Search Results

Search found 9545 results on 382 pages for 'least privilege'.

Page 302/382 | < Previous Page | 298 299 300 301 302 303 304 305 306 307 308 309  | Next Page >

• How do I create a Status Icon / System Tray Icon with custom text and transparent background using P

  - by Raugturi

  Here is the code that I have so far to define the icon: icon_bg = gtk.gdk.pixbuf_new_from_file('gmail.png') w, h = icon_bg.get_width(), icon_bg.get_height() cmap = gtk.gdk.Colormap(gtk.gdk.visual_get_system(), False) drawable = gtk.gdk.Pixmap(None, w, h, 24) drawable.set_colormap = cmap gc = drawable.new_gc() drawable.draw_pixbuf(gc, icon_bg, 0, 0, 0, 0, w, h) drawn_icon = gtk.gdk.Pixbuf(gtk.gdk.COLORSPACE_RGB, False, 8, w, h) drawn_icon.get_from_drawable(drawable, cmap, 0, 0, 0, 0, w, h) icon = gtk.status_icon_new_from_pixbuf(drawn_icon) This works to get the png into the icon, but falls short in two areas. First, transparency is not working. If I use a 22x22 png with transparent background and the image centered, I end up with sections of other active icons showing up inside of mine, like this: http://i237.photobucket.com/albums/ff311/Raugturi/22x22_image_with_transparency.png The icon it choose to steal from is somewhat random. Sometimes it's part of the dropbox icon, others the NetworkManager Applet. If I instead use this code: icon_bg = gtk.gdk.pixbuf_new_from_file('gmail.png') w, h = icon_bg.get_width(), icon_bg.get_height() cmap = gtk.gdk.Colormap(gtk.gdk.visual_get_system(), False) drawable = gtk.gdk.Pixmap(None, w, h, 24) drawable.set_colormap = cmap gc = drawable.new_gc() drawable.draw_pixbuf(gc, icon_bg, 0, 0, 0, 0, w, h) drawn_icon = gtk.gdk.Pixbuf(gtk.gdk.COLORSPACE_RGB, False, 8, 22, 22) drawn_icon.get_from_drawable(drawable, cmap, 0, 0, 3, 6, w, h) icon = gtk.status_icon_new_from_pixbuf(drawn_icon) And an image that is only 16x11 with the transparent edges removed, what I end up with is this: Same URL but file is 16x11_image_positioned_in_middle.png So how do I end up with a transparent block like the 1st one that doesn't pull in stuff from other icons? As for the second problem, I need the ability to write on the image before converting it to the icon. I tried using draw_glyphs and it told me I should be using Pango layout/context instead. Unfortunately all the Pango tutorials I could find deal with actual windows, not the status icon. Is there a good tutorial out there for Pango that would apply to this issue (and also maybe have at least some explanation of how to tell it what font to use as all of them that I found seem to lack this and it won't write anything without it). Note: Sorry for the lack of actual images and only one working link, apparently this is a spam prevention feature due to my lack of reputation.

  Read the article

• IE 8 remove line break between nodes with JavaScript

  - by Tokimon

  Ok i have a list of HTML nodes which should be inline with no spacing between them. The problem is, that the nodes are written from a CMS and therefore will come with all sorts of linebreaks and spaces. Therefore I'm removing the spaces with JS using the method descibed in this question. The problem is, however, that in IE (not 9) the white spaces isn't part of the childrens list of the parent node, rendering the method useless in IE. However IE 7 (or at least IE 9 emulating IE 7) ignores the linebreaks, so that one is in the clear. That leaves IE 8 as the troublemaker. I discovered that the line break is actually a part of the outerHTML and that a simple reset of the outerHTML did the trick - like so: node.outerHTML = node.outerHTML However this will reset the node intirely and therefore removing all events and other settings on the node, which isn't really any good. So my question is now: Is there a way to remove that linebreak from the nodes outerHTML whitout resetting the node? I've tried with zoom: 1, but to no avail. Hope anyone has any experience with this.

  Read the article

• Sql Server Compact Edition version error.

  - by Tim

  I am working on .NET ClickOnce project that uses Sql Server 2005 Compact Edition to synchronize remote data through the use of a Merge replication. This application has been live for nearly a year now, and while we encounter occasional synchronization errors, things run quite smoothly for the most part. Yesterday a user reported an error that I have never seen before and have yet to find any information for online. Many users synchronize every night, and I haven't received error reports from anyone else, so this issue must be isolated to this particular user / client machine. Here are the full details of the error: -Error Code : 80004005 -Message : The message contains an unexpected replication operation code. The version of SQL Server Compact Edition Client Agent and SQL Server Compact Edition Server Agent should match. [ replication operation code = 31 ] -Minor Error : 28526 -Source : Microsoft SQL Server Compact Edition -Numeric Parameters : 31 One interesting thing that I've found is that his data does get synchronized to the server, so this error must occur after the upload completes. I have yet to determine whether or not changes at the server are still being downloaded to his subscription. Thinking that maybe there was some kind of version conflict going on, I had a remote desktop session with this user last night and uninstalled both the application and the SQL Server Compact Edition prerequisite, then reinstalled both from our ClickOnce publication site. I also removed his existing local database file so that upon synchronization, an entirely new subscription would be issued to him. Still his errors continue. I suppose the error may be somewhat general, and the text in the error message stating that the versions should match may not necessarily reflect the problem at hand. This site contains the only official reference to this error that I've been able to find, and it offers no more detail than the error message itself. Has anyone else encountered this error? Or at least know more about SQL Compact to have a better guess as to what is going on here? Any help / suggestions will be greatly appreciated!

  Read the article

• Cursor returns zero rows from query to table

  - by brockoli

  I've created an SQLiteDatabase in my app and populated it with some data. I can connect to my AVD with a terminal and when I issue select * from articles; I get a list of all the rows in my table and everything looks fine. However, in my code when I query my table, I get a cursor back that has my tables columns, but zero rows of data. Here is my code.. mDbHelper.open(); Cursor articles = mDbHelper.fetchAllArticles(); startManagingCursor(articles); Cursor feeds = mDbHelper.fetchAllFeeds(); startManagingCursor(feeds); mDbHelper.close(); int titleColumn = articles.getColumnIndex("title"); int feedIdColumn = articles.getColumnIndex("feed_id"); int feedTitleColumn = feeds.getColumnIndex("title"); /* Check if our result was valid. */ if (articles != null) { int count = articles.getCount(); /* Check if at least one Result was returned. */ if (articles.moveToFirst()) { In the above code, my Cursor articles returns with my 4 columns, but when I call getCount() it returns zero, even though I can see hundreds of rows of data in that table from command line. Any idea what I might be doing wrong here? Also.. here is my code for fetchAllArticles.. public Cursor fetchAllArticles() { return mDb.query(ARTICLES_TABLE, new String[] {ARTICLE_KEY_ROWID, ARTICLE_KEY_FEED_ID, ARTICLE_KEY_TITLE, ARTICLE_KEY_URL}, null, null, null, null, null); } Rob W.

  Read the article

• Validate HAML from ActiveRecord: scope/controller/helpers for link_to etc?

  - by Chris Boyle

  I like HAML. So much, in fact, that in my first Rails app, which is the usual blog/CMS thing, I want to render the body of my Page model using HAML. So here is app/views/pages/_body.html.haml: .entry-content= Haml::Engine.new(body, :format => :html5).render ...and it works (yay, recursion). What I'd like to do is validate the HAML in the body when creating or updating a Page. I can almost do that, but I'm stuck on the scope argument to render. I have this in app/models/page.rb: validates_each :body do |record, attr, value| begin Haml::Engine.new(value, :format => :html5).render(record) rescue Exception => e record.errors.add attr, "line #{(e.respond_to? :line) && e.line || 'unknown'}: #{e.message}" end end You can see I'm passing record, which is a Page, but even that doesn't have a controller, and in particular doesn't have any helpers like link_to, so as soon as a Page uses any of that it's going to fail to validate even when it would actually render just fine. So I guess I need a controller as scope for this, but accessing that from here in the model (where the validator is) is a big MVC no-no, and as such I don't think Rails gives me a way to do it. (I mean, I suppose I could stash a controller in some singleton somewhere or something, but... excuse me while I throw up.) What's the least ugly way to properly validate HAML in an ActiveRecord validator?

  Read the article

• iPodMusicPlayer playbackState inaccurate after odd conditions

  - by Shane Costello

  I have a simple music player app that runs into a really weird problem. First of all, while playing music and in the locked state, I allow the user to double click the Home button and use the locked iPod music controls. I did notice however that while in the locked state, my app doesn't receive any of its registered notifications. For the most part, this is fine anyway. But, if the user is playing music for at least 15 minutes (I'm not sure why but any less and this problem doesn't occur) while in the locked state, and using some kind of headphone or aux jack, then unplugs the headphone/aux jack while the device is still playing music, the iPodMusicPlayer will auto-pause. Which is exactly what I would want it to do, but after this happens, when the user unlocks their device and gives focus to the app again, the iPodMusicPlayer's playbackState is inaccurate. - (IBAction)playPause:(id)sender { if ([musicPlayer playbackState] == MPMusicPlaybackStatePlaying) { [musicPlayer pause]; } else { [musicPlayer play]; } } where musicPlayer = [MPMusicPlayerController iPodMusicPlayer]. Under normal circumstances, this runs perfectly fine. But after these conditions, my breakpoint will hit the condition for MPMusicPlaybackStatePlaying while the music is paused, and vice versa. The only way I've been able to fix this is to either make a new selection of music or to terminate the app and reopen. I've tried tons of a workarounds to fix this problem programmatically, but nothing turns out a 100% bug free fix. Does anyone have any clue as to why this happens in the first place?

  Read the article

• Compiling a Windows C++ program in g++

  - by Phenom

  I'm trying to compile a Windows C++ program in g++. This is what I get. /usr/include/c++/4.4/backward/backward_warning.h:28:2: warning: #warning This file includes at least one deprecated or antiquated header which may be removed without further notice at a future date. Please use a non-deprecated interface with equivalent functionality instead. For a listing of replacement headers and interfaces, consult the file backward_warning.h. To disable this warning use -Wno-deprecated. btree.cpp:1204: error: ‘_TCHAR’ has not been declared btree.cpp: In function ‘int _tmain(int, int**)’: btree.cpp:1218: error: ‘__int64’ was not declared in this scope btree.cpp:1218: error: expected ‘;’ before ‘frequency’ btree.cpp:1220: error: ‘LARGE_INTEGER’ was not declared in this scope btree.cpp:1220: error: expected primary-expression before ‘)’ token btree.cpp:1220: error: ‘frequency’ was not declared in this scope btree.cpp:1220: error: ‘QueryPerformanceFrequency’ was not declared in this scope btree.cpp:1262: error: expected primary-expression before ‘)’ token btree.cpp:1262: error: ‘start’ was not declared in this scope btree.cpp:1262: error: ‘QueryPerformanceCounter’ was not declared in this scope btree.cpp:1264: error: name lookup of ‘i’ changed for ISO ‘for’ scoping btree.cpp:1264: note: (if you use ‘-fpermissive’ G++ will accept your code) btree.cpp:1304: error: expected primary-expression before ‘)’ token btree.cpp:1304: error: ‘end’ was not declared in this scope btree.cpp:1306: error: ‘total’ was not declared in this scope btree.cpp:1316: error: ‘getchar’ was not declared in this scope The first thing I noticed is that there are these variable types called _TCHAR, _int64, and LARGE_INTEGER, which is probably a Windows thing. What can these be changed to so that they will work in g++? Also, if there's anything else in here that you know can be converted to g++, that would be helpful. I got the code from here: http://touc.org/btree.html

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• URLLoader.load() issue when using the same URLRequest

