Search Results

Search found 8391 results on 336 pages for 'partial hash arguments'.

Page 304/336 | < Previous Page | 300 301 302 303 304 305 306 307 308 309 310 311  | Next Page >

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • asp.net custom templated datalist - throws argument out of range (index) on button press

    - by MrTortoise
    I have a class BaseTemplate public abstract class BaseTemplate : ITemplate This adds the controls, and provides abstract methods to implement in the inheriting class. The inheriting class then adds its html according to its data source and manages the data binding. this all works fine - I get the control appearing with properly parsed html. the problem is that the base class adds controls into the template that have their own CommandName arguments ... the idea is that the class that implements the custom templated dataList will provide the logic of setting the Selected and Edit Indexes. This class also manages the data binding etc. It sets all of the templates ont he datalist in the Init method (which was another cause of this exception). the exception gets throw when i hit one of these buttons .. but after the ItemCommand event is being processed. The stack trace does not include any references to my methods or objects which is why i am so stuck. The Exception Details Exception Details: System.ArgumentOutOfRangeException: Specified argument was out of the range of valid values. Parameter name: index The Stack Trace: [ArgumentOutOfRangeException: Specified argument was out of the range of valid values. Parameter name: index] System.Web.UI.ControlCollection.get_Item(Int32 index) +8665582 System.Web.UI.WebControls.DataList.GetItem(ListItemType itemType, Int32 repeatIndex) +8667655 System.Web.UI.WebControls.DataList.System.Web.UI.WebControls.IRepeatInfoUser.GetItemStyle(ListItemType itemType, Int32 repeatIndex) +11 System.Web.UI.WebControls.RepeatInfo.RenderVerticalRepeater(HtmlTextWriter writer, IRepeatInfoUser user, Style controlStyle, WebControl baseControl) +8640873 System.Web.UI.WebControls.RepeatInfo.RenderRepeater(HtmlTextWriter writer, IRepeatInfoUser user, Style controlStyle, WebControl baseControl) +27 System.Web.UI.WebControls.DataList.RenderContents(HtmlTextWriter writer) +208 System.Web.UI.WebControls.BaseDataList.Render(HtmlTextWriter writer) +30 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +134 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +19 System.Web.UI.HtmlControls.HtmlForm.RenderChildren(HtmlTextWriter writer) +163 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +32 System.Web.UI.HtmlControls.HtmlForm.Render(HtmlTextWriter output) +51 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.HtmlControls.HtmlForm.RenderControl(HtmlTextWriter writer) +40 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +134 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +19 System.Web.UI.Page.Render(HtmlTextWriter writer) +29 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +27 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +99 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +25 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1266 This is driving me absolutley stark raving bonkers ... im talking cthulu style.

    Read the article

  • ASP.NET MVC : Good Replacement for User Control?

    - by David Lively
    I found user controls to be incredibly useful when working with ASP.NET webforms. By encapsulating the code required for displaying a control with the markup, creation of reusable components was very straightforward and very, very useful. While MVC provides convenient separation of concerns, this seems to break encapsulation (ie, you can add a control without adding or using its supporting code, leading to runtime errors). Having to modify a controller every time I add a control to a view seems to me to integrate concerns, not separate them. I'd rather break the purist MVC ideology than give up the benefits of reusable, packaged controls. I need to be able to include components similar to webforms user controls throughout a site, but not for the entire site, and not at a level that belongs in a master page. These components should have their own code not just markup (to interact with the business layer), and it would be great if the page controller didn't need to know about the control. Since MVC user controls don't have codebehind, I can't see a good way to do this. Update FINALLY, a good (and, in retrospect, obvious) way to accomplish this. using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.Mvc; namespace K.ObjectModel.Controls { public class TestControl : ViewUserControl { protected override void Render(System.Web.UI.HtmlTextWriter writer) { writer.Write("Hello World"); base.Render(writer); } } } Create a new class which inherits ViewUserControl Override the .Render() method as shown above. Register the control via its associated ASCX as you would in a webForm: <%@ Register TagName="tn" TagPrefix="k" Src="~/Views/Navigation/LeftBar.ascx"%> Use the corresponding tag in whatever view or master page that you need: <k:tn runat="server"/> Make sure your .ascx inherits your new control: <%@ Control Language="C#" Inherits="K.ObjectModel.Controls.TestControl" %> Voila, you're up and running. This is tested with ASP.NET MVC 2, VS 2010 and .NET 4.0. Your custom tag references the ascx partial view, which inherits from the TestControl class. The control then overrides the Render() method, which is called to render the view, giving you complete control over the process from tag to output. Why does everyone try to make this so much harder than it has to be?

