Search Results

Search found 23573 results on 943 pages for 'program flow'.

Page 296/943 | < Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >

  • Python: How to quit CLI when stuck in blocking raw_input?

    - by christianschluchter
    I have a GUI program which should also be controllable via CLI (for monitoring). The CLI is implemented in a while loop using raw_input. If I quit the program via a GUI close button, it hangs in raw_input and does not quit until it gets an input. How can I immediately abort raw_input without entering an input? I run it on WinXP but I want it to be platform independent, it should also work within Eclipse since it is a developer tool. Python version is 2.6. I searched stackoverflow for hours and I know there are many answers to that topic, but is there really no platform independent solution to have a non-blocking CLI reader? If not, what would be the best way to overcome this problem? Thanks

    Read the article

  • Call external library from PHP. What is faster: exec or extension?

    - by robusta
    Hi, I need to make calls from webpage to external library written in C++ and display the result. Platform is Linux, Apache, PHP. My current idea is to use PHP service which will call my library/program. I found that there are two possible ways to do this: 1) use PHP 'exec' function 2) write PHP extension I am curious what works more effective? Faster? Less load the server? I will probably need to do 4 calls per second, so I want to be as optimal as possible. P.S. If you are aware of some other (more effective) way of calling C++ library or program from webpage, please let me know. Thanks a lot, Robusta

    Read the article

  • unittest in python: ignore an import from the code I want to test

    - by vaidab
    I have a python program that imports pythoncom (and uses pythoncom.CoCreateInstance from it). I want to create a unittest for the program logic without it importing pythoncom (so I can run the test on Linux as well). What options are there? Can I do it without modifying the system under test? What I found so far: sys.modules["pythoncom"] = "test" import module_that_imports_pythoncom My problem with it is if I have: from pythoncom.something import something I'll get: ImportError: No module named something.something And sys.modules["something.something"] or sys.modules["pythoncom.something.something"] doesn't work. Any ideas?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Execute a line in a text file

    - by apophis
    Hi I have a program that reads text files filled with code designed to be executed line by line by the program, like a script file. The problem is that I don't no how to do the line executing part. Here is my code, I thought using the \r would fool the console. But it just shows me a list of lines in the file. if (tok[0] == "read" && length == 2) { try { StreamReader tr = new StreamReader(@"C:\Users\Public\"+tok[1]+".txt"); while (!tr.EndOfStream) { Console.WriteLine(tr.ReadLine()); } } catch { Console.WriteLine("No such text file.\n"); } Prompt(); If I knew what to search for to fix my problem in Google, I would have. But I've got no idea. Thanks

    Read the article

  • Make a USB Device, Control It In Java

    - by yar
    I'm thinking about making a physical controller (device?) with knobs, buttons, and LEDs. I'd like to interact with it using Java (respond to the knobs, light up LEDs, etc). The reason I mention Java is two-fold: first, I know Java well1. Second, I've written the rest of the program I need to interface with in Java (though there are ways to talk to the Java program from another language). I would like the device to connect via USB and be (computer-)platform independent. I haven't the slightest idea of where to start, except to start reading the Arduino website. Is this my best/only option? Is there something better suited for communicating with Java? Note: I know that Arduino has something to do with Java (not sure what), but it seems like code must be written in a subset of C. How would I get moving on this topic? 1 - No laughter, please.

    Read the article

  • Using a database/index sequential file independently of the Unix distribution

    - by Helper Method
    What I'm planning to do is a) parse a file for some lines matching a regular expression b) store the match in some sort of database / file so I don't have to do the parsing again and again c) call another program passing the matches as arguments While I can imagine how to do a) and c), I'm a little bit unsure about b). The matches are of the form key:attribute1:attribute2:attribute3 where attribute 2 may be optional. I'm thinking of storing the results in a simple database but the problem is the database needs to available on a number of Unix platform for the program to work. Are there any (simple) databases which can be found on any Unix platforms? Or should I use some sort of index-sequential file?