  - by Rudy

  Hello, I have an issue with my eventListeners with the URLLoader, but this issue happens in IE, not in FF. public function getUploadURL():void { var request:URLRequest = new URLRequest(); request.url = getPath(); request.method = URLRequestMethod.GET; _loader = new URLLoader(); _loader.dataFormat = URLLoaderDataFormat.TEXT; _loader.addEventListener(Event.COMPLETE, getBaseURL); _loader.load(request); } private function getBaseURL(event:Event):void { _loader.removeEventListener(Event.COMPLETE, getBaseURL); } The issue is that my getBaseURL gets executed automatically after I have executed the code at least once, but that is the case only in IE. What happens is I call my getUploadURL, I make sure the server sends an event that will result in an Event.COMPLETE, so the getBaseURL gets executed, and the listener is removed. If I call the getUploadURL method and put the wrong path, I do not get an Event.COMPLETE but some other event, and getBaseURL should not be executed. That is the correct behavior in FireFox. In IE, it looks like the load() method does not actually call the server, it jumps directly to the getBaseURL() for the Event.COMPLETE. I checked the willTrigger() and hasEventListener() on _loader before assigning the new URLLoader, and it turns out the event has been well removed. I hope I make sense, I simplified my code. To sum up quickly: in FireFox it works well, but in IE, the first call will work but the second call won't really call the .load() method; it seems it uses the previously stored result from the first call. I hope someone can please help me, Thank you, Rudy

  Read the article

• Making a table in a scrolling div resizable?

  - by Mason Jones

  I've got a table in a div, with a vertical scrollbar on the div to allow the table to be longer than the div can hold. Works fine. But I'd like to allow the user to resize the div vertically if they want to be able to view more of the table. I've been playing with the jQueryUI resizable interaction, but it doesn't seem to quite do what I want; at least, not so far. I've tried making the wrapper div resizable, but the behavior's erratic. If I have the style "height:20em; overflow:auto;" on it, then I can resize the table horizontally, but not vertically. If I remove the overflow, then the table flows outside the div of course. If I remove the height, then the table is actually resizable, but it is initially drawn at full height. Anyone know of a way to specify an initial height, but allow it to be resized larger than that? If I make the table resizable rather than the div, then I can resize the table horizontally within the div but I can't increase the height of the displayed table. Which makes sense, of course, but I thought I'd mention it. Also, is there a way to make the resize "handle" the corner between the horizontal and vertical scrollbars? Right now it's a sort of invisible handle in the bottom-right of the table. Thanks for any thoughts.

  Read the article

• Need help with strange Class#getResource() issue

  - by Andreas_D

  I have some legacy code that reads a configuration file from an existing jar, like: URL url = SomeClass.class.getResource("/configuration.properties"); // some more code here using url variable InputStream in = url.openStream(); Obviously it worked before but when I execute this code, the URL is valid but I get an IOException on the third line, saying it can't find the file. The url is something like "file:jar:c:/path/to/jar/somejar.jar!configuration.properties" so it doesn't look like a classpath issue - java knows pretty well where the file can be found.. The above code is part of an ant task and it fails while the task is executed. Strange enough - I copied the code and the jar file into a separate class and it works as expected, the properties file is readable. At some point I changed the code of the ant task to URL url = SomeClass.class.getResource("/configuration.properties"); // some more code here using url variable InputStream in = SomeClass.class.getResourceAsStream("/configuration.properties"); and now it works - just until it crashes in another class where a similiar access pattern is implemented.. Why could it have worked before, why does it fail now? The only difference I see at the moment is, that the old build was done with java 1.4 while I'm trying it with Java 6 now. Workaround Today I installed Java 1.4.2_19 on the build server and made ant to use it. To my totally frustrating surprise: The problem is gone. It looks to me, that java 1.4.2 can handle URLs of this type while Java 1.6 can't (at least in my context/environment). I'm still hoping for an explanation although I'm facing the work to rewrite parts of the code to use Class#getRessourceAsStream which behaved much more stable...