    Read the article

  • Registry Problem

    - by Dominik
    I made a launcher for my game server. (World of Warcraft) I want to get the installpath of the game, browsed by the user. I'm using this code to browse, and get the installpath, then set some other strings from the installpath string, then just strore in my registry key. using System; using System.Drawing; using System.Reflection; using System.Collections; using System.ComponentModel; using System.Windows.Forms; using System.Data; using Microsoft.Win32; using System.IO; using System.Net.NetworkInformation; using System.Diagnostics; using System.Runtime; using System.Runtime.InteropServices; using System.Security; using System.Security.Cryptography; using System.Text; using System.Net; using System.Linq; using System.Net.Sockets; using System.Collections.Generic; using System.Threading; namespace WindowsFormsApplication1 { public partial class Form1 : Form { public Form1() { InitializeComponent(); } string InstallPath, WoWExe, PatchPath; private void Form1_Load(object sender, EventArgs e) { RegistryKey LocalMachineKey_Existence; MessageBox.Show("Browse your install location.", "Select Wow.exe"); OpenFileDialog BrowseInstallPath = new OpenFileDialog(); BrowseInstallPath.Filter = "wow.exe|*.exe"; if (BrowseInstallPath.ShowDialog() == DialogResult.OK) { InstallPath = System.IO.Path.GetDirectoryName(BrowseInstallPath.FileName); WoWExe = InstallPath + "\\wow.exe"; PatchPath = InstallPath + "\\Data\\"; LocalMachineKey_Existence = Registry.LocalMachine.CreateSubKey(@"SOFTWARE\ExistenceWoW"); LocalMachineKey_Existence.SetValue("InstallPathLocation", InstallPath); LocalMachineKey_Existence.SetValue("PatchPathLocation", PatchPath); LocalMachineKey_Existence.SetValue("WoWExeLocation", WoWExe); } } } } The problem is: On some computer, it doesnt stores like it should be. For example, your wow.exe is in C:\ASD\wow.exe, your select it with the browse windows, then the program should store it in the Existence registry key as C:\ASD\Data\ but it stores like this: C:\ASDData , so it forgots a backslash :S Look at this picture: http://img21.imageshack.us/img21/2829/regedita.jpg My program works cool on my PC, and on my friends pc, but on some pc this "bug" comes out :S I have windows 7, with .NEt 3.5 Please help me.

    Read the article

  • How to get Firefox to not continue to show "Transferring data from..." in browser status bar after a

    - by Edward Tanguay
    The following silverlight demo loads and displays a text file from a server. However, in Firefox (but not Explorer or Chrome) after you click the button and the text displays, the status bar continues to show "Transferring data from test.development..." which erroneously gives the user the belief that something is still loading. I've noticed that if you click on another Firefox tab and then back on the original one, the message goes away, so it seems to be just a Firefox bug that doesn't clear the status bar automatically. Is there a way to clear the status bar automatically in Firefox? or a way to explicitly tell it that the async loading is finished so it can clear the status bar itself? XAML: <UserControl x:Class="TestLoad1111.MainPage" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml"> <StackPanel Margin="10"> <StackPanel HorizontalAlignment="Left" Orientation="Horizontal" Margin="0 0 0 10"> <Button Content="Load Text" Click="Button_LoadText_Click"/> </StackPanel> <TextBlock Text="{Binding Message}" /> </StackPanel> </UserControl> Code Behind: using System; using System.Net; using System.Windows; using System.Windows.Controls; using System.ComponentModel; namespace TestLoad1111 { public partial class MainPage : UserControl, INotifyPropertyChanged { #region ViewModelProperty: Message private string _message; public string Message { get { return _message; } set { _message = value; OnPropertyChanged("Message"); } } #endregion public MainPage() { InitializeComponent(); DataContext = this; } private void Button_LoadText_Click(object sender, RoutedEventArgs e) { WebClient webClientTextLoader = new WebClient(); webClientTextLoader.DownloadStringAsync(new Uri("http://test.development:111/testdata/test.txt?" + Helpers.GetRandomizedSuffixToPreventCaching())); webClientTextLoader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(webClientTextLoader_DownloadStringCompleted); } void webClientTextLoader_DownloadStringCompleted(object sender, DownloadStringCompletedEventArgs e) { Message = e.Result; } #region INotifiedProperty Block public event PropertyChangedEventHandler PropertyChanged; protected void OnPropertyChanged(string propertyName) { PropertyChangedEventHandler handler = PropertyChanged; if (handler != null) { handler(this, new PropertyChangedEventArgs(propertyName)); } } #endregion } public static class Helpers { private static Random random = new Random(); public static int GetRandomizedSuffixToPreventCaching() { return random.Next(10000, 99999); } } }

    Read the article

  • What would you suggest as a high school first language?

    - by ldigas
    Edit by OA: After reading some answers I'll just update the question a little. At first I put it a little bluntly, but some of those gave me some good arguments which have to be taken into consideration while making a stand on this one. (these are mostly picked up from comments and answers below). A few things to take into account: to many pupils this is a first programming language - at this stage most of them have trouble grasping a difference between data types, variable passing, ... and whatnot, less alone pointers and similar 'low level stuff' :) they will all have to pass this to get into next grade (well, big majority of them anyway) not all of them have computers at home, not all of them are willing to learn this, less alone interested in - so the concepts have to be taught on a finite time scale in school hours (as well as practice on computers) free literature is a bonus - the teacher will make some scripts and handaways, but still ... I wouldn't like to bear the parents with the burden of buying expensive literature (also, english is not a native language here ... and although they are all learning it, their ability to read it fluently is somewhat questionable) somebody gave an argument - "a language which does not get in the way of ideas" - good one accessibility on different platforms in not expecially important at this point - although most of the suggested ones are available on win as well as linux - not many macs in this part of europe (their prices are sky high for anything but specialised usage) I will check what are the licencing issues on ms express editions about using it massively in high schools for purposes like this - if someone has any info about this, please, do not be shy with it :) A friend of mine, informatics teacher - in EU it comes as something as junior cs teacher, in a local high school asked me what I thought about what should be the first language pupils should be taught? It is a technical school (a little more oriented towards mathematics than the gymnasium, but not computer oriented totally). So I'm asking you - what do you think should be the first language pupils are exposed to in highschool? They have been teaching Pascal so far, but she's not sure that's a good course. She thought about switching to C (which I resented; considering not all pupils have interests in programming, to start with, and should be taught something higher level since they are just gripping the idea of a loop and such ... for a start), I suggested python or ruby (preferably py since it handles all paradigms). What is your opinion on this one? I looked, but didn't find a similar question on SO, so if there is one, please just point me towards it. Edit: The assumption is that none of the pupils have been exposed to any programming in junior school. See also: What is the best way to teach young kids some basic programming concepts? Best ways to teach a beginner to program How and when do you teach a kid to code What is the easiest language to start with? High School Programming

    Read the article

  • custom control in DataGridTemplateColumn

    - by Johnsonlu
    Hi all, I'd like to add my custom control into a template column of data grid. The custom control is very similar to a text box, but has an icon in it. The user can click the icon, and selects an item from a prompted window, then the selected item will be filled into the text box. My problem is when the text box is filled, after I click the second column, the text will disappear. If I replace the custom control with a simple text box, the result is the same. Here is the sample code: //Employee.cs using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace SimpleGridTest { public class Employee { public string Department { get; set; } public int ID { get; set; } public string Name { get; set; } } } Mainwindow.xaml <Window x:Class="SimpleGridTest.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="350" Width="525"> <Grid> <DataGrid x:Name="grid" Grid.Row="1" Margin="5" AutoGenerateColumns="False" RowHeight="25" RowHeaderWidth="10" ItemsSource="{Binding}" CanUserAddRows="True" CanUserSortColumns="False"> <DataGrid.Columns> <DataGridTemplateColumn Header="Department" Width="150"> <DataGridTemplateColumn.CellTemplate> <DataTemplate> <TextBox Text="{Binding Department}" /> </DataTemplate> </DataGridTemplateColumn.CellTemplate> </DataGridTemplateColumn> <DataGridTextColumn Header="ID" Binding="{Binding Path=ID}" Width="100"/> <DataGridTextColumn Header="Name" Binding="{Binding Path=Name}" Width="200"/> </DataGrid.Columns> </DataGrid> </Grid> </Window> MainWindow.xaml.cs using System.Windows; using System.Collections.ObjectModel; namespace SimpleGridTest { /// <summary> /// Interaction logic for MainWindow.xaml /// </summary> public partial class MainWindow : Window { private ObservableCollection<Employee> _employees = new ObservableCollection<Employee>(); public ObservableCollection<Employee> Employees { get { return _employees; } set { _employees = value; } } public MainWindow() { InitializeComponent(); grid.ItemsSource = Employees; } } } How can I fix this problem? Or I need to write a DataGrid***Column as DataGridTextColumn? Thanks in advance! Best Regards, Johnson

    Read the article

  • MVC Entity Framework: Cannot open user default database. Login failed.

    - by Michael
    This type of stuff drives me nuts. I'm having trouble finding the exact issue that I'm having, maybe I just don't know the terminology. Anyway, I had a working website using MVC and Entity Framework, but then I coded an error in a partial view page (ascx). Then all of a sudden I started to get this message. Cannot open user default database. Login failed. Login failed for user 'NT AUTHORITY\SYSTEM' I've found plenty of suggestions about opening SQL Server Management Studio, Double Click on Security, Double Click on Logins, Double click on NT AUTHORITY\SYSTEM and then double click on User Mapping. In this view I'm suppose to check the box for my database so that this user is mapped to this login. However, since I created my database in Visio Studio 2008 as part of my solution, it doesn't show up to allow me to click on it. So what do I do now? What drives me nuts is that everything was working fine. I was using my computer name to access the website and everything was working fine until the coding error. I've fix the error but still getting the error. I should also mention that this error started yesterday too around the same time but later cleared itself up. If I use localhost to access the site, it works just fine. IIS7 configuration for my website: Application Pool = DefaultAppPool Physical Path Credentials Logon = ClearText With in connection strings. I do see the one for my database in this solution. Entry Type is local metadata=res://*/Models.DataModel.csdl|res://*/Models.DataModel.ssdl|res://*/Models.DataModel.msl; provider=System.Data.SqlClient; provider connection string="Data Source=.\SQLEXPRESS;AttachDbFilename=|DataDirectory|\FFBall.mdf;Integrated Security=True;User Instance=True;MultipleActiveResultSets=True" And somewhere I remember changing the identity from Network Service to LocalSystem. Because when I first stared I was getting this same message, but I changed this value and it started working. I saw that suggested somewhere too but I do not recall. Wait I remember now, I believe in IIS7, under Application Pools, DefaultAppPool identity is set to LocalSystem. Additional things I've tried. Restart the computer Recycle the application pool. Antivirus isn't running. Any help would be appreciated. Thank you in advance.

    Read the article

  • Multiplying matrices: error: expected primary-expression before 'struct'

    - by justin
    I am trying to write a program that is supposed to multiply matrices using threads. I am supposed to fill the matrices using random numbers in a thread. I am compiling in g++ and using PTHREADS. I have also created a struct to pass the data from my command line input to the thread so it can generate the matrix of random numbers. The sizes of the two matrices are also passed in the command line as well. I keep getting: main.cpp:7: error: expected primary-expression before 'struct' my code @ line 7 =: struct a{ int Arow; int Acol; int low; int high; }; My inpust are : Sizes of two matrices ( 4 arguments) high and low ranges in which o generate the random numbers between. Complete code: [headers] using namespace std; void *matrixACreate(struct *); void *status; int main(int argc, char * argv[]) { int Arow = atoi(argv[1]); // Matrix A int Acol = atoi(argv[2]); // WxX int Brow = atoi(argv[3]); // Matrix B int Bcol = atoi(argv[4]); // XxZ, int low = atoi(argv[5]); // Range low int high = atoi(argv[6]); struct a{ int Arow; // Matrix A int Acol; // WxX int low; // Range low int high; }; pthread_t matrixAthread; //pthread_t matrixBthread; pthread_t runner; int error, retValue; if (Acol != Brow) { cout << " This matrix cannot be multiplied. FAIL" << endl; return 0; } error = pthread_create(&matrixAthread, NULL, matrixACreate, struct *a); //error = pthread_create(&matrixAthread, NULL, matrixBCreate, sendB); retValue = pthread_join(matrixAthread, &status); //retValue = pthread_join(matrixBthread, &status); return 0; } void matrixACreate(struct * a) { struct a *data = (struct a *) malloc(sizeof(struct a)); data->Arow = Arow; data->Acol = Acol; data->low = low; data->high = high; int range = ((high - low) + 1); cout << Arow << endl<< Acol << endl; }// just trying to print to see if I am in the thread

    Read the article

  • Class template specializations with shared functionality

    - by Thomas
    I'm writing a simple maths library with a template vector type: template<typename T, size_t N> class Vector { public: Vector<T, N> &operator+=(Vector<T, N> const &other); // ... more operators, functions ... }; Now I want some additional functionality specifically for some of these. Let's say I want functions x() and y() on Vector<T, 2> to access particular coordinates. I could create a partial specialization for this: template<typename T> class Vector<T, 3> { public: Vector<T, 3> &operator+=(Vector<T, 3> const &other); // ... and again all the operators and functions ... T x() const; T y() const; }; But now I'm repeating everything that already existed in the generic template. I could also use inheritance. Renaming the generic template to VectorBase, I could do this: template<typename T, size_t N> class Vector : public VectorBase<T, N> { }; template<typename T> class Vector<T, 3> : public VectorBase<T, 3> { public: T x() const; T y() const; }; However, now the problem is that all operators are defined on VectorBase, so they return VectorBase instances. These cannot be assigned to Vector variables: Vector<float, 3> v; Vector<float, 3> w; w = 5 * v; // error: no conversion from VectorBase<float, 3> to Vector<float, 3> I could give Vector an implicit conversion constructor to make this possible: template<typename T, size_t N> class Vector : public VectorBase<T, N> { public: Vector(VectorBase<T, N> const &other); }; However, now I'm converting from Vector to VectorBase and back again. Even though the types are the same in memory, and the compiler might optimize all this away, it feels clunky and I don't really like to have potential run-time overhead for what is essentially a compile-time problem. Is there any other way to solve this?

