Search Results

Search found 35327 results on 1414 pages for 'string concatenation'.

Page 308/1414 | < Previous Page | 304 305 306 307 308 309 310 311 312 313 314 315  | Next Page >

  • Processing CSV File

    - by nettguy
    I am using Sebastien LorionReference CSV reader to process my CSV file in C# 3.0. Say example id|name|dob (Header) 1|sss|19700101 (data) 2|xx|19700201 (data) My Business Object is class Employee { public string ID {get;set;} public string Name {get;set;} public string Dob {get;set;} } I read the CSV stream and stored it in List<string[]> List<string[]> col = new List<string[]>(); using (CsvReader csv = new CsvReader (new StreamReader("D:\\sample.txt"), true, '|')) { col = csv.ToList(); } How to iterate over the list to get each Employee like foreach (var q in col) { foreach (var r in q) { Employee emp=new Employee(); emp.ID =r[0]; emp.Name=r[1]; emp.Dob=r[2]; } } If i call r[0],r[1],r[2] i am getting "index out of range exception".How the process the list to avoid the error?

    Read the article

  • Thread Blocks During Call

    - by user578875
    I have a serious problem, I'm developing an application that mesures on call time during a call; the problem presents when, with the phone on the ear, the thread that the timer has, blocks and no longer responds before taking off my ear. The next log shows the problem. 01-11 16:14:19.607 14558 14566 I Estado : postDelayed Async Service 01-11 16:14:20.607 14558 14566 I Estado : postDelayed Async Service 01-11 16:14:21.607 14558 14566 I Estado : postDelayed Async Service 01-11 16:14:22.597 14558 14566 I Estado : postDelayed Async Service 01-11 16:14:23.608 14558 14566 I Estado : postDelayed Async Service 01-11 16:14:24.017 1106 1106 D iddd : select() < 0, Probably a handled signal: Interrupted system call 01-11 16:14:24.607 14558 14566 I Estado : postDelayed Async Service 01-11 16:18:05.500 1106 1106 D iddd : select() < 0, Probably a handled signal: Interrupted system call 01-11 16:18:06.026 14558 14566 I Estado : postDelayed Async Service 01-11 16:18:06.026 14558 14566 I Estado : postDelayed Async Service 01-11 16:18:06.026 14558 14566 I Estado : postDelayed Async Service 01-11 16:18:06.026 14558 14566 I Estado : postDelayed Async Service 01-11 16:18:06.026 14558 14566 I Estado : postDelayed Async Service 01-11 16:18:06.026 14558 14566 I Estado : postDelayed Async Service I've been trying with Services, Timers, Threads, AyncTasks and they all present the same problem. My Code: @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); requestWindowFeature(Window.FEATURE_NO_TITLE); getWindow().setFlags(WindowManager.LayoutParams.FLAG_FULLSCREEN, WindowManager.LayoutParams.FLAG_FULLSCREEN); setContentView(R.layout.main); HangUpService.setMainActivity(this); objHangUpService = new Intent(this, HangUpService.class); Runnable rAccion = new Runnable() { public void run() { TelephonyManager tm = (TelephonyManager)getSystemService(TELEPHONY_SERVICE); tm.listen(mPhoneListener, PhoneStateListener.LISTEN_CALL_STATE); objVibrator = (Vibrator) getSystemService(getApplicationContext().VIBRATOR_SERVICE); final ListView lstLlamadas = (ListView) findViewById(R.id.lstFavoritos); final EditText txtMinutos = (EditText) findViewById(R.id.txtMinutos); final EditText txtSegundos = (EditText) findViewById(R.id.txtSegundos); ArrayList<Contacto> cContactos = new ArrayList<Contacto>(); ContactoAdapter caContactos = new ContactoAdapter(HangUp.this, R.layout.row,cContactos); Cursor curContactos = getContentResolver().query( ContactsContract.Contacts.CONTENT_URI, null, null, null, ContactsContract.Contacts.TIMES_CONTACTED + " DESC"); while (curContactos.moveToNext()){ String strNombre = curContactos.getString(curContactos.getColumnIndex(ContactsContract.Contacts.DISPLAY_NAME)); String strID = curContactos.getString(curContactos.getColumnIndex(ContactsContract.Contacts._ID)); String strHasPhone=curContactos.getString(curContactos.getColumnIndex(ContactsContract.Contacts.HAS_PHONE_NUMBER)); String strStarred=curContactos.getString(curContactos.getColumnIndex(ContactsContract.Contacts.STARRED)); if (Integer.parseInt(strHasPhone) > 0 && Integer.parseInt(strStarred) ==1 ) { Cursor CursorTelefono = getContentResolver().query( ContactsContract.CommonDataKinds.Phone.CONTENT_URI, null, ContactsContract.CommonDataKinds.Phone.CONTACT_ID +" = " + strID, null, null); while (CursorTelefono.moveToNext()) { String strTipo=CursorTelefono.getString(CursorTelefono.getColumnIndex(ContactsContract.CommonDataKinds.Phone.TYPE)); String strTelefono=CursorTelefono.getString(CursorTelefono.getColumnIndex(ContactsContract.CommonDataKinds.Phone.NUMBER)); strNumero=strTelefono; String args[]=new String[1]; args[0]=strNumero; Cursor CursorCallLog = getContentResolver().query( android.provider.CallLog.Calls.CONTENT_URI, null, android.provider.CallLog.Calls.NUMBER + "=?", args, android.provider.CallLog.Calls.DATE+ " DESC"); if (Integer.parseInt(strTipo)==2) { caContactos.add( new Contacto( strNombre, strTelefono ) ); } } CursorTelefono.close(); } } curContactos.close(); lstLlamadas.setAdapter(caContactos); lstLlamadas.setOnItemClickListener(new OnItemClickListener() { @Override public void onItemClick(AdapterView a, View v, int position, long id) { Contacto mContacto=(Contacto)lstLlamadas.getItemAtPosition(position); i = new Intent(HangUp.this, Llamada.class); Log.i("Estado","Declaro Intent"); Bundle bundle = new Bundle(); bundle.putString("telefono", mContacto.getTelefono()); i.putExtras(bundle); startActivityForResult(i,SUB_ACTIVITY_ID); Log.i("Estado","Inicio Intent"); blActivo=true; try { String strMinutos=txtMinutos.getText().toString(); String strSegundos=txtSegundos.getText().toString(); if(!strMinutos.equals("") && !strSegundos.equals("")){ int Tiempo = ( (Integer.parseInt(txtMinutos.getText().toString())*60) + Integer.parseInt(txtSegundos.getText().toString()) )* 1000; handler.removeCallbacks(rVibrate); cTime = System.currentTimeMillis(); cTime=cTime+Tiempo; objHangUpAsync = new HangUpAsync(cTime,objVibrator,objPowerManager,objKeyguardLock); objHangUpAsync.execute(); objPowerManager.userActivity(Tiempo+3000, true); objHangUpService.putExtra("cTime", cTime); //startService(objHangUpService); } catch (Exception e) { e.printStackTrace(); } finally { } } }); } }; } AsyncTask: @Override protected String doInBackground(String... arg0) { blActivo = true; mWakeLock = objPowerManager.newWakeLock(PowerManager.FULL_WAKE_LOCK, "My Tag"); objKeyguardLock.disableKeyguard(); Log.i("Estado", "Entro a doInBackground"); timer.scheduleAtFixedRate( new TimerTask() { public void run() { if (blActivo){ if (cTime blActivo=false; objVibrator.vibrate(1000); Log.i("Estado","Vibrar desde Async"); this.cancel(); }else{ try{ mWakeLock.acquire(); mWakeLock.release(); Log.i("Estado","postDelayed Async Service"); }catch(Exception e){ Log.i("Estado","Error: " + e.getMessage()); } } } } }, 0, INTERVAL); return null; }

    Read the article

  • Implicit vs explicit getters/setters in AS3, which to use and why?