    Read the article

  • Boost Shared Pointers and Memory Management

    - by Izza
    I began using boost rather recently and am impressed by the functionality and APIs provided. In using boost::shared_ptr, when I check the program with Valgrind, I found a considerable number of "Still reachable" memory leaks. As per the documentation of Valgrind, these are not a problem. However, since I used to use the standard C++ library only, I always made sure that any program written is completely free from memory leaks. My question is, are these memory leaks something to worry about? I tried using reset(), however it only decrements the reference count, doesn't deallocate memory. Can I safely ignore these, or any way to forcibly deallocate the memory allocated by boost::shared_ptr? Thank you.

    Read the article

  • [C++] Needed: A simple C++ container (stack, linked list) that is thread-safe for writing

    - by conradlee
    I am writing a multi-threaded program using OpenMP in C++. At one point my program forks into many threads, each of which need to add "jobs" to some container that keeps track of all added jobs. Each job can just be a pointer to some object. Basically, I just need the add pointers to some container from several threads at the same time. Is there a simple solution that performs well? After some googling, I found that STL containers are not thread-safe. Some stackoverflow threads address this question, but none form a consensus on a simple solution.

    Read the article

  • Broadcast message or file to nearby Bluetooth devices

    - by Medjeti
    Hiya, A client of ours is attending a business fair and would like to push some sort of "welcome message" to people visiting their space. I'm not too familiar with Bluetooth, so I have a few questions: What kind of content can you transfer via Bluetooth? (Is it files only or is it possible to send a simple text message?) Is it possible to push content only to recipients within a certain distance? (ie. based on signal strength or similar) Can anybody recommend a piece of software that can do some or all of the above? If necessary we could program a custom solution ourselves (.NET), but I'm sure there must be a program out there that can do the job. I've googled a bit and came across the 32feet.NET framework - does anybody have any experience with this framework? Thanks in advance for any suggestions!

    Read the article

  • explain this macro

    - by deostroll
    #define __T(x) L ## x Found in code from one of the MFC source header file. It is mostly used for converting strings to ........ (I don't know what). If I am correct it converts strings to LPCTSTR...don't know what that type is either... I can't seem to convert char* into LPCTSTR. While MFC file handling, the following code will always return error while trying to open the file... char* filepath = "C:\\Program Files\\Microsoft Office\\Office12\\BITMAPS\\STYLES\\GLOBE.WMF"; if( !file.Open((LPCTSTR)filepath , CFile::modeRead, &fexp) ) { fexp.ReportError(); return 1; } But instead if I wrote it this way, it doesn't give error: if( !file.Open( _T("C:\\Program Files\\Microsoft Office\\Office12\\BITMAPS\\STYLES\\GLOBE.WMF") , CFile::modeRead, &fexp) ) { fexp.ReportError(); return 1; } I am looking at passing a variable as the first argument to the CFile::Open() method.

    Read the article

  • Change Dll loaded with MEF

    - by Tim
    Hi all, I'm using MEF and the System.ComponentModel.Composition.dll to load some dll. I'm doing something like : AggregateCatalog catalog = new AggregateCatalog(new AssemblyCatalog(Assembly.GetExecutingAssembly()), new DirectoryCatalog(directory)); _container = new CompositionContainer(catalog); _container.ComposeParts(this); to import my dll. After some times, I would like to update my dll but if I try to delete it, I have an access denied, because it's alrealdy used by the program. How can I release the dll, replace with a new dll and load the dll again ? (without closing the program) Thanks in advance for your help

    Read the article

  • When debugging in VS 2008 why does the debugger land on a second return statement?

    - by Hellfire
    When debugging the following console program: class Program { static void Main(string[] args) { Console.WriteLine(DoIt(false)); Console.WriteLine(DoIt(true)); } private static Boolean DoIt(Boolean abort) { try { throw new InvalidOperationException(); } catch(Exception ex) { if (abort) { return true; } Console.WriteLine("Got here"); return false; } } } Why does the IDE land on the second return statement during the second call to DoIt()? The results of the execution is correct but the debugging experience is misleading. Is this a known issue? Is the behavior in VS 2010 the same?

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • just x86 assembly question~~!!