  Read the article

• jCarousel - achieving an active state AND wrap:circular

  - by swisstony

  Hey folks A while back I implemented the jCarousel image solution for a client that required a numbered active state. After a bit of googling a found the answer but noticed that the preferred circular option would not work. What would happen is that once the carousel had cycled through all its (5) images, upon the return to the first, the active state would be lost, because, according to jcarousel it was actually the 6th (the index just keeps on incrementing). I just went ahead and instead used wrap:'both' which at least had a correctly functioning active state. However now the client says they dont like this effect and simply want the animation to return to position 1 after the final image. This means I need to get'wrap: 'both' working somehow. Below is my current code. Can someone please solve this one, as its a little above my head! function highlight(carousel, obejctli,liindex,listate){ jQuery('.jcarousel-control a:nth-child('+ liindex +')').attr("class","active"); }; function removehighlight(carousel, obejctli,liindex,listate){ jQuery('.jcarousel-control a:nth-child('+ liindex +')').removeAttr("class","active"); }; jQuery('#mycarousel').jcarousel({ initCallback: mycarousel_initCallback, auto: 5, wrap: 'both', vertical: true, scroll: 1, buttonNextHTML: null, buttonPrevHTML: null, animation: 1000, itemVisibleInCallback: highlight, itemVisibleOutCallback: removehighlight }); }); Thanks in advance

  Read the article

• Exception calling UpdateModel - Value cannot be null or empty

  - by James Alexander

  This is probably something silly I'm missing but I'm definitely lost. I'm using .NET 4 RC and VS 2010. This is also my first attempt to use UpdateModel in .NET 4, but every time I call it, I get an exception saying Value cannont be null or empty. I've got a simple ViewModel called LogOnModel: [MetadataType(typeof(LogOnModelMD))] public class LogOnModel { public string Username { get; set; } public string Password { get; set; } public class LogOnModelMD { [StringLength(3), Required] public object Username { get; set; } [StringLength(3), Required] public object Password { get; set; } } } My view uses the new strongly typed helpers in MVC2 to generate a textbox for username and one for the password. When I look at FormCollection in my controller method, I see values for both coming through. And last but not least, here's are post controller methods: // POST: /LogOn/ [HttpPost] public ActionResult Index(FormCollection form) { var lm = new LogOnModel(); UpdateModel(lm, form); var aservice = new AuthenticationService(); if (!aservice.AuthenticateLocal(lm.Username, lm.Password)) { ModelState.AddModelError("User", "The username or password submitted is invalid, please try again."); return View(lm); } return Redirect("~/Home"); } Can someone please lend some insight into why UpdateModel would be throwing this exception? Thanks!

  Read the article

• White Screen of Death (WSOD) in Browser

  - by nickyt

  Here's the specs: ASP.NET 3.5 using ASP.NET AJAX AJAX Control Toolkit jQuery 1.3.2 web services IIS6 on Windows Server 2003 SP1 SP1 SQLServer 2005 SP3 Site is SSL Here's the problem: I'm getting the White Screen of Death (WSOD) in pretty much any browser (at least FireFox and IE 7/8). We have an application that uses one popup window for updating records. Most of the time when you click on the [Edit] button to edit a record, the popup window opens and loads the update page. However, after editing records for a while, all of a sudden the popup window will open, but it stays blank and just hangs. The URL is in the address bar. Loading up Fiddler I noticed that the request for the update page is never sent which leads me to believe it's some kind of lockup on the client-side. If I copy the same URL that's in the popup window into a new browser window, the page generally loads fine. Observations: - Since the request is never sent to the server, it's definitely something client-side - Only appears to happen when there is some semblance of traffic on the site which is weird because this appears to be contained within client-side code - There is a web service being called in the background every few seconds checking if the user is logged on, but this doesn't cause the freeze. I'm really at a loss here. I've googled WSOD but not much seems to appear related to my specific WSOD. Any ideas?

  Read the article

• Visual Studio and .NET programming

  - by Vit

  Hi, I just want to ask wheather I am right or not about .NET. So, .NET is new framework that enables you to easily implement new and old windows functions. It is similiar to java in the way that its also compiled into "bytecode", but its name is Common Language Infrastructure, or CLI. This language is interpreted by .NET Framework, so code generated by programming using .NET cannot be executed directly by CPU. Now, few languages can be compiled to CLI. First, it was Microsoft-developed C#, than J#, C++ others. I suspect that this is in general right, at least I hope I understand it right. But, what I am still missing is, can you write to machine code compiled code in C#? And, if using Visual Studio 2005, when I select Win32 project, it is compiled into machine code, so only thing you need to run this apps are windows dynamic-link libraries, since static libraries code is implemented into app durink linking phase. And those dynamic-link libraries are implemented in every windows installation, or provided by DirectX installations. But when I select CLR in Visual Studio 2005, than app is compiled into CLI code, and it first executes .NET framework, and than .NET framework executes that program, since its not in machine code. So, I am right? I ask becouse you can read these infos on the internet, but I have noone to tell me wheather I understand it right or not. Thanks.

  Read the article

• Kohana Sessions data does not persist across pages in chrome and ir browsers

  - by user1062637

  Kohana Session data does not persist across pages opened in Chrome and IE browsers the same works fine in a Firefox browser Kohana version used is 2.3 session config files hold $config['driver'] = 'native'; /** * Session storage parameter, used by drivers. */ $config['storage'] = ''; /** * Session name. * It must contain only alphanumeric characters and underscores. At least one letter must be present. */ $config['name'] = 'NITWSESSID'; /** * Session parameters to validate: user_agent, ip_address, expiration. */ $config['validate'] = array(); /** * Enable or disable session encryption. * Note: this has no effect on the native session driver. * Note: the cookie driver always encrypts session data. Set to TRUE for stronger encryption. */ $config['encryption'] = FALSE; /** * Session lifetime. Number of seconds that each session will last. * A value of 0 will keep the session active until the browser is closed (with a limit of 24h). */ $config['expiration'] = 2700; /** * Number of page loads before the session id is regenerated. * A value of 0 will disable automatic session id regeneration. */ $config['regenerate'] = 0; /** * Percentage probability that the gc (garbage collection) routine is started. */ $config['gc_probability'] = 2; Help needed urgently

  Read the article

• CORBA on MacOS X (Cocoa)

  - by user8472

  I am currently looking into different ways to support distributed model objects (i.e., a computational model that runs on several different computers) in a project that initially focuses on MacOS X (using Cocoa). As far as I know there is the possibility to use the class cluster around NSProxy. But there also seem to be implementations of CORBA around with Objective-C support. At a later time there may be the need to also support/include Windows machines. In that case I would need to use something like Gnustep on the Windows side (which may be an option, if it works well) or come up with a combination of both technologies. Or write something manually (which is, of course, the least desirable option). My questions are: If you have experience with both technologies (Cocoa native infrastructure vs. CORBA) can you point out some key features/issues of either approach? Is it possible to use Gnustep with Cocoa in the way explained above? Is it possible (and reasonably feasible, i.e. simpler than writing a network layer manually) to communicate among all MacOS clients using Cocoa's technology and with Windows clients through CORBA?

  Read the article

• What caused the rails application crash?

  - by so1o

  I'm sure someone can explain this. we have an application that has been in production for an year. recently we saw an increase in number of support requests for people having difficulty signing into the system. after scratching our head because we couldn't recreate the problem in development, we decided we'll switch on debug logger in production for a month. that was june 5th. application worked fine with the above change and we were waiting. then yesterday we noticed that the log files were getting huge so we made another change in production config.logger = Logger.new("#{RAILS_ROOT}/log/production.log", 50, 1048576) after this change, the application started crashing while processing a particular file. this particular line of code was RAILS_DEFAULT_LOGGER.info "Payment Information Request: ", request.inspect as you can see there was a comma instead of a plus sign. this piece of code was introduced in Mar. the question is this: why did the application fail now? if changing the debug level caused the application to process this line of code it should have started failing on june 5th! why today. please someone help us. Are we missing the obvious here? if you dont have an answer, at least let us know we aren't the only one that are bonkers.