    - by James
    Since the advent of AS3 I have been working like this: private var loggy:String; public function getLoggy ():String { return loggy; } public function setLoggy ( loggy:String ):void { // checking to make sure loggy's new value is kosher etc... this.loggy = loggy; } and have avoided working like this: private var _loggy:String; public function get loggy ():String { return loggy; } public function set loggy ( loggy:String ):void { // checking to make sure loggy's new value is kosher etc... this.loggy = loggy; } I have avoided using AS3's implicit getters/setters partly so that I can just start typing "get.." and content assist will give me a list of all my getters, and likewise for my setters. I also dislike underscores in my code which turned me off the implicit route. Another reason is that I prefer the feel of this: whateverObject.setLoggy( "loggy's awesome new value!" ); to this: whateverObject.loggy = "loggy's awesome new value!"; I feel that the former better reflects what is actually happening in the code. I am calling functions, not setting values directly. After installing Flash Builder and the great new plugin SourceMate ( which helps to get some of the useful features that FDT is famous into FB ) I realized that when I use SourceMate's "generate getters and setters" feature it automatically sets my code up using the implicit route: private var _loggy:String; public function get loggy ():String { return loggy; } public function set loggy ( loggy:String ):void { // do whatever is needed to check to make sure loggy is an acceptable value this.loggy = loggy; } I figure that these SourceMate people must know what they are doing or they wouldn't be writing workflow enhancement plugins for coding in AS3, so now I am questioning my ways. So my question to you is: Can anyone give me a good reason why I should give up my explicit g/s ways, start using the implicit technique, and embrace those stinky little _underscores for my private vars? Or back me up in my reasons for doing things the way that I do?

    Read the article

  • Implementing a logging library in .NET with a database as the storage medium

    - by Dave
    I'm just starting to work on a logging library that everyone can use to keep track of any sort of system information while the user is running our application. The simplest example so far is to track Info, Warnings, and Errors. I want all plugins to be able to use this feature, but since each developer might have a different idea of what's important to report, I want to keep this as generic as possible. In the C++ world, I would normally use something like a stl::pair<string,string> to act as a key value pair structure, and have a stl::list of these to act as a "row" in the log. The log cache would then be a list<list<pair<string,string>>> (ugh!). This way, the developers can use a const string key like INFO, WARNING, ERROR to have a consistent naming for a column in the database (for SELECTing specific types of information). I'd like the database to be able to deal with any number of distinct column names. For example, John might have an INFO row with a column called USER, and Bill might have an INFO row with a column called FILENAME. I want the log viewer to be able to display all information, and if one report doesn't have a value for INFO / FILENAME, those fields should just appear blank. So one option is to use List<List<KeyValuePair<String,String>>, and the another is to have the log library consumer somehow "register" its schema, and then have the database do an ALTER TABLE to handle this situation. Yet another idea is to have a table that's just for key value pairs, with a foreign key that maps the key value pairs back to the original log entry. I obviously don't want logging to bog down the system, so I only lock the log cache to make a copy of the data (and remove the already-copied data), then a background thread will dump the information to the database. My specific questions regarding this are: Do you see any performance issues? In other words, have you ever tried something like this and found that certain things just don't work well in practice? Is there a more .NETish way to implement the key value pairs, other than List<List<KeyValuePair<String,String>>>? Even if there is a way to do #2 better, is the ALTER TABLE idea I proposed above a Bad Thing? Would you recommend multiple databases over a single one? I don't yet have an idea of how frequently the log would get written to, but we ideally would like to have lots of low level information. Perhaps there should be a DB with a fixed schema only for the low level stuff, and then another DB that's more flexible for reporting information back to users.

    Read the article

  • When is ¦ not equal to ¦?

