS Platform: darwin DEBUG: OS Version: 10.3.0 DEBUG: Mac OS X Version: 10.6 DEBUG: System Arch: i386 DEBUG: setting option os.universal_supported to yes DEBUG: org.macports.load registered provides 'load', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.unload registered provides 'unload', a pre-existing procedure. Target override will not be provided DEBUG: org.macports.distfiles registered provides 'distfiles', a pre-existing procedure. Target override will not be provided DEBUG: adding the default universal variant DEBUG: Reading variant descriptions from /opt/local/var/macports/sources/rsync.macports.org/release/ports/_resources/port1.0/variant_descriptions.conf DEBUG: Requested variant darwin is not provided by port pkgconfig. DEBUG: Requested variant i386 is not provided by port pkgconfig. DEBUG: Requested variant macosx is not provided by port pkgconfig. ---> Computing dependencies for pkgconfig DEBUG: Executing org.macports.main (pkgconfig) DEBUG: Skipping completed org.macports.fetch (pkgconfig) DEBUG: Skipping completed org.macports.checksum (pkgconfig) DEBUG: Skipping completed org.macports.extract (pkgconfig) DEBUG: Skipping completed org.macports.patch (pkgconfig) ---> Configuring pkgconfig DEBUG: Using compiler 'Mac OS X gcc 4.2' DEBUG: Executing org.macports.configure (pkgconfig) DEBUG: Environment: CFLAGS='-O2 -arch x86_64' CPPFLAGS='-I/opt/local/include' CXXFLAGS='-O2 -arch x86_64' MACOSX_DEPLOYMENT_TARGET='10.6' CXX='/usr/bin/g++-4.2' F90FLAGS='-O2 -m64' LDFLAGS='-L/opt/local/lib' OBJC='/usr/bin/gcc-4.2' FCFLAGS='-O2 -m64' INSTALL='/usr/bin/install -c' OBJCFLAGS='-O2 -arch x86_64' FFLAGS='-O2 -m64' CC='/usr/bin/gcc-4.2' DEBUG: Assembled command: 'cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig' checking for a BSD-compatible install... /usr/bin/install -c checking whether build environment is sane... yes checking for gawk... no checking for mawk... no checking for nawk... no checking for awk... awk checking whether make sets $(MAKE)... no checking whether to enable maintainer-specific portions of Makefiles... no checking build system type... i386-apple-darwin10.3.0 checking host system type... i386-apple-darwin10.3.0 checking for style of include used by make... none checking for gcc... /usr/bin/gcc-4.2 checking for C compiler default output file name... configure: error: C compiler cannot create executables See `config.log' for more details. Error: Target org.macports.configure returned: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 DEBUG: Backtrace: configure failure: shell command " cd "/opt/local/var/macports/build/_opt_local_var_macports_sources_rsync.macports.org_release_ports_devel_pkgconfig/work/pkg-config-0.23" && ./configure --prefix=/opt/local --enable-indirect-deps --with-pc-path=/opt/local/lib/pkgconfig:/opt/local/share/pkgconfig " returned error 77 while executing "$procedure $targetname" Warning: the following items did not execute (for pkgconfig): org.macports.activate org.macports.configure org.macports.build org.macports.destroot org.macports.install Error: Status 1 encountered during processing. I have only recently installed Xcode 3.2.2 (prior to installing macports). Am I right in thinking this the issue here: configure: error: C compiler cannot create executables