    Read the article

  • drupal jQuery 1.4 on specific pages

    - by Mark
    I'm looking for a way to force drupal to use 1.4 on specific pages. This is the same as this old question:http://stackoverflow.com/questions/2842792/drupal-jquery-1-4-on-specific-pages It look me a while to try the answer which I marked correct. But because I'm new to module dev overall I couldn't figure it out based on the answer. The code from that answer looked like this: /** * Implementation of hook_theme_registry_alter(). * Based on the jquery_update module. * * Make this page preprocess function runs *last*, * so that a theme can't call drupal_get_js(). */ function MYMODULE_theme_registry_alter(&$theme_registry) { if (isset($theme_registry['page'])) { // See if our preprocess function is loaded, if so remove it. if ($key = array_search('MYMODULE_preprocess_page', $theme_registry['page']['preprocess functions'])) { unset($theme_registry['page']['preprocess functions'][$key]); } // Now add it on at the end of the array so that it runs last. $theme_registry['page']['preprocess functions'][] = 'MYMODULE_preprocess_page'; } } /** * Implementation of moduleName_preprocess_hook(). * Based on the jquery_update module functions. * * Strips out JS and CSS for a path. */ function MYMODULE_preprocess_page(&$variables, $arg = 'my_page', $delta=0) { // I needed a one hit wonder. Can be altered to use function arguments // to increase it's flexibility. if(arg($delta) == $arg) { $scripts = drupal_add_js(); $css = drupal_add_css(); // Only do this for pages that have JavaScript on them. if (!empty($variables['scripts'])) { $path = drupal_get_path('module', 'admin_menu'); unset($scripts['module'][$path . '/admin_menu.js']); $variables['scripts'] = drupal_get_js('header', $scripts); } // Similar process for CSS but there are 2 Css realted variables. // $variables['css'] and $variables['styles'] are both used. if (!empty($variables['css'])) { $path = drupal_get_path('module', 'admin_menu'); unset($css['all']['module'][$path . '/admin_menu.css']); unset($css['all']['module'][$path . '/admin_menu.color.css']); $variables['styles'] = drupal_get_css($css); } } } I need the jquery_update 1.3.2 to be unset on the node-types of 'blog' and 'video'. Can someone help me out? Thank you.

    Read the article

  • jQuery: modify hidden form field value before submit

    - by Jason Miesionczek
    I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • ASP.NET MVC: How can I explain an invalid type violation to an end-user with Html.ValidationSummary?

    - by Terminal Frost
    Serious n00b warning here; please take mercy! So I finished the Nerd Dinner MVC Tutorial and I'm now in the process of converting a VB.NET application to ASP.NET MVC using the Nerd Dinner program as a sort of rough template. I am using the "IsValid / GetRuleViolations()" pattern to identify invalid user input or values that violate business rules. I am using LINQ to SQL and am taking advantage of the "OnValidate()" hook that allows me to run the validation and throw an application exception upon trying to save changes to the database via the CustomerRepository class. Anyway, everything works well, except that by the time the form values reach my validation method invalid types have already been converted to a default or existing value. (I have a "StreetNumber" property that is an integer, though I imagine this would be a problem for DateTime or any other non-strings as well.) Now, I am guessing that the UpdateModel() method throws an exception and then alters the value because the Html.ValidationMessage is displayed next to the StreetNumber field but my validation method never sees the original input. There are two problems with this: While the Html.ValidationMessage does signal that something is wrong, there is no corresponding entry in the Html.ValidationSummary. If I could even get the exception message to show up there indicating an invalid cast or something that would be better than nothing. My validation method which resides in my Customer partial class never sees the original user input so I do not know if the problem is a missing entry or an invalid type. I can't figure out how I can keep my validation logic nice and neat in one place and still get access to the form values. I could of course write some logic in the View that processes the user input, however that seems like the exact opposite of what I should be doing with MVC. Do I need a new validation pattern or is there some way to pass the original form values to my model class for processing? CustomerController Code // POST: /Customers/Edit/[id] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(int id, FormCollection formValues) { Customer customer = customerRepository.GetCustomer(id); try { UpdateModel(customer); customerRepository.Save(); return RedirectToAction("Details", new { id = customer.AccountID }); } catch { foreach (var issue in customer.GetRuleViolations()) ModelState.AddModelError(issue.PropertyName, issue.ErrorMessage); } return View(customer); }

    Read the article

  • ASP.NET MVC 2: Linq to SQL entity w/ ForeignKey relationship and Default ModelBinder strangeness