    - by Trey Jackson
    Background. I'm working with netlists, and in general, people specify different hierarchies by using /. However, it's not illegal to actually use a / as a part of an instance name. For example, X1/X2/X3/X4 might refer to instance X4 inside another instance named X1/X2/X3. Or it might refer an instance named X3/X4 inside an instance named X2 inside an instance named X1. Got it? There's really no "regular" character that cannot be used as a part of an instance name, so you resort to a non-printable one, or ... perhaps one outside of the standard 0..127 ASCII chars. I thought I'd try (decimal) 166, because for me it shows up as the pipe: ¦. So... I've got some C++ code which constructs the path name using ¦ as the hierarchical separator, so the path above looks like X1¦X2/X3¦X4. Now the GUI is written in Tcl/Tk, and to properly translate this into human readable terms I need to do something like the following: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set humanreadable [join [split $path ¦] /] Basically, replace the ¦ with / (I could also accomplish this with [string map]). Now, the problem is, the ¦ in the string I get from C++ doesn't match the ¦ I can create in Tcl. i.e. This fails: set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 string match $path [format X1%cX2/X3%cX4 166 166] Visually, the two strings look identical, but string match fails. I even tried using scan to see if I'd mixed up the bit values. But set path [getPathFromC++] ;# returns X1¦X2/X3¦X4 set path2 [format X1%cX2/X3%cX4 166 166] for {set i 0} {$i < [string length $path]} {incr i} { set p [string range $path $i $i] set p2 [string range $path2 $i $i] scan %c $p c scan %c $p2 c2 puts [list $p $c :::: $p2 $c2 equal? [string equal $c $c2]] } Produces output which looks like everything should match, except the [string equal] fails for the ¦ characters with a print line: ¦ 166 :::: ¦ 166 equal? 0 For what it's worth, the character in C++ is defined as: const char SEPARATOR = 166; Any ideas why a character outside the regular ASCII range would fail like this? When I changed the separator to (decimal) 28 (^\), things worked fine. I just don't want to get bit by a similar problem on a different platform. (I'm currently using Redhat Linux).

    Read the article

  • jQuery post request is not sent until first post request is compleated

    - by Champ
    I have a function which have a long execution time. public void updateCampaign() { context.Session[processId] = "0|Fetching Lead360 Campaign"; Lead360 objLead360 = new Lead360(); string campaignXML = objLead360.getCampaigns(); string todayDate = DateTime.Now.ToString("dd-MMMM-yyyy"); context.Session[processId] = "1|Creating File for Lead360 Campaign on " + todayDate; string fileName = HttpContext.Current.Server.MapPath("campaigns") + todayDate + ".xml"; objLead360.createFile(fileName, campaignXML); context.Session[processId] = "2|Reading The latest Lead360 Campaign"; string file = File.ReadAllText(fileName); context.Session[processId] = "3|Updating Lead360 Campaign"; string updateStatus = objLead360.updateCampaign(fileName); string[] statusArr = updateStatus.Split('|'); context.Session[processId] = "99|" + statusArr[0] + " New Inserted , " + statusArr[1] + " Updated , With " + statusArr[2] + " Error , "; } So to track the Progress of the function I wrote a another function public void getProgress() { if (context.Session[processId] == null) { string json = "{\"error\":true}"; Response.Write(json); Response.End(); }else{ string[] status = context.Session[processId].ToString().Split('|'); if (status[0] == "99") context.Session.Remove(processId); string json = "{\"error\":false,\"statuscode\":" + status[0] + ",\"statusmsz\":\"" + status[1] + "\" }"; Response.Write(json); Response.End(); } } To call this by jQuery post request is used reqUrl = "AjaxPages/lead360Campaign.aspx?processid=" + progressID + "&action=updatecampaign"; $.post(reqUrl); setTimeout(getProgress, 500); get getProgress is : function getProgress() { reqUrl = "AjaxPages/lead360Campaign.aspx?processid=" + progressID + "&action=getProgress"; $.post(reqUrl, function (response) { var progress = jQuery.parseJSON(response); console.log(progress) if (progress.error) { $("#fetchedCampaign .waitingMsz").html("Some error occured. Please try again later."); $("#fetchedCampaign .waitingMsz").css({ "background": "url(common/images/ajax_error.jpg) no-repeat center 6px" }); return; } if (progress.statuscode == 99) { $("#fetchedCampaign .waitingMsz").html("Update Status :"+ progress.statusmsz ); $("#fetchedCampaign .waitingMsz").css({ "background": "url(common/images/ajax_loded.jpg) no-repeat center 6px" }); return; } $("#fetchedCampaign .waitingMsz").html("Please Wait... " + progress.statusmsz); setTimeout(getProgress, 500); }); } But the problem is that I can't see the intermediate message. Only the last message is been displayed after a long lime of ajax loading message Also on the browser console I just see that after a long time first requested is completed and after that the second request is completed. but there should be for getProgress ? I have checked jquery.doc and it says that $post is an asynchronous request. Can anyone please explain what is wrong with the code or logic?