    - by kevin
    this is my assembly program which is just a function to swap *x *y. so first argument from main is address of x which is in 8(%ebp) and second one is address of y is in 12(%ebp). the program does swap x and y. I need 7 lines for doing this. can you make it 6 lines and there is a condition you can use only %eax,%ecx, and %edx 3 registers. I think about it so much.. but.. I can't make it 6 lines...there must be a way.. isn't it? this might be not a big deal.. but if there is a way to get it in 6lines. I want to know.. if you know the way~ help me~ plz~ thank you and have a good and nice day~ movl 8(%ebp), %eax movl (%eax), %ecx movl 12(%ebp), %edx movl (%edx), %eax movl %ecx, (%edx) movl 8(%ebp), %ecx movl %eax, (%ecx)

    Read the article

  • Statically linked libraries not running code inside to setup static variables.

    - by MJD
    In a c++ project I am working on, I have a simple c++ file that needs to run some code at the beginning of the program execution. This file is linked into a static library, which is then linked into the main program. I have similar code in other files running fine, that looks something like: bool ____nonexistent_value = executeAction(); However, it does not work inside this file unless I make use of a function implemented in this file. It does work if the library is compiled as a shared library. I'd prefer to link this statically as the library is only a convenience as the file is in a different directory.

    Read the article

  • Memory allocated with malloc does not persist outside function scope?

    - by PM
    Hi, I'm a bit new to C's malloc function, but from what I know it should store the value in the heap, so you can reference it with a pointer from outside the original scope. I created a test program that is supposed to do this but I keep getting the value 0, after running the program. What am I doing wrong? int f1(int * b) { b = malloc(sizeof(int)); *b = 5; } int main() { int * a; f1(a); printf("%d\n", a); return 0; }

    Read the article

  • Sending a file from memory (rather than disk) over HTTP using libcurl

    - by cinek1lol
    Hi! I would like to send pictures via a program written in C + +. - OK WinExec("C:\\curl\\curl.exe -H Expect: -F \"fileupload=@C:\\curl\\ok.jpg\" -F \"xml=yes\" -# \"http://www.imageshack.us/index.php\" -o data.txt -A \"Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.8.1.1) Gecko/20061204 Firefox/2.0.0.1\" -e \"http://www.imageshack.us\"", NULL); It works, but I would like to send the pictures from pre-loaded carrier to a variable char (you know what I mean? First off, I load the pictures into a variable and then send the variable), cause now I have to specify the path of the picture on a disk. I wanted to write this program in c++ by using the curl library, not through exe. extension. I have also found such a program (which has been modified by me a bit) #include <stdio.h> #include <string.h> #include <iostream> #include <curl/curl.h> #include <curl/types.h> #include <curl/easy.h> int main(int argc, char *argv[]) { CURL *curl; CURLcode res; struct curl_httppost *formpost=NULL; struct curl_httppost *lastptr=NULL; struct curl_slist *headerlist=NULL; static const char buf[] = "Expect:"; curl_global_init(CURL_GLOBAL_ALL); /* Fill in the file upload field */ curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "send", CURLFORM_FILE, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "nowy.jpg", CURLFORM_COPYCONTENTS, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "submit", CURLFORM_COPYCONTENTS, "send", CURLFORM_END); curl = curl_easy_init(); headerlist = curl_slist_append(headerlist, buf); if(curl) { curl_easy_setopt(curl, CURLOPT_URL, "http://www.imageshack.us/index.php"); if ( (argc == 2) && (!strcmp(argv[1], "xml=yes")) ) curl_easy_setopt(curl, CURLOPT_HTTPHEADER, headerlist); curl_easy_setopt(curl, CURLOPT_HTTPPOST, formpost); res = curl_easy_perform(curl); curl_easy_cleanup(curl); curl_formfree(formpost); curl_slist_free_all (headerlist); } system("pause"); return 0; }

    Read the article

  • Best way to create a Unique ID field for an enum

    - by jax
    What is the best way to get a Unique ID from an ENUM that will stay consistent between repeated execution of the program? Currently I am doing this manually by passing an ID to the enum constructor. I don't really want to do this is I can help it. Another option would be to use a static field that gets incremented for each enum value. The problem is that if later I decide to move the enum fields around or delete some this will cause problems with my program as the ID will be saved into user preferences. The ID can be any basic type or a String.

    Read the article

< Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >