Search Results

Search found 19018 results on 761 pages for 'raw input'.

Page 296/761 | < Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >

  • Why is Drupal writing to root and not sites/default/files?

    - by Candland
    I'm using Drupal 6.14 on Win7. Everything seems to work except files that should be written to sites/default/files are trying to be written to /. The site was moved from a linux installation, which is writing the files correctly. I have setup a web.config w/ the rewrite rules for drupal. Not sure what or where else I should check. Thanks for any help. <rule name="Drupal Clean URLs" stopProcessing="true"> <match url="^(.*)$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php?q={R:1}" appendQueryString="true" /> </rule>

    Read the article

  • Is it possible to block a certain character or group of characters from entering into text box or an

    - by Param-Ganak
    Hello friends! I have a text input field like text box or text area. I want to prevent the user from entering certain character or a group of characters. That is for example if I dont want # * @ and numbers from 0-9 these characters. So Whenever user press any of the above character key then that character should not appear in to an input field. It means directly blocking that character. Is this possible in Jquery? Please give me some guidelines to achive it. Thank You

    Read the article

  • HTML5 Video Javascript

    - by user373721
    Hi, I am not experienced in Javascript, I have the following script to play video files on Andriod phone, and it works fine. <script type="text/javascript"> function PlayMyVideo(arg) { var myVideo = document.getElementById([arg]); myVideo.play(); } </script> <video id="what" src="what.mp4" poster="" /> <input type="button" onclick="PlayMyVideo('what')" value="Play" /> I am trying to write the tag on the fly: <script type="text/javascript"> function PlayVideo() { new_video = document.createElement('video'); new_video.setAttribute('scr', 'what.mp4'); new_video.play(); } </script> <input type="button" onclick="PlayVideo()" value="Play2" /> Nothing happen, would appreciate your suggestions. Thanks in advance

    Read the article

  • Passing Values from a View to itself with parameters getting null values ?

    - by vsj
    Hi all, I am trying to get values from a view which i have the code below and I am taking the start date value from the view input text box and posting it back but I am still getting null except for the apikey and userkey.Here are the two views.. public ActionResult View1(string apiKey, string userId) { StartGoalViewModel vm = new StartGoalViewModel(); vm.ApiKey = apiKey; vm.UserId = userId; vm.GoalTypeId =1; vm.StartDate = null; return View(vm); } VIEW1.ASPX <% Html.BeginForm(); %> <%= Html.TextBox("name", Model.StartDate) %> <input type="submit" value="Start" /> <% Html.EndForm(); %> [HttpPost] public ActionResult VIEW1 (StartGoalViewModel fm) { // I get StartDate null... }

    Read the article

  • Problem with Initializing Consts

    - by UdiM
    This code, when compiled in xlC 8.0 (on AIX 6.1), produces the wrong result. It should print 12345, but instead prints 804399880. Removing the const in front of result makes the code work correctly. Where is the bug? #include <stdio.h> #include <stdlib.h> #include <string> long int foo(std::string input) { return strtol(input.c_str(), NULL, 0); } void bar() { const long int result = foo("12345"); printf("%u\n", result); } int main() { bar(); return 0; } Compilation command: /usr/vacpp/bin/xlC example.cpp -g

