Search Results

Search found 9545 results on 382 pages for 'least privilege'.

Page 302/382 | < Previous Page | 298 299 300 301 302 303 304 305 306 307 308 309  | Next Page >

• How to properly load HTML data from third party website using MVC+AJAX?

  - by Dmitry

  I'm building ASP.NET MVC2 website that lets users store and analyze data about goods found on various online trade sites. When user is filling a form to create or edit an item, he should have a button "Import data" that automatically fills some fields based on data from third party website. The question is: what should this button do under the hood? I see at least 2 possible solutions. First. Do the import on client side using AJAX+jQuery load method. I tried it in IE8 and received browser warning popup about insecure script actions. Of course, it is completely unacceptable. Second. Add method ImportData(string URL) to ItemController class. It is called via AJAX, does the import + data processing server-side and returns JSON-d result to client. I tried it and received server exception (503) Server unavailable when loading HTML data into XMLDocument. Also I have a feeling that dealing with not well-formed HTML (missing closing tags, etc.) will be a huge pain. Any ideas how to parse such HTML documents?

  Read the article

• What makes good web form styling for business applications?

  - by ProfK

  Styling forms (form elements) is something that even Eric Meyer prefers to avoid. However, most business forms, and that is where styling is at issue; 'contact us' forms are easy to style, put window estate at a premium, with more 'document level' (e.g. invoice) fields, plus 'detail level' (e.g. invoice line) fields. Factors I often find at play are: At my minimum, at least two horizontally adjacent fieldsets are required. In applications vs. public web pages, fixed positioning vs fluid layout is often better. Quantity of content is important, vs. exaggerated readability. Users know the system, and cues etc. take a back seat. In light of factors like these, is there any available guidence for styling web form based applications? Are there any CSS or JavaScript frameworks that would make my quest to style these applications better than Visual Studios still pathetic 'Auto-format' (what drugs were those people on? I will never take them.)

  Read the article

• LINQ to Entities question about orderby and null collections.

  - by Chevex

  I am currently developing a forum. I am new to LINQ and EF. In my forum I have a display that shows a list of topics with the most recent topics first. The problem is that "most recent" is relative to the topic's replies. So I don't want to order the list by the topic's posted date, rather I want to order the list by the topic's last reply's posted date. So that topics with newer replies pop back to the top of the list. This is rather simple if I knew that every topic had at least one reply; I would just do this: var topicsQuery = from x in board.Topics orderby x.Replies.Last().PostedDate descending select x; However, in many cases the topic has no replies. In which case I would like to use the topic's posted date instead. Is there a way within my linq query to order by x.PostedDate in the event that the topic has no replies? I'm getting confused by this and any help would be appreciated. With the above query, it breaks on topics with no replies because of the x.Replies.Last() which assumes there are replies. LastOrDefault() doesn't work because I need to access the PostedDate property which also assumes a reply exists. Thanks in advance for any insight.

  Read the article

• IE 8 remove line break between nodes with JavaScript

  - by Tokimon

  Ok i have a list of HTML nodes which should be inline with no spacing between them. The problem is, that the nodes are written from a CMS and therefore will come with all sorts of linebreaks and spaces. Therefore I'm removing the spaces with JS using the method descibed in this question. The problem is, however, that in IE (not 9) the white spaces isn't part of the childrens list of the parent node, rendering the method useless in IE. However IE 7 (or at least IE 9 emulating IE 7) ignores the linebreaks, so that one is in the clear. That leaves IE 8 as the troublemaker. I discovered that the line break is actually a part of the outerHTML and that a simple reset of the outerHTML did the trick - like so: node.outerHTML = node.outerHTML However this will reset the node intirely and therefore removing all events and other settings on the node, which isn't really any good. So my question is now: Is there a way to remove that linebreak from the nodes outerHTML whitout resetting the node? I've tried with zoom: 1, but to no avail. Hope anyone has any experience with this.

  Read the article

• Can this auto-stretcing scenario be realized undex XHTML/CSS?

  - by Vilx-

  I want two horizontal areas in my webpage. The first one is the menu. It's on the top. Unfortunately I don't know its size, and it might change in response to user actions. Below the menu is the main area which should stretch at least as far as the bottom of the window (if there is little content) or beyond (if there is a lot of content. To illustrate with ASCII art: +----------------------------------------------------+ | This area resizes vertically depending on contents | +----------------------------------------------------+ | This area stretches to the bottom of the window, | | but can be even larger if necessary. Note: this | | should be a separate area because it will contain | | children with height:100% as well. | | | +----------------------------------------------------+ Can this be done? Can it be done with Javascript? Added: To put things in perspective and avoid confusion, think of it this way: the top menu is generated by myself, but the bottom area is an IFrame which I want to fill the rest of the page. This is what it eventually comes down to anyway in my case.

  Read the article

• Migrate Data and Schema from MySQL to MSSQL

  - by colithium

  Are there any free solutions for automatically migrating a database from MySQL to MSSQL Server that "just works"? I've been attempting this simple (at least I thought so) task all day now. I've tried: MSSQL Server Management Studio's Import Data feature Create an empty database Tasks - Import Data... .NET Framework Data Provider for Odbc Valid DSN (verified it connects) Copy data from one or more tables or views Check 1 VERY simple table Click Preview Get Error: The preview data could not be retrieved. ADDITIONAL INFORMATION: ERROR [42000] [MySQL][ODBC 5.1 Driver][mysqld-5.1.45-community]You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near '"table_name"' at line 1 (myodbc5.dll) A similar error occurs if I go through the rest of the wizard and perform the operation. The failed step is "Setting Source Connection" the error refers to retrieving column information and then lists the above error. It can retrieve column information just fine when I modify column mappings so I really don't know what the issue is. I've also tried getting various MySql tools to output ddl statements that MSSQL understand but haven't succeeded. I've tried with MySQL v5.1.11 to SQL Server 2005 and with MySQL v5.1.45 to SQL Server 2008 (with ODBC drivers 3.51.27.00 and 5.01.06.00 respectively)

  Read the article

• Need help with strange Class#getResource() issue

  - by Andreas_D

  I have some legacy code that reads a configuration file from an existing jar, like: URL url = SomeClass.class.getResource("/configuration.properties"); // some more code here using url variable InputStream in = url.openStream(); Obviously it worked before but when I execute this code, the URL is valid but I get an IOException on the third line, saying it can't find the file. The url is something like "file:jar:c:/path/to/jar/somejar.jar!configuration.properties" so it doesn't look like a classpath issue - java knows pretty well where the file can be found.. The above code is part of an ant task and it fails while the task is executed. Strange enough - I copied the code and the jar file into a separate class and it works as expected, the properties file is readable. At some point I changed the code of the ant task to URL url = SomeClass.class.getResource("/configuration.properties"); // some more code here using url variable InputStream in = SomeClass.class.getResourceAsStream("/configuration.properties"); and now it works - just until it crashes in another class where a similiar access pattern is implemented.. Why could it have worked before, why does it fail now? The only difference I see at the moment is, that the old build was done with java 1.4 while I'm trying it with Java 6 now. Workaround Today I installed Java 1.4.2_19 on the build server and made ant to use it. To my totally frustrating surprise: The problem is gone. It looks to me, that java 1.4.2 can handle URLs of this type while Java 1.6 can't (at least in my context/environment). I'm still hoping for an explanation although I'm facing the work to rewrite parts of the code to use Class#getRessourceAsStream which behaved much more stable...

  Read the article

• Making a table in a scrolling div resizable?

  - by Mason Jones

  I've got a table in a div, with a vertical scrollbar on the div to allow the table to be longer than the div can hold. Works fine. But I'd like to allow the user to resize the div vertically if they want to be able to view more of the table. I've been playing with the jQueryUI resizable interaction, but it doesn't seem to quite do what I want; at least, not so far. I've tried making the wrapper div resizable, but the behavior's erratic. If I have the style "height:20em; overflow:auto;" on it, then I can resize the table horizontally, but not vertically. If I remove the overflow, then the table flows outside the div of course. If I remove the height, then the table is actually resizable, but it is initially drawn at full height. Anyone know of a way to specify an initial height, but allow it to be resized larger than that? If I make the table resizable rather than the div, then I can resize the table horizontally within the div but I can't increase the height of the displayed table. Which makes sense, of course, but I thought I'd mention it. Also, is there a way to make the resize "handle" the corner between the horizontal and vertical scrollbars? Right now it's a sort of invisible handle in the bottom-right of the table. Thanks for any thoughts.

  Read the article

• Optimizing an embedded SELECT query in mySQL

  - by Crazy Serb

  Ok, here's a query that I am running right now on a table that has 45,000 records and is 65MB in size... and is just about to get bigger and bigger (so I gotta think of the future performance as well here): SELECT count(payment_id) as signup_count, sum(amount) as signup_amount FROM payments p WHERE tm_completed BETWEEN '2009-05-01' AND '2009-05-30' AND completed > 0 AND tm_completed IS NOT NULL AND member_id NOT IN (SELECT p2.member_id FROM payments p2 WHERE p2.completed=1 AND p2.tm_completed < '2009-05-01' AND p2.tm_completed IS NOT NULL GROUP BY p2.member_id) And as you might or might not imagine - it chokes the mysql server to a standstill... What it does is - it simply pulls the number of new users who signed up, have at least one "completed" payment, tm_completed is not empty (as it is only populated for completed payments), and (the embedded Select) that member has never had a "completed" payment before - meaning he's a new member (just because the system does rebills and whatnot, and this is the only way to sort of differentiate between an existing member who just got rebilled and a new member who got billed for the first time). Now, is there any possible way to optimize this query to use less resources or something, and to stop taking my mysql resources down on their knees...? Am I missing any info to clarify this any further? Let me know... EDIT: Here are the indexes already on that table: PRIMARY PRIMARY 46757 payment_id member_id INDEX 23378 member_id payer_id INDEX 11689 payer_id coupon_id INDEX 1 coupon_id tm_added INDEX 46757 tm_added, product_id tm_completed INDEX 46757 tm_completed, product_id

  Read the article

• Facebook not recoginising open graph tags

  - by Pratik Poddar

  My object page looks like: <html xmlns="http://www.w3.org/1999/xhtml" dir="ltr" lang="en-US" xmlns:fb="https://www.facebook.com/2008/fbml"> <head prefix="og: http://ogp.me/ns# cliprin: http://ogp.me/ns/apps/cliprin#"> <meta property="fb:app_id" content="143944345745133" /> <meta property="og:type" content="cliprin:product" /> <meta property="og:url" content="https://itsourstudio.com/" /> <meta property="og:title" content="LED Ice Cubes (Set Of 4)" /> <meta property="og:sitename" content="Its Our Studio" /> <meta property="og:image" content="https://s-static.ak.fbcdn.net/images/devsite/attachment_blank.png" /> <meta property="og:description" content="Blah Blah Blah" /> </head> </html> The JSLink Debugger of the page as shown by the link shows that of:type is website and gives following warnings: Open Graph Warnings That Should Be Fixed Inferred Property: The 'og:url' property should be explicitly provided, even if a value can be inferred from other tags. Inferred Property: The 'og:title' property should be explicitly provided, even if a value can be inferred from other tags. Inferred Property: The 'og:description' property should be explicitly provided, even if a value can be inferred from other tags. Inferred Property: The 'og:image' property should be explicitly provided, even if a value can be inferred from other tags. Tiny og:image: All the images referenced by og:image must be at least 200px in both dimensions. Please check all the images with tag og:image in the given url and ensure that it meets the minimum specification.

  Read the article

• What's the best way to only output a tag if it exists in XSL?