    - by Simon
    Once again I'm having trouble with Linq to Sql and the MVC Model Binder. I have Linq to Sql generated classes, to illustrate them they look similar to this: public class Client { public int ClientID { get; set; } public string Name { get; set; } } public class Site { public int SiteID { get; set; } public string Name { get; set; } } public class User { public int UserID { get; set; } public string Name { get; set; } public int? ClientID { get; set; } public EntityRef<Client> Client { get; set; } public int? SiteID { get; set; } public EntityRef<Site> Site { get; set; } } The 'User' has a relationship with the 'Client' and 'Site . The User class has nullable ClientIDs and SiteIDs because the admin users are not bound to a Client or Site. Now I have a view where a user can edit a 'User' object, the view has fields for all the 'User' properties. When the form is submitted, the appropiate 'Save' action is called in my UserController: public ActionResult Save(User user, FormCollection form) { //form['SiteID'] == 1 //user.SiteID == 1 //form['ClientID'] == 1 //user.ClientID == null } The problem here is that the ClientID is never set, it is always null, even though the value is in the FormCollection. To figure out whats going wrong I set breakpoints for the ClientID and SiteID getters and setters in the Linq to Sql designer generated classes. I noticed the following: SiteID is being set, then ClientID is being set, but then the Client EntityRef property is being set with a null value which in turn is setting the ClientID to null too! I don't know why and what is trying to set the Client property, because the Site property setter is never beeing called, only the Client setter is being called. Manually setting the ClientID from the FormCollection like this: user.ClientID = int.Parse(form["ClientID"].ToString()); throws a 'ForeignKeyReferenceAlreadyHasValueException', because it was already set to null before. The only workaround I have found is to extend the generated partial User class with a custom method: Client = default(EntityRef<Client>) but this is not a satisfying solution. I don't think it should work like this? Please enlighten me someone. So far Linq to Sql is driving me crazy! Best regards

    Read the article

  • How can I group an array of rectangles into "Islands" of connected regions?

    - by Eric
    The problem I have an array of java.awt.Rectangles. For those who are not familiar with this class, the important piece of information is that they provide an .intersects(Rectangle b) function. I would like to write a function that takes this array of Rectangles, and breaks it up into groups of connected rectangles. Lets say for example, that these are my rectangles (constructor takes the arguments x, y, width,height): Rectangle[] rects = new Rectangle[] { new Rectangle(0, 0, 4, 2), //A new Rectangle(1, 1, 2, 4), //B new Rectangle(0, 4, 8, 2), //C new Rectangle(6, 0, 2, 2) //D } A quick drawing shows that A intersects B and B intersects C. D intersects nothing. A tediously drawn piece of ascii art does the job too: +-------+ +---+ ¦A+---+ ¦ ¦ D ¦ +-+---+-+ +---+ ¦ B ¦ +-+---+---------+ ¦ +---+ C ¦ +---------------+ Therefore, the output of my function should be: new Rectangle[][]{ new Rectangle[] {A,B,C}, new Rectangle[] {D} } The failed code This was my attempt at solving the problem: public List<Rectangle> getIntersections(ArrayList<Rectangle> list, Rectangle r) { List<Rectangle> intersections = new ArrayList<Rectangle>(); for(Rectangle rect : list) { if(r.intersects(rect)) { list.remove(rect); intersections.add(rect); intersections.addAll(getIntersections(list, rect)); } } return intersections; } public List<List<Rectangle>> mergeIntersectingRects(Rectangle... rectArray) { List<Rectangle> allRects = new ArrayList<Rectangle>(rectArray); List<List<Rectangle>> groups = new ArrayList<ArrayList<Rectangle>>(); for(Rectangle rect : allRects) { allRects.remove(rect); ArrayList<Rectangle> group = getIntersections(allRects, rect); group.add(rect); groups.add(group); } return groups; } Unfortunately, there seems to be an infinite recursion loop going on here. My uneducated guess would be that java does not like me doing this: for(Rectangle rect : allRects) { allRects.remove(rect); //... } Can anyone shed some light on the issue?