    Read the article

  • Are memcached entries saved by the Danga client compatible with the Spy client?

    - by jigjig
    After saving a String value into memcached using the Danga client, I attempted to get the entry using the Spy client. The two String values are not the same. The Danga client retrieves a string with an additional empty char prepended to the string, therefore violating the equality condition. Danga: t,e,s,t,s,t,r,i,n,g Spy: ,t,e,s,t,s,t,r,i,n,g I also attempted to save a serialized Map using the Danga client and get the Map using the Spy client. The Spy client is able to only get a String form of the Map. The string contains binary values, as below: sr

    Read the article

  • What is the best data structure and algorithm for comparing a list of strings?

    - by Chiraag E Sehar
    I want to find the longest possible sequence of words that match the following rules: Each word can be used at most once All words are Strings Two strings sa and sb can be concatenated if the LAST two characters of sa matches the first two characters of sb. In the case of concatenation, it is performed by overlapping those characters. For example: sa = "torino" sb = "novara" sa concat sb = "torinovara" For example, I have the following input file, "input.txt": novara torino vercelli ravenna napoli liverno messania noviligure roma And, the output of the above file according to the above rules should be: torino novara ravenna napoli livorno noviligure since the longest possible concatenation is: torinovaravennapolivornovilligure Can anyone please help me out with this? What would be the best data structure for this?

    Read the article

  • Can AutoMapper call a method on destination for each member of collection on source?

    - by YonahW
    I have two classes as below. public class Destination { public Destination() { _StringCollection = new List<String>(); } private ICollection<String> _StringCollection; public IEnumerable<String> StringCollection { get { return _StringCollection.AsEnumerable<String>(); } } public void AddString(string str) { _StringCollection.Add(str); } } public class Source { public List<String> StringCollection { get; set; } } I would like to map that for each member of source call AddString(member) on Destination. I thought that maybe I could do something with a custom resolver but can't seem to figure out how.

    Read the article

  • Reading column header and column values of a data table using LAMBDA(C#3.0)

    - by Newbie
    Consider the folowing where I am reading the data table values and writing to a text file using (StreamWriter sw = new StreamWriter(@"C:\testwrite.txt",true)) { DataPreparation().AsEnumerable().ToList().ForEach(i => { string col1 = i[0].ToString(); string col2 = i[1].ToString(); string col3 = i[2].ToString(); string col4 = i[3].ToString(); sw.WriteLine( col1 + "\t" + col2 + "\t" + col3 + "\t" + col4 + Environment.NewLine ); }); } The data preparation function is as under private static DataTable DataPreparation() { DataTable dt = new DataTable(); dt.Columns.Add("Col1", typeof(string)); dt.Columns.Add("Col2", typeof(int)); dt.Columns.Add("Col3", typeof(DateTime)); dt.Columns.Add("Col4", typeof(bool)); for (int i = 0; i < 10; i++) { dt.Rows.Add("String" + i.ToString(), i, DateTime.Now.Date, (i % 2 == 0) ? true : false); } return dt; } It is working fine. Now in the above described program, it is known to me the Number of columns and the column headers. How to achieve the same in case when the column headers and number of columns are not known at compile time using the lambda expression? I have already done that which is as under public static void WriteToTxt(string directory, string FileName, DataTable outData, string delimiter) { FileStream fs = null; StreamWriter streamWriter = null; using (fs = new FileStream(directory + "\\" + FileName + ".txt", FileMode.Append, FileAccess.Write)) { try { streamWriter = new StreamWriter(fs); streamWriter.BaseStream.Seek(0, SeekOrigin.End); streamWriter.WriteLine(); DataTableReader datatableReader = outData.CreateDataReader(); for (int header = 0; header < datatableReader.FieldCount; header++) { streamWriter.Write(outData.Columns[header].ToString() + delimiter); } streamWriter.WriteLine(); int row = 0; while (datatableReader.Read()) { for (int field = 0; field < datatableReader.FieldCount; field++) { streamWriter.Write(outData.Rows[row][field].ToString() + delimiter); } streamWriter.WriteLine(); row++; } } catch (Exception ex) { throw ex; } } } I am using C#3.0 and framework 3.5 Thanks in advance