  - by Morinar

  I'm working on an interface with a 3rd party app that basically needs to take XML that was spat out by the app and convert it into XML our system can deal with. It's basically just applying a stylesheet to the original XML to make it looks like "our" XML. I've noticed that in other stylesheets we have, there are constructs like this: <xsl:for-each select="State"> <StateAbbreviation> <xsl:value-of select="."/> </StateAbbreviation> </xsl:for-each> Basically, the "in" XML has a State tag that I need to output as our recognized StateAbbreviation tag. However, I want to ONLY output the StateAbbreviation tag if the "in" XML contains the State tag. The block above accomplishes this just fine, but is not very intuitive (at least it wasn't to me), as every time I see a for-each I assume there is more than one, whereas in these cases there is 0 or 1. My question: is that a standard-ish construct? If not, is there a more preferred way to do it? I could obviously check the string length (which is also being done in other stylesheets), but would like to do it the same, "best" way everywhere (assuming of course that a "best" way exists. Advice? Suggestions?

  Read the article

• What caused the rails application crash?

  - by so1o

  I'm sure someone can explain this. we have an application that has been in production for an year. recently we saw an increase in number of support requests for people having difficulty signing into the system. after scratching our head because we couldn't recreate the problem in development, we decided we'll switch on debug logger in production for a month. that was june 5th. application worked fine with the above change and we were waiting. then yesterday we noticed that the log files were getting huge so we made another change in production config.logger = Logger.new("#{RAILS_ROOT}/log/production.log", 50, 1048576) after this change, the application started crashing while processing a particular file. this particular line of code was RAILS_DEFAULT_LOGGER.info "Payment Information Request: ", request.inspect as you can see there was a comma instead of a plus sign. this piece of code was introduced in Mar. the question is this: why did the application fail now? if changing the debug level caused the application to process this line of code it should have started failing on june 5th! why today. please someone help us. Are we missing the obvious here? if you dont have an answer, at least let us know we aren't the only one that are bonkers.

  Read the article

• Validate HAML from ActiveRecord: scope/controller/helpers for link_to etc?

  - by Chris Boyle

  I like HAML. So much, in fact, that in my first Rails app, which is the usual blog/CMS thing, I want to render the body of my Page model using HAML. So here is app/views/pages/_body.html.haml: .entry-content= Haml::Engine.new(body, :format => :html5).render ...and it works (yay, recursion). What I'd like to do is validate the HAML in the body when creating or updating a Page. I can almost do that, but I'm stuck on the scope argument to render. I have this in app/models/page.rb: validates_each :body do |record, attr, value| begin Haml::Engine.new(value, :format => :html5).render(record) rescue Exception => e record.errors.add attr, "line #{(e.respond_to? :line) && e.line || 'unknown'}: #{e.message}" end end You can see I'm passing record, which is a Page, but even that doesn't have a controller, and in particular doesn't have any helpers like link_to, so as soon as a Page uses any of that it's going to fail to validate even when it would actually render just fine. So I guess I need a controller as scope for this, but accessing that from here in the model (where the validator is) is a big MVC no-no, and as such I don't think Rails gives me a way to do it. (I mean, I suppose I could stash a controller in some singleton somewhere or something, but... excuse me while I throw up.) What's the least ugly way to properly validate HAML in an ActiveRecord validator?

  Read the article

• HTTP Negotiate windows vs. Unix server implementation using python-kerberos

  - by ondra

  I tried to implement a simple single-sign-on in my python web server. I have used the python-kerberos package which works nicely. I have tested it from my Linux box (authenticating against active directory) and it was without problem. However, when I tried to authenticate using Firefox from Windows machine (no special setup, just having the user logged into the domain + added my server into negotiate-auth.trusted-uris), it doesn't work. I have looked at what is sent and it doesn't even resemble the things the Linux machine sends. This Microsoft description of the process pretty much resembles the way my interaction from Linux works, but the Windows machine generally sends a very short string, which doesn't even resemble the things microsoft documentation states, and when base64 decoded, it is something like 12 zero bytes followed by 3 or 4 non-zero bytes (GSS functions then return that it doesn't support such scheme) Either there is something wrong with the client Firefox settings, or there is some protocol which I am supposed to follow for the Negotiate protocol, but which I cannot find any reference anywhere. Any ideas what's wrong? Do you have any idea what protocol I should by trying to find, as it doesn' look like SPNEGO, at least from MS documentation.