    Read the article

  • Ruby: Parse, replace, and evaluate a string formula

    - by Swartz
    I'm creating a simple Ruby on Rails survey application for a friend's psychological survey project. So we have surveys, each survey has a bunch of questions, and each question has one of the options participants can choose from. Nothing exciting. One of the interesting aspects is that each answer option has a score value associated with it. And so for each survey a total score needs to be calculated based on these values. Now my idea is instead of hard-coding calculations is to allow user add a formula by which the total survey score will be calculated. Example formulas: "Q1 + Q2 + Q3" "(Q1 + Q2 + Q3) / 3" "(10 - Q1) + Q2 + (Q3 * 2)" So just basic math (with some extra parenthesis for clarity). The idea is to keep the formulas very simple such that anyone with basic math can enter them without resolving to some fancy syntax. My idea is to take any given formula and replace placeholders such as Q1, Q2, etc with the score values based on what the participant chooses. And then eval() the newly formed string. Something like this: f = "(Q1 + Q2 + Q3) / 2" # some crazy formula for this survey values = {:Q1 => 1, :Q2 => 2, :Q3 => 2} # values for substitution result = f.gsub(/(Q\d+)/) {|m| values[$1.to_sym] } # string to be eval()-ed eval(result) So my questions are: Is there a better way to do this? I'm open to any suggestions. How to handle formulas where not all placeholders were successfully replaced (e.g. one question wasn't answered)? Ex: {:Q3 = 2} wasn't in values hash? My idea is to rescue eval()... any thoughts? How to get proper result? Should be 2.5, but due to integer arithmetic, it will truncate to 2. I can't expect people who provide the correct formula (e.g. / 2.0 ) to understand this nuance. I do not expect this, but how to best protect eval() from abuse (e.g. bad formula, manipulated values coming in)? Thank you!

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • Writing a managed wrapper for unmanaged (C++) code - custom types/structs

    - by Bobby
    faacEncConfigurationPtr FAACAPI faacEncGetCurrentConfiguration( faacEncHandle hEncoder); I'm trying to come up with a simple wrapper for this C++ library; I've never done more than very simple p/invoke interop before - like one function call with primitive arguments. So, given the above C++ function, for example, what should I do to deal with the return type, and parameter? FAACAPI is defined as: #define FAACAPI __stdcall faacEncConfigurationPtr is defined: typedef struct faacEncConfiguration { int version; char *name; char *copyright; unsigned int mpegVersion; unsigned long bitRate; unsigned int inputFormat; int shortctl; psymodellist_t *psymodellist; int channel_map[64]; } faacEncConfiguration, *faacEncConfigurationPtr; AFAIK this means that the return type of the function is a reference to this struct? And faacEncHandle is: typedef struct { unsigned int numChannels; unsigned long sampleRate; ... SR_INFO *srInfo; double *sampleBuff[MAX_CHANNELS]; ... double *freqBuff[MAX_CHANNELS]; double *overlapBuff[MAX_CHANNELS]; double *msSpectrum[MAX_CHANNELS]; CoderInfo coderInfo[MAX_CHANNELS]; ChannelInfo channelInfo[MAX_CHANNELS]; PsyInfo psyInfo[MAX_CHANNELS]; GlobalPsyInfo gpsyInfo; faacEncConfiguration config; psymodel_t *psymodel; /* quantizer specific config */ AACQuantCfg aacquantCfg; /* FFT Tables */ FFT_Tables fft_tables; int bitDiff; } faacEncStruct, *faacEncHandle; So within that struct we see a lot of other types... hmm. Essentially, I'm trying to figure out how to deal with these types in my managed wrapper? Do I need to create versions of these types/structs, in C#? Something like this: [StructLayout(LayoutKind.Sequential)] struct faacEncConfiguration { uint useTns; ulong bitRate; ... } If so then can the runtime automatically "map" these objects onto eachother? And, would I have to create these "mapped" types for all the types in these return types/parameter type hierarchies, all the way down until I get to all primitives? I know this is a broad topic, any advice on getting up-to-speed quickly on what I need to learn to make this happen would be very much appreciated! Thanks!

    Read the article

  • Why does this textbox binding example work in WPF but not in Silverlight?

    - by Edward Tanguay
    Why is it in the following silverlight application that when I: change the default text in the first textbox move the cursor to the second text box (i.e. take focus off first textbox) click the button that inside the button handler, it still has the old value "default text"? What do I have to do to get the binding to work in Silverlight? The same code works fine in WPF. XAML: <UserControl x:Class="TestUpdate123.MainPage" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" mc:Ignorable="d" d:DesignWidth="640" d:DesignHeight="480"> <StackPanel Margin="10" HorizontalAlignment="Left"> <TextBox Text="{Binding InputText}" Height="200" Width="600" Margin="0 0 0 10"/> <StackPanel HorizontalAlignment="Left"> <Button Content="Convert" Click="Button_Convert_Click" Margin="0 0 0 10"/> </StackPanel> <TextBox Height="200" Width="600" Margin="0 0 0 10"/> <TextBlock Text="{Binding OutputText}"/> </StackPanel> </UserControl> Code Behind: using System.Windows; using System.Windows.Controls; using System.ComponentModel; namespace TestUpdate123 { public partial class MainPage : UserControl, INotifyPropertyChanged { #region ViewModelProperty: InputText private string _inputText; public string InputText { get { return _inputText; } set { _inputText = value; OnPropertyChanged("InputText"); } } #endregion #region ViewModelProperty: OutputText private string _outputText; public string OutputText { get { return _outputText; } set { _outputText = value; OnPropertyChanged("OutputText"); } } #endregion public MainPage() { InitializeComponent(); DataContext = this; InputText = "default text"; } private void Button_Convert_Click(object sender, RoutedEventArgs e) { OutputText = InputText; } #region INotifiedProperty Block public event PropertyChangedEventHandler PropertyChanged; protected void OnPropertyChanged(string propertyName) { PropertyChangedEventHandler handler = PropertyChanged; if (handler != null) { handler(this, new PropertyChangedEventArgs(propertyName)); } } #endregion } }

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Combobox INotifyPropertyChanged event not raised!!!