  Read the article

• Why not put all braces inline in C++/C#/Java/javascript etc.?

  - by DanM

  Of all the conventions out there for positioning braces in C++, C#, Java, etc., I don't think I've ever seen anyone try to propose something like this: public void SomeMethod(int someInput, string someOtherInput) { if (someInput > 5) { var addedNumber = someInput + 5; var subtractedNumber = someInput - 5; } else { var addedNumber = someInput + 10; var subtractedNumber = someInput; } } public void SomeOtherMethod(int someInput, string someOtherInput( { ... } But why not? I'm sure it would take some getting used to, but I personally don't have any difficulty following what's going on here. I believe indentation is the dominant factor in being able to see how code is organized into blocks and sub-blocks. Braces are just visual noise to me. They are these ugly things that take up lines where I don't want them. Maybe I just feel that way because I was weened on basic (and later VB), but I just don't like braces taking up lines. If I want a gap between blocks, I can always add an empty line, but I don't like being forced to have gaps simply because the convention says the closing brace needs to be on its own line. I made this a community wiki because I realize this is not a question with a defined answer. I'm just curious what people think. I know that no one does this currently (at least, not that I've seen), and I know that the auto-formatter in my IDE doesn't support it, but are there are any other solid reasons not to format code this way, assuming you are working with a modern IDE that color codes and auto-indents? Are there scenarios where it will become a readability nightmare? Better yet, are you aware of any research on this?

  Read the article

• How to check for mip-map availability in OpenGL?

  - by Xavier Ho

  Recently I bumped into a problem where my OpenGL program would not render textures correctly on a 2-year-old Lenovo laptop with an nVidia Quadro 140 card. It runs OpenGL 2.1.2, and GLSL 1.20, but when I turned on mip-mapping, the whole screen is black, with no warnings or errors. This is my texture filter code: glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR_MIPMAP_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_GENERATE_MIPMAP, GL_TRUE); After 40 minutes of fiddling around, I found out mip-mapping was the problem. Turning it off fixed it: // glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR_MIPMAP_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MIN_FILTER, GL_LINEAR); glTexParameteri(GL_TEXTURE_2D, GL_TEXTURE_MAG_FILTER, GL_LINEAR); // glTexParameteri(GL_TEXTURE_2D, GL_GENERATE_MIPMAP, GL_TRUE); I get a lot of aliasing, but at least the program is visible and runs fine. Finally, two questions: What's the best or standard way to check if mip-mapping is available on a machine, aside from checking OpenGL versions? If mip-mapping is not available, what's the best work-around to avoid aliasing?

  Read the article

• How do I create a simple Windows form to access a SQL Server database?

  - by NoCatharsis

  I believe this is a very novice question, and if I'm using the wrong forum to ask, please advise. I have a basic understanding of databasing with MS SQL Server, and programming with C++ and C#. I'm trying to teach myself more by setting up my own database with MS SQL Server Express 2008 R2 and accessing it via Windows forms created in C# Express 2010. At this point, I just want to keep it to free or Express dev tools (not necessarily Microsoft though). Anyway, I created a database using the instructions provided here and I set the data types appropriately for each column (no errors in setup at least). Now I'm designing the GUI in C# Express but I've kind of hit a wall as far as the database connection. Is there a simple way to access the database I created locally using C# Express? Can anyone suggest a guide that has all this spelled out already? I am a self-learner so I look forward to teaching myself how to use these applications, but any pointers to start me off in the right direction would be greatly appreciated.

  Read the article

• How to use a VB usercontrol on a C# page?