    Read the article

  • How to resolve Resharper's "unused property" warning on properties solely for Display/Value Members?

    - by JYelton
    I have defined two properties "Name" and "ID" for an object which I use for the DisplayMember and ValueMember of a ComboBox with a BindingList datasource. I recently installed Resharper to evaluate it. Resharper is giving me warnings on the object that the two properties are unused. Sample code: BindingList<ClassSample> SampleList = new BindingList<ClassSample>(); // populate SampleList cmbSampleSelector.DisplayMember = "Name"; cmdSampleSelector.ValueMember = "ID"; cmbSampleSelector.DataSource = SampleList; private class ClassSample { private string _name; private string _id; public string Name // Resharper believes this property is unused { get { return _name; } } public string ID // Resharper believes this property is unused { get {return _id; } } public ClassSample(string Name, string ID) { _name = Name; _id = ID; } } Am I doing something wrong or is Resharper clueless about this particular usage?

    Read the article

  • How to find the maximum value for each key in a List of Dictionaries using LINQ?

    - by Argos
    I have a List of Dictionaries that have keys of type string and values that are ints. Many of the dictionaries have the same keys in them but not all of them. So my question is: using LINQ how would I find the maximum value associated with each distinct key across all of the dictionaries? So for example given the following input: var data = new List<Dictionary<string, int>> { new Dictionary<string, int> {{"alpha", 4}, {"gorilla", 2}, {"gamma", 3}}, new Dictionary<string, int> {{"alpha", 1}, {"beta", 3}, {"gamma", 1}}, new Dictionary<string, int> {{"monkey", 2}, {"beta", 2}, {"gamma", 2}}, }; I would like some kind of collection that contains: {"alpha", 4}, {"gorilla", 2}, {"gamma", 3}, {"beta", 3}, {"monkey", 2} (I'm currently looping through the list and keeping track of things myself, really just wondering if there is a nicer LINQ-esque way of doing it) EDIT: I also don't know what the string keys are in advance

    Read the article

  • Passing null as a param for replace() in javascript behaving weird?

    - by Babiker
    I have the follwing jQuery: $("#textArea").keyup(function(){ var textAreaValue = $("textArea"); if(!textArea.value.indexOf("some string")){ textArea.value = textArea.value.replace("some string",null); alert("It was there!"); } }); Is it normal for element.value.replace("some string",null); to replace "some string" with "null"as a string? And if normal can you please explain why? I have tested it with element.value.replace("some string",""), and that works fine, so what would be the difference between null and ""? Thanks in advance.