    Read the article

  • Import/rip/convert DVD to Adobe Premiere Pro for Mac

    - by alexyu2010
    For those who want to edit their videos, Adobe Premiere Pro will inevitably a good choice, it is a professional, real time, timeline based video editing software application that supports many video editing cards and plug-ins for accelerated processing, additional file format support and video/audio effects. Although Adobe Premiere Pro is said to be for professionals, is not so complicated that a hobbyist can't excel at using it in an hour or so. General file formats supported by Adobe Premiere Pro Up to now, Adobe Creative Suite has released several versions of Adobe Premiere Pro, including Adobe Premiere 1.0, Adobe Premiere 2.0, Adobe Premiere Pro CS3, Adobe Premiere Pro CS4 and the newly published Adobe Premiere Pro CS5. Although I saw diversity in file formats they support, I did find some common file formats supported by all of them, such as AVI, MOV, MPG. Importing DVD, Adobe Premiere Pro says "NO" It is obvious to all of us that Adobe Premiere Pro will never give DVD a hug, and it isn't rare to see that many people are really confused when they want to import their DVDs to Adobe Premiere Pro for editing. What to do? Yes, you may have noticed that, there is only a way out, that is ripping your DVDs to some formats workable with Adobe Premiere Pro natively, and this is what DVD to Adobe Premiere Pro can do. Importing DVD to Adobe Premiere Pro on Mac DVD to Adobe Premiere Pro converter for Mac is the specially designed application for ripping/converting DVD movies, DVD VOB files or DVD clips to Adobe Premiere Pro compatible AVI, MOV, MPG files with either DVD ripping tool and video converting tool within the versatile DVD to Adobe Premiere Pro converter who is a powerful program for dealing with DVD and videos perfectly. Mac DVD to Adobe Premiere Pro converter can work with a wide variety of files including DVD, VOB, AVI, WMV, MPG, MOV, MP4, DV, FLV, MKV, ASF, SWF, HD video for using with other editing tools like iMovie, FCP etc, play on QuickTime, iTunes, put on portable devices like iPod, iPhone, iPad, iRiver, BlackBerry, Gphone, Mobile Phone or upload to webistes such as YouTube, MySpace. DVD to Adobe Premiere Pro converter for Mac can also help you do some basic editing. You can trim, crop your DVD movie or DVD clip, apply special effect to make it more artistic, merge several DVD clips to a single one or tweak the output parameters for video and audio separately to get a better quality rendering. Besides, to get a good common of the process the preview widnows is also available for you.

    Read the article

  • Sharing the same `ssh-agent` among multiple login sessions

    - by intuited
    Is there a convenient way to ensure that all logins from a given user (ie me) use the same ssh-agent? I hacked out a script to make this work most of the time, but I suspected all along that there was some way to do it that I had just missed. Additionally, since that time there have been amazing advances in computing technology, like for example this website. So the goal here is that whenever I log in to the box, regardless of whether it's via SSH, or in a graphical session started from gdm/kdm/etc, or at a console: if my username does not currently have an ssh-agent running, one is started, the environment variables exported, and ssh-add called. otherwise, the existing agent's coordinates are exported in the login session's environment variables. This facility is especially valuable when the box in question is used as a relay point when sshing into a third box. In this case it avoids having to type in the private key's passphrase every time you ssh in and then want to, for example, do git push or something. The script given below does this mostly reliably, although it botched recently when X crashed and I then started another graphical session. There might have been other screwiness going on in that instance. Here's my bad-is-good script. I source this from my .bashrc. # ssh-agent-procure.bash # v0.6.4 # ensures that all shells sourcing this file in profile/rc scripts use the same ssh-agent. # copyright me, now; licensed under the DWTFYWT license. mkdir -p "$HOME/etc/ssh"; function ssh-procure-launch-agent { eval `ssh-agent -s -a ~/etc/ssh/ssh-agent-socket`; ssh-add; } if [ ! $SSH_AGENT_PID ]; then if [ -e ~/etc/ssh/ssh-agent-socket ] ; then SSH_AGENT_PID=`ps -fC ssh-agent |grep 'etc/ssh/ssh-agent-socket' |sed -r 's/^\S+\s+(\S+).*$/\1/'`; if [[ $SSH_AGENT_PID =~ [0-9]+ ]]; then # in this case the agent has already been launched and we are just attaching to it. ##++ It should check that this pid is actually active & belongs to an ssh instance export SSH_AGENT_PID; SSH_AUTH_SOCK=~/etc/ssh/ssh-agent-socket; export SSH_AUTH_SOCK; else # in this case there is no agent running, so the socket file is left over from a graceless agent termination. rm ~/etc/ssh/ssh-agent-socket; ssh-procure-launch-agent; fi; else ssh-procure-launch-agent; fi; fi; Please tell me there's a better way to do this. Also please don't nitpick the inconsistencies/gaffes ( eg putting var stuff in etc ); I wrote this a while ago and have since learned many things.