  Read the article

• Exception calling UpdateModel - Value cannot be null or empty

  - by James Alexander

  This is probably something silly I'm missing but I'm definitely lost. I'm using .NET 4 RC and VS 2010. This is also my first attempt to use UpdateModel in .NET 4, but every time I call it, I get an exception saying Value cannont be null or empty. I've got a simple ViewModel called LogOnModel: [MetadataType(typeof(LogOnModelMD))] public class LogOnModel { public string Username { get; set; } public string Password { get; set; } public class LogOnModelMD { [StringLength(3), Required] public object Username { get; set; } [StringLength(3), Required] public object Password { get; set; } } } My view uses the new strongly typed helpers in MVC2 to generate a textbox for username and one for the password. When I look at FormCollection in my controller method, I see values for both coming through. And last but not least, here's are post controller methods: // POST: /LogOn/ [HttpPost] public ActionResult Index(FormCollection form) { var lm = new LogOnModel(); UpdateModel(lm, form); var aservice = new AuthenticationService(); if (!aservice.AuthenticateLocal(lm.Username, lm.Password)) { ModelState.AddModelError("User", "The username or password submitted is invalid, please try again."); return View(lm); } return Redirect("~/Home"); } Can someone please lend some insight into why UpdateModel would be throwing this exception? Thanks!

  Read the article

• Designing small comparable objects

  - by Thomas Ahle

  Intro Consider you have a list of key/value pairs: (0,a) (1,b) (2,c) You have a function, that inserts a new value between two current pairs, and you need to give it a key that keeps the order: (0,a) (0.5,z) (1,b) (2,c) Here the new key was chosen as the average between the average of keys of the bounding pairs. The problem is, that you list may have milions of inserts. If these inserts are all put close to each other, you may end up with keys such to 2^(-1000000), which are not easily storagable in any standard nor special number class. The problem How can you design a system for generating keys that: Gives the correct result (larger/smaller than) when compared to all the rest of the keys. Takes up only O(logn) memory (where n is the number of items in the list). My tries First I tried different number classes. Like fractions and even polynomium, but I could always find examples where the key size would grow linear with the number of inserts. Then I thought about saving pointers to a number of other keys, and saving the lower/greater than relationship, but that would always require at least O(sqrt) memory and time for comparison. Extra info: Ideally the algorithm shouldn't break when pairs are deleted from the list.

  Read the article

• Integrate OpenId into an existing site

  - by Andrea

  I have a working web application which already has a login and registration system. I'm looking for some advice on how to do it. Until now, users have a username, an email, a password and some optional fields. The registrartion is the usual process with email confirmation. Now I'd like to allow users to use OpenId. So I have added an openid field to the table. There are two different login forms, and users which are already registered can add their openid info and use either login form. The problem is with new users who come on the site for the first time and try to login with OpenId. I create a new user for them, and I don't need a password, but still I need at least a username, which is used on the site (I'm not sure if the email is needed). So my problems are: 1) How do I manage validation? Some fields are required for some users, (e.g. a password) but not for some others. I mean, I can do this, but it immediately gets messy. 2) Should I ask for a username and email on the first OpenId login? On the one hand I'd say yes, but I fear this vanishes the advantages of using OpenId, that is, not having to provide details. 3) I could get the details via SReg or AttributeExchange, but most providers have a bad support for those. For instance my Gmail OpenId account does not tell the email (!). Is there some place to learn more about the current support for these extensions?

  Read the article

• Implementation of MVC with SQLite and NSURLConnection, use cases?

  - by user324723

  I'm interested in knowing how others have implemented/designed database & web services in their iphone app and how they simplified it for the entire application. My application is dependent on these services and I can't figure out a efficient way to use them together due to the (semi)complexity of my requirements. My past attempts on combining them haven't been completely successful or at least optimal in my mind. I'm building a database driven iphone app that uses a relational database in sqlite and consumes web services based on missing content or user interaction. Like this hasn't been done before...right? Since I am using a relational database - any web services consumed requires normalization, parsing the result and persisting it to the database before it can be displayed in a table view controller. The applications UI consists of nested(nav controller) table views where a user can select a cell and be taken to the next table view where it attempts to populate the table views data source from the database. If nothing exists in the database then it will send a request via web services to download its content, thus download - parse - persist - query - display. Since the user has the ability to request a refresh of this data it still requires the same process. Quickly describing what I've implemented and tried to run with - 1st attempt - Used a singleton web service class that handled sending web service requests, parsing the result and returning it to the table view controller via delegate protocols. Once the controller received that data it would then be responsible for persisting it to the database and re-returning the result. I didn't like the idea of only preventing the case where the app delegate selector doesn't exists(released) causing the app to crash. 2nd attempt - Used NSNotificationCenter for easy access to both database and web services but later realized it was more complex due to adding and removing observers per view(which isn't advised anyways).