  - by ks78

  Hopefully someone will be able to point me in the right direction. I've created a usercontrol in VB that handles paging more efficiently than the DataPager (at least for very large datasets). I'd like to use it in a C# project, but I've been having trouble getting it to work. I've tried simply adding PagingControl.ascx to the C# project, but when I do that the markup and VB code behind don't seem to see each other. --Is this a namespace issue? I've tried adding the PagingControl.ascx to its own VB project, then adding that project to the C# project's solution, as well as a reference. --That almost works. I can register the PagingControl usercontrol in the markup. I can access the usercontrol's properties in the code behind, but any property that involves the UI of the usercontrol fails. Its seems as if the usercontrol's form hasn't had a chance to load by the time the C# page's Page_Load event handler fires. --Maybe this is an "order of operations" problem? At what point in the C# page's lifetime should a usercontrol's form be loaded? If anyone has any ideas or insight, I'd really appreciate it. Thanks in advance.

  Read the article

• What makes good web form styling for business applications?

  - by ProfK

  Styling forms (form elements) is something that even Eric Meyer prefers to avoid. However, most business forms, and that is where styling is at issue; 'contact us' forms are easy to style, put window estate at a premium, with more 'document level' (e.g. invoice) fields, plus 'detail level' (e.g. invoice line) fields. Factors I often find at play are: At my minimum, at least two horizontally adjacent fieldsets are required. In applications vs. public web pages, fixed positioning vs fluid layout is often better. Quantity of content is important, vs. exaggerated readability. Users know the system, and cues etc. take a back seat. In light of factors like these, is there any available guidence for styling web form based applications? Are there any CSS or JavaScript frameworks that would make my quest to style these applications better than Visual Studios still pathetic 'Auto-format' (what drugs were those people on? I will never take them.)

  Read the article

• Behavior of local variables in JavaScripts with()-statement

  - by thr

  I noticed some weird (and to my knowledge undefined behavior, by the ECMA 3.0 Spec at least), take the following snippet: var foo = { bar: "1", baz: "2" }; alert(bar); with(foo) { alert(bar); alert(bar); } alert(bar); It crashes in both Firefox and Chrome, because "bar" doesn't exist in the first alert(); statement, this is as expected. But if you add a declaration of bar inside the with()-statement, so it looks like this: var foo = { bar: "1", baz: "2" }; alert(bar); with(foo) { alert(bar); var bar = "g2"; alert(bar); } alert(bar); It will produce the following: undefined, 1, g2, undefined It seems as if you create a variable inside a with()-statement most browsers (tested on Chrome or Firefox) will make that variable exist outside that scope also, it's just set to undefined. Now from my perspective bar should only exist inside the with()-statement, and if you make the example even weirder: var foo = { bar: "1", baz: "2" }; var zoo; alert(bar); with(foo) { alert(bar); var bar = "g2"; zoo = function() { return bar; } alert(bar); } alert(bar); alert(zoo()); It will produce this: undefined, 1, g2, undefined, g2 So the bar inside the with()-statement does not exist outside of it, yet the runtime somehow "automagically" creates a variable named bar that is undefined in its top level scope (global or function) but this variable does not refer to the same one as inside the with()-statement, and that variable will only exist if a with()-statement has a variable named bar that is defined inside it. Very weird, and inconsistent. Anyone have an explanation for this behavior? There is nothing in the ECMA Spec about this.

  Read the article

• Java Executor: Small tasks or big ones?

  - by Arash Shahkar

  Consider one big task which could be broken into hundreds of small, independently-runnable tasks. To be more specific, each small task is to send a light network request and decide upon the answer received from the server. These small tasks are not expected to take longer than a second, and involve a few servers in total. I have in mind two approaches to implement this using the Executor framework, and I want to know which one's better and why. Create a few, say 5 to 10 tasks each involving doing a bunch of send and receives. Create a single task (Callable or Runnable) for each send & receive and schedule all of them (hundreds) to be run by the executor. I'm sorry if my question shows that I'm lazy to test these and see for myself what's better (at least performance-wise). My question, while looking after an answer to this specific case, has a more general aspect. In situations like these when you want to use an executor to do all the scheduling and other stuff, is it better to create lots of small tasks or to group those into a less number of bigger tasks?

  Read the article

< Previous Page | 298 299 300 301 302 303 304 305 306 307 308 309  | Next Page >