    Read the article

  • Graphics driver for ubuntu on dell latitude XT

    - by marc.riera
    Hi, we have a laptop (dell latitude xt) on our company, and we would like to install ubuntu on it. windows 7 works fine out of the box, so the hardware is fine. since this laptop has a touchscreen we just installed ubuntu 10.10 netbook edition 32x. But, we do not manage to enable the touchscreen, neither the vga graphic drivers. this is the output from lspci, if somebody cares. 00:00.0 Host bridge: ATI Technologies Inc Radeon Xpress 7930 Host Bridge 00:01.0 PCI bridge: ATI Technologies Inc RS7932 PCI Bridge 00:04.0 PCI bridge: ATI Technologies Inc Device 7934 00:06.0 PCI bridge: ATI Technologies Inc RS7936 PCI Bridge 00:07.0 PCI bridge: ATI Technologies Inc Device 7937 00:13.0 USB Controller: ATI Technologies Inc SB600 USB (OHCI0) 00:13.1 USB Controller: ATI Technologies Inc SB600 USB (OHCI1) 00:13.2 USB Controller: ATI Technologies Inc SB600 USB (OHCI2) 00:13.3 USB Controller: ATI Technologies Inc SB600 USB (OHCI3) 00:13.4 USB Controller: ATI Technologies Inc SB600 USB (OHCI4) 00:13.5 USB Controller: ATI Technologies Inc SB600 USB Controller (EHCI) 00:14.0 SMBus: ATI Technologies Inc SBx00 SMBus Controller (rev 14) 00:14.1 IDE interface: ATI Technologies Inc SB600 IDE 00:14.2 Audio device: ATI Technologies Inc SBx00 Azalia (Intel HDA) 00:14.3 ISA bridge: ATI Technologies Inc SB600 PCI to LPC Bridge 00:14.4 PCI bridge: ATI Technologies Inc SBx00 PCI to PCI Bridge 01:05.0 VGA compatible controller: ATI Technologies Inc Radeon Xpress 1250 03:01.0 CardBus bridge: Texas Instruments PCIxx12 Cardbus Controller 03:01.1 FireWire (IEEE 1394): Texas Instruments PCIxx12 OHCI Compliant IEEE 1394 Host Controller 03:01.3 SD Host controller: Texas Instruments PCIxx12 SDA Standard Compliant SD Host Controller 09:00.0 Ethernet controller: Broadcom Corporation NetXtreme BCM5756ME Gigabit Ethernet PCI Express 0b:00.0 Network controller: Broadcom Corporation BCM4321 802.11a/b/g/n (rev 03) I've tryied to install ati drivers 9.3 , which I downloaded and installed, unpacked and installed, builded and installed, but nothing worked. Looks like the latests version is just accepted to work on jaunty 9.04, so they are kind of old. what else I can do? thanks. Marc Information added: lsusb and lspci -n |grep 01:05.0 sysop@wl083517:~$ lspci -n |grep 01:05.0 01:05.0 0300: 1002:7942 sysop@wl083517:~$ lsusb Bus 006 Device 002: ID 413c:8138 Dell Computer Corp. Wireless 5520 Voda I Mobile Broadband (3G HSDPA) Minicard EAP-SIM Port Bus 006 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 005 Device 002: ID 413c:8140 Dell Computer Corp. Wireless 360 Bluetooth Bus 005 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 004 Device 002: ID 0483:2016 SGS Thomson Microelectronics Fingerprint Reader Bus 004 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 003 Device 002: ID 1b96:0001 N-Trig Duosense Transparent Electromagnetic Digitizer Bus 003 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 002 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 001 Device 002: ID 03f0:1807 Hewlett-Packard Bus 001 Device 001: ID 1d6b:0002 Linux Foundation 2.0 root hub sysop@wl083517:~$