    Read the article

  • login not working when changing from mysql to mysqli

    - by user1438647
    I have a code below where it logs a teacher in by matching it's username and password in the database, if correct, then log in, if incorrect, then display a message. <?php session_start(); $username="xxx"; $password="xxx"; $database="mobile_app"; $link = mysqli_connect('localhost',$username,$password); mysqli_select_db($link, $database) or die( "Unable to select database"); foreach (array('teacherusername','teacherpassword') as $varname) { $$varname = (isset($_POST[$varname])) ? $_POST[$varname] : ''; } ?> <form action="<?php echo htmlentities($_SERVER['PHP_SELF']); ?>" method="post" id="teachLoginForm"> <p>Username</p><p><input type="text" name="teacherusername" /></p> <!-- Enter Teacher Username--> <p>Password</p><p><input type="password" name="teacherpassword" /></p> <!-- Enter Teacher Password--> <p><input id="loginSubmit" type="submit" value="Login" name="submit" /></p> </form> <?php if (isset($_POST['submit'])) { $query = " SELECT * FROM Teacher t WHERE (t.TeacherUsername = '".mysqli_real_escape_string($teacherusername)."') AND (t.TeacherPassword = '".mysqli_real_escape_string($teacherpassword)."') "; $result = mysqli_query($link, $query); $num = mysqli_num_rows($result); $loged = false; while($row = mysqli_fetch_array($result)) { if ($_POST['teacherusername'] == ($row['TeacherUsername']) && $_POST['teacherpassword'] == ($row['TeacherPassword'])) { $loged = true; } $_SESSION['teacherforename'] = $row['TeacherForename']; $_SESSION['teachersurname'] = $row['TeacherSurname']; $_SESSION['teacherusername'] = $row['TeacherUsername']; } if ($loged == true){ header( 'Location: menu.php' ) ; }else{ echo "The Username or Password that you Entered is not Valid. Try Entering it Again."; } mysqli_close($link); } ?> Now the problem is that even if the teacher has entered in the correct username and password, it still doesn't let the teacher log in. When the code above was the old mysql() code, it worked fine as teacher was able to login when username and password match, but when trying to change the code into mysqli then it causes login to not work even though username and password match. What am I doing wrong?

    Read the article

  • Scanner class is skipping lines

    - by user2403304
    I'm new to programing and I'm having a problem with my scanner class. This code is in a loop and when the loop comes around the second, third whatever time I have it set to it skips the first title input. I need help please why is it skipping my title scanner input in the beginning? System.out.println("Title:"); list[i].title=keyboard.nextLine(); System.out.println("Author:"); list[i].author=keyboard.nextLine(); System.out.println("Album:"); list[i].album=keyboard.nextLine(); System.out.println("Filename:"); list[i].filename=keyboard.nextLine();

    Read the article

  • php random image file name

    - by bush man
    Okay im using a snippet I found on google to take a users uploaded image and put it in my directory under Content But Im worried about duplicates so I was going have it upload the image as a Random number well here is my code you can probably understand what im going for through it anyways <label for="file">Profile Pic:</label> <input type="file" name="ProfilePic" id="ProfilePic" /><br /> <input type="submit" name="submit" value="Submit" /> $ProfilePicName = $_FILES["ProfilePic"]["name"]; $ProfilePicType = $_FILES["ProfilePic"]["type"]; $ProfilePicSize = $_FILES["ProfilePic"]["size"]; $ProfilePicTemp = $_FILES["ProfilePic"]["tmp_name"]; $ProfilePicError = $_FILES["ProfilePic"]["error"]; $RandomAccountNumber = mt_rand(1, 99999); echo $RandomAccountNumber; move_uploaded_file($ProfilePicTemp, "Content/".$RandomAccountNumber.$ProfilePicType); And then basicly after all this Im going try to get it to put that random number in my database

    Read the article

  • "Remember" last three MySql queries; Cookie, passed variable or other method?

    - by Camran
    I have a classified website, with pretty sophisticated searching, and I am about to implement a function where the last three queries is displayed for the user, so that the user can go back easier through the queries. This because for each query the user has to provide a lot of input. I have four questions for you: I wonder, how can I save the actual query (SELECT * FROM etc etc)...? Do I need to add some form of encryption to be on the safe side? How will this affect performance? (I don't like the fact that cookies slow websites down) Anything else to think about? If you need more input, let me know... Btw, the website is PHP based. Thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • IIS7 URL Redirect with Regex

    - by andyjv
    I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • Using php to create a password system with chinese characters