  Read the article

• LINQ-SQL Updating Multiple Rows in a single transaction

  - by RPM1984

  Hi guys, I need help re-factoring this legacy LINQ-SQL code which is generating around 100 update statements. I'll keep playing around with the best solution, but would appreciate some ideas/past experience with this issue. Here's my code: List<Foo> foos; int userId = 123; using (DataClassesDataContext db = new FooDatabase()) { foos = (from f in db.FooBars where f.UserId = userId select f).ToList(); foreach (FooBar fooBar in foos) { fooBar.IsFoo = false; } db.SubmitChanges() } Essentially i want to update the IsFoo field to false for all records that have a particular UserId value. Whats happening is the .ToList() is firing off a query to get all the FooBars for a particular user, then for each Foo object, its executing an UPDATE statement updating the IsFoo property. Can the above code be re-factored to one single UPDATE statement? Ideally, the only SQL i want fired is the below: UPDATE FooBars SET IsFoo = FALSE WHERE UserId = 123 EDIT Ok so looks like it cant be done without using db.ExecuteCommand. Grr...! What i'll probably end up doing is creating another extension method for the DLINQ namespace. Still require some hardcoding (ie writing "WHERE" and "UPDATE"), but at least it hides most of the implementation details away from the actual LINQ query syntax.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Why does GetWindowThreadProcessId return 0 when called from a service

  - by Marve

  When using the following class in a console application, and having at least one instance of Notepad running, GetWindowThreadProcessId correctly returns a non-zero thread id. However, if the same code is included in a Windows Service, GetWindowThreadProcessId always returns 0 and no exceptions are thrown. Changing the user the service launches under to be the same as the one running the console application didn't alter the result. What causes GetWindowThreadProcessId to return 0 even if it is provided with a valid hwnd? And why does it function differently in the console application and the service? Note: I am running Windows 7 32-bit and targeting .NET 3.5. public class TestClass { [DllImport("user32.dll")] static extern uint GetWindowThreadProcessId(IntPtr hWnd, IntPtr ProcessId); public void AttachToNotepad() { var processesToAttachTo = Process.GetProcessesByName("Notepad") foreach (var process in processesToAttachTo) { var threadID = GetWindowThreadProcessId(process.MainWindowHandle, IntPtr.Zero); .... } } } Console Code: class Program { static void Main(string[] args) { var testClass = new TestClass(); testClass.AttachToNotepad(); } } Service Code: public class TestService : ServiceBase { private TestClass testClass = new TestClass(); static void Main() { ServiceBase.Run(new TestService()); } protected override void OnStart(string[] args) { testClass.AttachToNotepad(); base.OnStart(args); } protected override void OnStop() { ... } }

  Read the article

• CORBA on MacOS X (Cocoa)

  - by user8472

  I am currently looking into different ways to support distributed model objects (i.e., a computational model that runs on several different computers) in a project that initially focuses on MacOS X (using Cocoa). As far as I know there is the possibility to use the class cluster around NSProxy. But there also seem to be implementations of CORBA around with Objective-C support. At a later time there may be the need to also support/include Windows machines. In that case I would need to use something like Gnustep on the Windows side (which may be an option, if it works well) or come up with a combination of both technologies. Or write something manually (which is, of course, the least desirable option). My questions are: If you have experience with both technologies (Cocoa native infrastructure vs. CORBA) can you point out some key features/issues of either approach? Is it possible to use Gnustep with Cocoa in the way explained above? Is it possible (and reasonably feasible, i.e. simpler than writing a network layer manually) to communicate among all MacOS clients using Cocoa's technology and with Windows clients through CORBA?