    Read the article

  • Oracle performance problem

    - by jreid42
    We are using an Oracle 11G machine that is very powerful; has redundant storage etc. It's a beast from what I have been told. We just got this DB for a tool that when I first came on as a coop had like 20 people using, now its upwards of 150 people. I am the only one working on it :( We currently have a system in place that distributes PERL scripts across our entire data center essentially giving us a sort of "grid" computing power. The Perl scripts run a sort of simulation and report back the results to the database. They do selects / inserts. The load is not very high for each script but it could be happening across 20-50 systems at the same time. We then have multiple data centers and users all hitting the same database with this same approach. Our main problem with this is that our database is getting overloaded with connections and having to drop some. We sometimes have upwards of 500 connections. These are old perl scripts and they do not handle this well. Essentially they fail and the results are lost. I would rather avoid having to rewrite a lot of these as they are poorly written, and are a headache to even look at. The database itself is not overloaded, just the connection overhead is too high. We open a connection, make a quick query and then drop the connection. Very short connections but many of them. The database team has basically said we need to lower the number of connections or they are going to ignore us. Because this is distributed across our farm we cant implement persistent connections. I do this with our webserver; but its on a fixed system. The other ones are perl scripts that get opened and closed by the distribution tool and thus arent always running. What would be my best approach to resolving this issue? The scripts themselves can wait for a connection to be open. They do not need to act immediately. Some sort of queing system? I've been suggested to set up a few instances of a tool called "SQL Relay". Maybe one in each data center. How reliable is this tool? How good is this approach? Would it work for what we need? We could have one for each data center and relay requests through it to our main database, keeping a pipeline of open persistent connections? Does this make sense? Is there any other suggestions you can make? Any ideas? Any help would be greatly appreciated. Sadly I am just a coop student working for a very big company and somehow all of this has landed all on my shoulders (there is literally nobody to ask for help; its a hardware company, everybody is hardware engineers, and the database team is useless and in India) and I am quite lost as what the best approach would be? I am extremely overworked and this problem is interfering with on going progress and basically needs to be resolved as quickly as possible; preferably without rewriting the whole system, purchasing hardware (not gonna happen), or shooting myself in the foot. HELP LOL!

    Read the article

  • What do you use to store all of your personal data?

    - by codeflunky
    I have been on a quest for years to find the perfect tool to store all "my stuff". You know... personal information, code snippets, software keys, people's birthdays, whatever. There are lots of tools out there for this sort of thing, but I've never found any of them quite what I need. Ideally, I would just be able to type some notes, tag them (I don't like the idea of folder organization... too cumbersome) and then easily search and retrieve what I need later. It seems so simple, but for some reason I just can't find it. I currently use Backpack (sometimes), which is OK, but I hate the fact that you always have to create "pages" to store things. I don't want to have to do that. I want to just type some notes, tag it and save. That's it. And Backpack didn't even have search for a long time. What I do like about Backpack is that it's fast and it's web based. I've tried some desktop apps, which probably came closer to the functionality I want, but I just hate being tied to a single machine. I want to be able to get to my stuff anywhere, so the web based thing is a definite requirement. Anyway, I'm thinking about writing my own thing for this if I can't find anything, but before I make the attempt, I was wondering if anyone has any suggestions? I've used Backpack, Zoho Planner, Stikkit and Google Notes so far, and they are not quite to my liking. Anyone? (Sorry if this is off-topic, but I figured you guys might be legitimately into this kind of thing... you know, storing code snippets and such.) UPDATE: I've been using Evernote for a few days, and it is exactly what I've been looking for. It is totally tag based and allows both online and offline usage. The desktop app sits in your system tray and allows you to add whatever you want on the fly either as text notes or clippings from the browser. It also syncs it to the web (if you want) where you can get to it from anywhere using their web client. They even have a mobile client which I haven't used, but I will try it soon. Thanks again 18hrs. I wish I could give you 10 upvotes.

    Read the article

  • Where / how does Apache generate the HTML code used in the default directory listing?