    - by WillDonohoe
    Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

    Read the article

  • inputMismatchException Java reading doubles from plain text file

    - by user939287
    Using double variable = inputFile.nextDouble(); Gives the mismatch error and I can't figure out why... Anyone know what's up? The input file is just a bunch of doubles like 5.0... Okay here is the code snippet String fileName; Scanner scanner = new Scanner(System.in); System.out.println("\nEnter file name that contains the matrix and vector: "); fileName = scanner.nextLine(); Scanner inputFile = new Scanner(fileName); double a1 = inputFile.nextDouble(); the input file is a plain text document .txt in this format 5.0 4.0 -3.0 4.0 2.0 5.0 6.0 5.0 -2.0 -13.0 4.0 12.0 I don't understand why it wouldn't take those as doubles... As far as what its expecting the format of the file to be... I suppose binary? isn't that the default? I didn't specify in the code...

    Read the article

  • How do I do Textbox Submit

    - by Newb
    Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

    Read the article

  • Failed to sum splited text

    - by user1784753
    I have a problem when summing all of bx3.text to t2.text. first I split bx3.text with space private void total() { string[] ps = bx3.Text.Split(new string[] {" "}, StringSplitOptions.None ); t2.Text = ps.Select(x => Convert.ToInt32(x)).Sum().ToString(); } I did try with t2.text = ps[1] and the number showed was correct. but when i try to sum it all, I got error "Input string was not in a correct format" on (x = Convert.ToInt32(x)) bx3.text is full of user-input number separated by single space " "

    Read the article

  • PHP setcookie warning

    - by Ranking
    Hello guys, I have a problem with 'setcookie' in PHP and I can't solve it. so I receive this error "Warning: Cannot modify header information - headers already sent by (output started at C:\Program Files\VertrigoServ\www\vote.php:14) in C:\Program Files\VertrigoServ\www\vote.php on line 86" and here is the file.. line 86 is setcookie ($cookie_name, 1, time()+86400, '/', '', 0); is there any other way to do this ?? <html> <head> <title>Ranking</title> <link href="style.css" rel="stylesheet" type="text/css"> </head> <body bgcolor="#EEF0FF"> <div align="center"> <br/> <div align="center"><div id="header"></div></div> <br/> <table width="800" border="0" align="center" cellpadding="5" cellspacing="0" class="mid-table"> <tr><td height="5"> <center> <table border="0" cellpadding="0" cellspacing="0" align="center" style="padding-top:5px;"> <tr> <td align="center" valign="top"><img src="images/ads/top_banner.png"></td> </tr> </table> </center> </td></tr> <tr><td height="5"></td></tr> </table> <br/> <?php include "conf.php"; $id = $_GET['id']; if (!isset($_POST['submitted'])) { if (isset($_GET['id']) && is_numeric($_GET['id'])) { $id = mysql_real_escape_string($_GET['id']); $query = mysql_query("SELECT SQL_CACHE id, name FROM s_servers WHERE id = $id"); $row = mysql_fetch_assoc($query); ?> <form action="" method="POST"> <table width="800" height="106" border="0" align="center" cellpadding="3" cellspacing="0" class="mid-table"> <tr><td><div align="center"> <p>Code: <input type="text" name="kod" class="port" /><img src="img.php" id="captcha2" alt="" /><a href="javascript:void(0);" onclick="document.getElementById('captcha2').src = document.getElementById('captcha2').src + '?' + (new Date()).getMilliseconds()">Refresh</a></p><br /> <p><input type="submit" class="vote-button" name="vote" value="Vote for <?php echo $row['name']; ?>" /></p> <input type="hidden" name="submitted" value="TRUE" /> <input type="hidden" name="id" value="<?php echo $row['id']; ?>" /> </div></td></tr> <tr><td align="center" valign="top"><img src="images/ads/top_banner.png"></td></tr> </table> </form> <?php } else { echo '<font color="red">You must select a valid server to vote for it!</font>'; } } else { $kod=$_POST['kod']; if($kod!=$_COOKIE[imgcodepage]) { echo "The code does not match"; } else { $id = mysql_real_escape_string($_POST['id']); $query = "SELECT SQL_CACHE id, votes FROM s_servers WHERE id = $id"; $result = mysql_query($query) OR die(mysql_error()); $row = mysql_fetch_array($result, MYSQL_ASSOC); $votes = $row['votes']; $id = $row['id']; $cookie_name = 'vote_'.$id; $ip = $_SERVER['REMOTE_ADDR']; $ltime = mysql_fetch_assoc(mysql_query("SELECT SQL_CACHE `time` FROM `s_votes` WHERE `sid`='$id' AND `ip`='$ip'")); $ltime = $ltime['time'] + 86400; $time = time(); if (isset($_COOKIE['vote_'.$id]) OR $ltime > $time) { echo 'You have already voted in last 24 hours! Your vote is not recorded.'; } else { $votes++; $query = "UPDATE s_servers SET votes = $votes WHERE id = $id"; $time = time(); $query2 = mysql_query("INSERT INTO `s_votes` (`ip`, `time`, `sid`) VALUES ('$ip', '$time', '$id')"); $result = mysql_query($query) OR die(mysql_error()); setcookie ($cookie_name, 1, time()+86400, '/', '', 0); } } } ?> <p><a href="index.php">[Click here if you don't want to vote]</a></p><br/> <p><a href="index.php">Ranking.net</a> &copy; 2010-2011<br> </p> </div> </body> </html> Thanks a lot!