  Read the article

• SQLAlchemy & Complex Queries

  - by user356594

  I have to implement ACL for an existing application. So I added the a user, group and groupmembers table to the database. I defined a ManyToMany relationship between user and group via the association table groupmembers. In order to protect some ressources of the app (i..e item) I added a additional association table auth_items which should be used as an association table for the ManyToMany relationship between groups/users and the specific item. item has following columns: user_id -- user table group_id -- group table item_id -- item table at least on of user_id and group_id columns are set. So it's possible to define access for a group or for a user to a specific item. I have used the AssociationProxy to define the relationship between users/groups and items. I now want to display all items which the user has access to and I have a really hard time doing that. Following criteria are used: All items which are owned by the user should be shown (item.owner_id = user.id) All public items should be shown (item.access = public) All items which the user has access to should be shown (auth_item.user_id = user.id) All items which the group of the user has access to should be shown. The first two criteria are quite straightforward, but I have a hard time doing the 3rd one. Here is my approach: clause = and_(item.access == 'public') if user is not None: clause = or_(clause,item.owner == user,item.users.contains(user),item.groups.contains(group for group in user.groups)) The third criteria produces an error. item.groups.contains(group for group in user.groups) I am actually not sure if this is a good approach at all. What is the best approach when filtering manytomany relationships? How I can filter a manytomany relationship based on another list/relationship? Btw I am using the latest sqlalchemy (6.0) and elixir version Thanks for any insights.

  Read the article

• URLLoader.load() issue when using the same URLRequest

  - by Rudy

  Hello, I have an issue with my eventListeners with the URLLoader, but this issue happens in IE, not in FF. public function getUploadURL():void { var request:URLRequest = new URLRequest(); request.url = getPath(); request.method = URLRequestMethod.GET; _loader = new URLLoader(); _loader.dataFormat = URLLoaderDataFormat.TEXT; _loader.addEventListener(Event.COMPLETE, getBaseURL); _loader.load(request); } private function getBaseURL(event:Event):void { _loader.removeEventListener(Event.COMPLETE, getBaseURL); } The issue is that my getBaseURL gets executed automatically after I have executed the code at least once, but that is the case only in IE. What happens is I call my getUploadURL, I make sure the server sends an event that will result in an Event.COMPLETE, so the getBaseURL gets executed, and the listener is removed. If I call the getUploadURL method and put the wrong path, I do not get an Event.COMPLETE but some other event, and getBaseURL should not be executed. That is the correct behavior in FireFox. In IE, it looks like the load() method does not actually call the server, it jumps directly to the getBaseURL() for the Event.COMPLETE. I checked the willTrigger() and hasEventListener() on _loader before assigning the new URLLoader, and it turns out the event has been well removed. I hope I make sense, I simplified my code. To sum up quickly: in FireFox it works well, but in IE, the first call will work but the second call won't really call the .load() method; it seems it uses the previously stored result from the first call. I hope someone can please help me, Thank you, Rudy

  Read the article

• How to check for mip-map availability in OpenGL?

  - by Xavier Ho

  Recently I bumped into a problem where my OpenGL program would not render textures correctly on a 2-year-old Lenovo laptop with an nVidia Quadro 140 card. It runs OpenGL 2.1.2, and GLSL 1.20, but when I turned on mip-mapping, the whole screen is black, with no warnings or errors. This is my texture filter code: glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR_MIPMAP_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_GENERATE_MIPMAP, GL_TRUE); After 40 minutes of fiddling around, I found out mip-mapping was the problem. Turning it off fixed it: // glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR_MIPMAP_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); // glTexParameteri(GL_TEXTURE_2D, GL_GENERATE_MIPMAP, GL_TRUE); I get a lot of aliasing, but at least the program is visible and runs fine. Finally, two questions: What's the best or standard way to check if mip-mapping is available on a machine, aside from checking OpenGL versions? If mip-mapping is not available, what's the best work-around to avoid aliasing?

  Read the article

< Previous Page | 298 299 300 301 302 303 304 305 306 307 308 309  | Next Page >