    - by Ellen B
    I am looking to modify the HTML that apache generates for its default directory listing. I already know how to create a HEADER.html file that gets included for every directory listing. I am attempting to change the actual html that Apache generates for the file listing itself; right now my MacOS apache generates this for example: <table><tr><th><img src="/icons/blank.gif" alt="[ICO]"></th><th><a href="?C=N;O=D">Name</a></th><th><a href="?C=M;O=A">Last modified</a></th><th><a href="?C=S;O=A">Size</a></th><th><a href="?C=D;O=A">Description</a></th></tr><tr><th colspan="5"><hr></th></tr> <tr><td valign="top"><img src="/icons/folder.gif" alt="[DIR]"></td><td><a href="ios-prototype/">ios-prototype/</a> </td><td align="right">07-Dec-2012 16:47 </td><td align="right"> - </td><td>&nbsp;</td></tr> <tr><td valign="top"><img src="/icons/folder.gif" alt="[DIR]"></td><td><a href="magneto-git/">magneto-git/</a> </td><td align="right">07-Dec-2012 16:46 </td><td align="right"> - </td><td>&nbsp;</td></tr> <tr><th colspan="5"><hr></th></tr> </table> I want a different HTML structure (like, say, an OL) generated when my server spits back directory listings. (FYI I'm doing a bunch of mobile browser prototyping with my local webserver & need to make it not totally horrible to browse with fingers to the right test directory — the table structure sucks, and while I can mod a lot of it with CSS it's still going to be ganky.)

    Read the article

  • Open ports broken from internal network

    - by ksvi
    Quick summary: Forwarded port works from the outside world, but from the internal network using the external IP the connection is refused. This is a simplified situation to make the explanation easier: I have a computer that is running a service on port 12345. This computer has an internal IP 192.168.1.100 and is connected directly to a modem/router which has internal IP 192.168.1.1 and external (public, static) IP 1.2.3.4. (The router is TP-LINK TD-w8960N) I have set up port forwarding (virtual server) at port 12345 to go to port 12345 at 192.168.1.100. If I run telnet 192.168.1.100 12345 from the same computer everything works. But running telnet 1.2.3.4 12345 says connection refused. If I do this on another computer (on the same internal network, connected to the router) the same thing happens. This would seem like the port forwarding is not working. However... If I run a online port checking service on my external IP and the service port it says the port is open and I can see the remote server connecting and immediately closing connection. And using another computer that is connected to the internet using a mobile connection I can also use telnet 1.2.3.4 12345 and I get a working connection. So the port forwarding seems to be working, however using external IP from the internal network doesn't. I have no idea what can be causing this, since another setup very much like this (different router) works for me. I can access a service running on a server from inside the network both through the internal and external IP. Note: I know I could just use the internal IP inside of the network to access this service. But if I have a laptop that must be able to do this both from inside and outside it would be annoying to constantly switch between 1.2.3.4 and 192.168.1.100 in the software configuration. Router output: > iptables -t nat -L -n Chain PREROUTING (policy ACCEPT) target prot opt source destination ACCEPT all -- 0.0.0.0/0 224.0.0.0/3 DNAT tcp -- 0.0.0.0/0 0.0.0.0/0 tcp dpt:25 to:192.168.1.101 DNAT udp -- 0.0.0.0/0 0.0.0.0/0 udp dpt:25 to:192.168.1.101 DNAT tcp -- 0.0.0.0/0 0.0.0.0/0 tcp dpt:110 to:192.168.1.101 DNAT tcp -- 0.0.0.0/0 0.0.0.0/0 tcp dpt:12345 to:192.168.1.102 DNAT udp -- 0.0.0.0/0 192.168.1.1 udp dpt:53 to:217.118.96.203 Chain POSTROUTING (policy ACCEPT) target prot opt source destination MASQUERADE all -- 192.168.1.0/24 0.0.0.0/0 Chain OUTPUT (policy ACCEPT) target prot opt source destination