    - by nagiah
    I created a combobox and set observable collection as the itemsource and implemented INotifyPropertyChanged on the observable collection item. Even after that, when I select different item in the combobox, the OnPropertyChange method is not invoked. I think I am not making the binding properly. Could any one please correct me/ suggest me in this regard. ---------------------------------MainPage.xaml--------------------------------------------------- <StackPanel Width="300"> <ComboBox Name="cboName"></ComboBox> <TextBox Name="tbxName" Text="{Binding Path=name,Mode=TwoWay,ElementName=cboName}" ></TextBox> </StackPanel> ---------------------------MainPage.xaml.cs----------------------------------------------- using System; using System.Collections.Generic; using System.Linq; using System.Net; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; using System.Collections.ObjectModel; using System.Collections.Specialized; using System.ComponentModel; namespace MasterDetailsUpdate { public partial class MainPage : UserControl { public MainPage() { InitializeComponent(); Loaded += new RoutedEventHandler(MainPage_Loaded); } void MainPage_Loaded(object sender, RoutedEventArgs e) { ObservableCollection<Person> persons = new ObservableCollection<Person>(); persons.Add(new Person { city = "c1", name = "n1" }); persons.Add(new Person { city = "c2", name = "n2" }); persons.Add(new Person { city = "c3", name = "" }); persons.Add(new Person { city = "c4", name = "" }); persons.Add(new Person { city = "c5", name = "n1" }); cboName.ItemsSource = persons; cboName.DisplayMemberPath = "name"; } } public class Person : INotifyPropertyChanged { private string _name; private string _city; public string name { set { _name = value; OnPropertyChanged("name"); } get { return _name; } } public string city { set { _city = value; OnPropertyChanged("city"); } get { return _city; } } #region INotifyPropertyChanged Members public event PropertyChangedEventHandler PropertyChanged; private void OnPropertyChanged(string propertyName) { if (PropertyChanged != null) { this.PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } #endregion } } Thank You

    Read the article

  • MODX parse error function implode (is it me or modx?)

    - by Ian
    Hi, I cannot for the life of me figure this out, maybe someone can help. Using MODX a form takes user criteria to create a filter and return a list of documents. The form is one text field and a few checkboxes. If both text field and checkbox data is posted, the function works fine; if just the checkbox data is posted the function works fine; but if just the text field data is posted, modx gives me the following error: Error: implode() [function.implode]: Invalid arguments passed. I've tested this outside of modx with flat files and it all works fine leading me to assume a bug exists within modx. But I'm not convinced. Here's my code: <?php $order = array('price ASC'); //default sort order if(!empty($_POST['tour_finder_duration'])){ //duration submitted $days = htmlentities($_POST['tour_finder_duration']); //clean up post array_unshift($order,"duration DESC"); //add duration sort before default $filter[] = 'duration,'.$days.',4'; //add duration to filter[] (field,criterion,mode) $criteria[] = 'Number of days: <strong>'.$days.'</strong>'; //displayed on results page } if(!empty($_POST['tour_finder_dests'])){ //destination/s submitted $dests = $_POST['tour_finder_dests']; foreach($dests as $value){ //iterate through dests array $filter[] = 'searchDests,'.htmlentities($value).',7'; //add dests to filter[] $params['docid'] = $value; $params['field'] = 'pagetitle'; $pagetitle = $modx->runSnippet('GetField',$params); $dests_array[] = '<a href="[~'.$value.'~]" title="Read more about '.$pagetitle.'" class="tourdestlink">'.$pagetitle.'</a>'; } $dests_array = implode(', ',$dests_array); $criteria[] = 'Destinations: '.$dests_array; //displayed on results page } if(is_array($filter)){ $filter = implode('|',$filter);//pipe-separated string } if(is_array($order)){ $order = implode(',',$order);//comma-separated string } if(is_array($criteria)){ $criteria = implode('<br />',$criteria); } echo '<br />Order: '.$order.'<br /> Filter: '.$filter.'<br /> Criteria: '.$criteria; //next: extract docs using $filter and $order, display user's criteria using $criteria... ?> The echo statement is displayed above the MODX error message and the $filter array is correctly imploded. Any help will save my computer from flying out the window. Thanks

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

< Previous Page | 300 301 302 303 304 305 306 307 308 309 310 311  | Next Page >