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • JComboBox to string

    - by gabrielle fregil
    I have a String array of names, and then I added it into an editable JComboBox. The user can either pick his/her name from the choices or just input his/her name if not in the choices. How do I put the user input into a new string variable? String [] chooseName = { Mark, John, Allison, Jessica }; JComboBox combo = new JComboBox (chooseName); combo.setEditable(true); String chosenName = /* how do i place what the user inputed here? */

    Read the article

  • Database that accesses a website.?

    - by Alec
    Hi Guys What application should I use that is able to automatically access a website to gather information? Basically I have a database that completes calculations for me; however I have to manually gather the parameters from a website and input these into my database. What I would like is have an application that will take my input say the name of a product, access the website, add this name into a search box on a website, complete the search and then extract the desired information from the web page returning the results to my application to complete the calculation thus presenting me with the result. This is a little out of my depth but I’m willing to learn no matter how complicated the software. Cheers for your help.

    Read the article

  • Shell Sort problem

    - by user191603
    Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

    Read the article

  • how to use OR in jquery

    - by user1493339
    1st i would like to thanks all who view this and special thanks for those who answer this. today, i tested this out but it not working, so just want to know how should this code. multiple "OR" in one line $("input[name='ABC']or[name='DEF']or[name='GHI']or[name='JKL']").click(function (){ //do something }); or even put else for it like... $("input[name='ABC'][name='DEF'][name='GHI'][name='JKL']").click(function (){ //do something }else{ //do something else }); i know both code is invalid, so is that possible to code in that way? so far i code it all one by one, so my coding is very long.

    Read the article

  • Confused on the basics of AJAX

    - by Doug
    So right now, I'm just using a basic form to check a password. I want it to check the password and basically remain on page.html so I can use JavaScript to alert incorrect password or something. I'm not really sure how to do that. It seems it would bring me to check.php. I'm not too sure on the whole process, any help appreciated! Thanks! Page.html <form action="check.php" method="post"> <input type="password" name="password" /> <input type="submit" value="Submit" /> </form> check.php <?php $password = $_POST['password']; if ( $password != "testing" ) { die(); } ?>

    Read the article

< Previous Page | 292 293 294 295 296 297 298 299 300 301 302 303  | Next Page >