    Read the article

  • Graphics driver for ubuntu on dell latitude XT

    - by marc.riera
    we have a laptop (dell latitude xt) on our company, and we would like to install ubuntu on it. windows 7 works fine out of the box, so the hardware is fine. since this laptop has a touchscreen we just installed ubuntu 10.10 netbook edition 32x. But, we do not manage to enable the touchscreen, neither the vga graphic drivers. this is the output from lspci, if somebody cares. 00:00.0 Host bridge: ATI Technologies Inc Radeon Xpress 7930 Host Bridge 00:01.0 PCI bridge: ATI Technologies Inc RS7932 PCI Bridge 00:04.0 PCI bridge: ATI Technologies Inc Device 7934 00:06.0 PCI bridge: ATI Technologies Inc RS7936 PCI Bridge 00:07.0 PCI bridge: ATI Technologies Inc Device 7937 00:13.0 USB Controller: ATI Technologies Inc SB600 USB (OHCI0) 00:13.1 USB Controller: ATI Technologies Inc SB600 USB (OHCI1) 00:13.2 USB Controller: ATI Technologies Inc SB600 USB (OHCI2) 00:13.3 USB Controller: ATI Technologies Inc SB600 USB (OHCI3) 00:13.4 USB Controller: ATI Technologies Inc SB600 USB (OHCI4) 00:13.5 USB Controller: ATI Technologies Inc SB600 USB Controller (EHCI) 00:14.0 SMBus: ATI Technologies Inc SBx00 SMBus Controller (rev 14) 00:14.1 IDE interface: ATI Technologies Inc SB600 IDE 00:14.2 Audio device: ATI Technologies Inc SBx00 Azalia (Intel HDA) 00:14.3 ISA bridge: ATI Technologies Inc SB600 PCI to LPC Bridge 00:14.4 PCI bridge: ATI Technologies Inc SBx00 PCI to PCI Bridge 01:05.0 VGA compatible controller: ATI Technologies Inc Radeon Xpress 1250 03:01.0 CardBus bridge: Texas Instruments PCIxx12 Cardbus Controller 03:01.1 FireWire (IEEE 1394): Texas Instruments PCIxx12 OHCI Compliant IEEE 1394 Host Controller 03:01.3 SD Host controller: Texas Instruments PCIxx12 SDA Standard Compliant SD Host Controller 09:00.0 Ethernet controller: Broadcom Corporation NetXtreme BCM5756ME Gigabit Ethernet PCI Express 0b:00.0 Network controller: Broadcom Corporation BCM4321 802.11a/b/g/n (rev 03) I've tryied to install ati drivers 9.3 , which I downloaded and installed, unpacked and installed, builded and installed, but nothing worked. Looks like the latests version is just accepted to work on jaunty 9.04, so they are kind of old. what else I can do? thanks. Marc Information added: lsusb and lspci -n |grep 01:05.0 sysop@wl083517:~$ lspci -n |grep 01:05.0 01:05.0 0300: 1002:7942 sysop@wl083517:~$ lsusb Bus 006 Device 002: ID 413c:8138 Dell Computer Corp. Wireless 5520 Voda I Mobile Broadband (3G HSDPA) Minicard EAP-SIM Port Bus 006 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 005 Device 002: ID 413c:8140 Dell Computer Corp. Wireless 360 Bluetooth Bus 005 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 004 Device 002: ID 0483:2016 SGS Thomson Microelectronics Fingerprint Reader Bus 004 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 003 Device 002: ID 1b96:0001 N-Trig Duosense Transparent Electromagnetic Digitizer Bus 003 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 002 Device 001: ID 1d6b:0001 Linux Foundation 1.1 root hub Bus 001 Device 002: ID 03f0:1807 Hewlett-Packard Bus 001 Device 001: ID 1d6b:0002 Linux Foundation 2.0 root hub sysop@wl083517:~$

    Read the article

  • Ubuntu Newbie Needs Assistance!!

    - by Steve Greene
    New Ubuntu User Needs Help!- version 9.10 does not communicate with laptop Hello folks, Several days ago, I installed Ubuntu 9.10 onto my Acer Aspire 3100 laptop, running it alongside Widows Vista as a dual-bootable system. Creation of the Ubuntu boot CD went fine, and the installation onto my hard drive was flawless. Ubuntu opens and behaves as I would expect, except for one little problem. For reasons unknown to me, Ubuntu is not communicating with my laptop's networking hardware, and I have no internet connectivity, even when sitting directly under the wireless router at the local library (literally), which puts out a wickedly-fast signal that my Windows Vista OS auto-detects and immediately connects to. Up in the right side of the Ubuntu desktop, I click on the network icon and it does not show a wireless connection at all, even though I am only a few feet from the router. At home, where I use a dialup modem, I also see no means of getting online. My modem is an HDAUDIO Soft Data Fax Modem with Smart CP,manufactured by CXT (Conexant Systems Inc., file version 4.0.13.0, and the driver version is 7.58.0.0). I desparately wish to convert to Ubuntu. I used Mac for ten years, and then Windows for ten years. Now, after 20 years, I want to live out my days as an open-source Ubuntu fanatic. I am ready to give the old status quo the boot! I am an advanced computer user, but I am not a programmer. I seek a solution that is user-friendly for normal people, something equivalent to a driver that I can easily install or activate that will allow Ubuntu to see my hardware and get me connected. Can anyone help me over this hopefully-little glitch so that I can move on in total Ubuntu bliss? My processor is a Mobile AMD Sempron Processor 3500+ at 1.80 GHz, 1.50 GB RAM, and a 32-bit Operating System. I am running Windows Vista Home Basic, Service Pack 2. My current email is [email protected] if you have a workable solution that does not require programmer status to implement. Surely this must be a simple fix that I simply am overlooking, but being the new guy on the block, I have yet to be enlightened. Thanks for your help in coming up to speed!! Steve Wanna' be Ubuntu Fanatic "If you're not living on the edge, you're taking up too much space."

    Read the article

  • I cut-to-move DCIM folder to ext SD when an auto android OS update popped up b4 I could choose target - Cannot recover 200+ photos

    - by ZeroG
    I was downloading my Exhibit II's DCIM camera folder (with month's of photos inside) to its external SD card, in order to transfer them into my laptop. In my overconfidence, I hurriedly chose cut-to-move (rather than copy-to-move) when KABOOM! —an automatic Android OS update popped up before I could choose the target!!! I figured everything was in cache & calmly tried to go through with the update. But that was not a typically seamless event. It showed downloading icon but hmm… since I rooted the phone it brought the command line up & recovery sequence. But neither Android nor I had yet downloaded any alternate custom ROM Files to internal SD to update from! So were they trying to make me unroot my phone by giving me some bogus update on the fly or just give me a hard time in trying to hand me down an unrooted ROM that I'd have to figure out how to root again? Yes, I know there was that blurb about overwriting a file of the same name but I was trying to shake the darn stubborn update being forced on my phone during this precarious moment. I thought I had frozen or turned off all those auto-updates previously. Anyway, phones are small & fingers are big (sigh)... I tried to reboot into safe mode but the resultant photo file was partially overwritten (200 files had names but Zero bytes in them). I thought maybe it was still hung in cache or deposited somewhere else but I have searched everywhere with file managers. Since I did not have Titanium backing up camera, photo folder or gallery, I cannot recover 200+ photos. Dumb. You can understand my dilemma as I am involved in the arts & although just a camera phone, most of these photos were historic & aesthetic or at least as to subject matter. Photo-ops don't reoccur. I have tried a couple of recovery apps from the market like Search Duplicates & Recover to no avail. I was only able to salvage stuff I'd sent out in messages. I've got several decades in computers & this is such a miserable beginner's piece of bad luck I can't believe it happened to me. They were precious photos! Yes, I turned on Titanium since & yes I even tried USB to laptop recoveries. Being on a MacBookPro I'm trying androidfiletransfer.dmg, but I'd have to upgrade to Peach Sunrise to get above Android 3.0 for that App to recognize the phone via USB & the programmer says installation zeros your data, so that pretty much toasts any secret hidden places where these photos may have been deposited. Don't want to do that & am still trying to find them. They certainly didn't make it to my external SD Card. If any of you techies out there know anything, please help & thanks. Despite decades of being in computing, unfamiliar & ever-changing hard or software can humble even the most seasoned veterans.

    Read the article

< Previous Page | 291 292 293 294 295 296 297 298 299 300 301 302  | Next Page >