    Read the article

  • Creating a generic NotFound View in ASP.MVC

    - by George
    Hello guys, I'm having a problem to create a generic View to represent NotFound pages. The view is created and it's fine. I need to know how i can direct the user to the NotFound view in my Controllers and how to render a specific "Return to Index" in each controller. Here is some code: public class NotFoundModel { private string _contentName; private string _notFoundTitle; private string _apologiesMessage; public string ContentName { get; private set; } public string NotFoundTitle { get; private set; } public string ApologiesMessage { get; private set; } public NotFoundModel(string contentName, string notFoundTitle, string apologiesMessage) { this._contentName = contentName; this._notFoundTitle = notFoundTitle; this._apologiesMessage = apologiesMessage; } } // NotFound View <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage<Geographika.Models.NotFoundModel>" %> <asp:Content ID="Content1" ContentPlaceHolderID="TitleContent" runat="server"> <%= Html.Encode(Model.ContentName) %> </asp:Content> <asp:Content ID="Content2" ContentPlaceHolderID="MainContent" runat="server"> <h2><%= Html.Encode(Model.NotFoundTitle) %></h2> <p><%= Html.Encode(Model.ApologiesMessage) %></p> <!-- How can i render here a specific "BackToIndexView", but that it's not bound to my NotFoundModel? --> </asp:Content> // Controller piece of code // // GET: /Term/Details/2 public ActionResult Details(int id) { Term term = termRepository.SingleOrDefault(t => t.TermId == id); if (term == null) return View("NotFound"); // how can i return the specific view that its not bound to Term Model? // the idea here would be something like: // return View("NotFound",new NotFoundModel("a","b","c")); else return View("Details", term); } I'm not sure how to redirect to a whole different page. Can anyone give me any pointers? Thanks

    Read the article

  • Using Ruby on Rails, can a polymorphic database be created in a few steps (with polymorphic associat

    - by Jian Lin
    I thought it could be created in a few steps but it can't yet: rails poly cd poly ruby script/generate scaffold animal name:string obj_type:string obj_id:integer rake:migrate ruby script/generate scaffold human name:string passportNumber:string rake:migrate ruby script/generate scaffold dog name:string registrationNumber:string rake:migrate and now change app/models/animal.rb to: class Animal < ActiveRecord::Base belongs_to :obj, :polymorphic => true end and run ruby script/server and go to http://localhost:3000 I thought on the server then if I create an Michael, Human, J123456 and then Woofie, Dog, L23456 then the database will have entries in the Dogs table and "Humen" or "Humans" table as well as in the Animals table? But only the Animals table has records, Dogs and "Humen" do not for some reason. Is there some steps missing?

    Read the article

  • Perl latin-9? Unicode - need to add support

    - by Phill Pafford
    I have an application that is being expanded to the UK and I will need to add support for Latin-9 Unicode. I have done some Googling but found nothing solid as to what is involved in the process. Any tips? Here is some code (Just the bits for Unicode stuff) use Unicode::String qw(utf8 latin1 utf16); # How to call $encoded_txt = $self->unicode_encode($item->{value}); # Function part sub unicode_encode { shift() if ref($_[0]); my $toencode = shift(); return undef unless defined($toencode); Unicode::String->stringify_as("utf8"); my $unicode_str = Unicode::String->new(); # encode Perl UTF-8 string into latin1 Unicode::String # - currently only Basic Latin and Latin 1 Supplement # are supported here due to issues with Unicode::String . $unicode_str->latin1( $toencode ); ... Any help would be great and thanks.

    Read the article

  • LINQ2SQL: how to merge two columns from the same table into a single list

    - by TomL
    this is probably a simple question, but I'm only a beginner so... Suppose I have a table containing home-work locations (cities) certain people use. Something like: ID(int), namePerson(string), homeLocation(string), workLocation(string) where homeLocation and workLocation can both be null. Now I want all the different locations that are used merged into a single list. Something like: var homeLocation = from hm in Places where hm.Home != null select hm.Home; var workLocation = from wk in Places where wk.Work != null select wk.Work; List<string> locationList = new List<string>(); locationList = homeLocation.Distinct().ToList<string>(); locationList.AddRange(workLocation.Distinct().ToList<string>()); (which I guess would still allow duplicates if they have the same value in both columns, which I don't really want...) My question: how this be put into a single LINQ statement? Thanks in advance for your help!

    Read the article

  • Mocking methods that call other methods Still hit database.Can I avoid it?

    - by devnet247
    Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • C++ interface inheritance problem

    - by james t
    Hey, i'm trying to create a c++ stomp client, my client constructor is : Client(std::string &server, short port, std::string &login, std::string &pass, Listener &listener); it gets a listener object which when Listener is the following interface : class Listener { virtual void message(StmpMessage message) =0; }; now i attempt to instantiate a client in a test class : class test : public virtual Listener { public: void message(StmpMessage message) { message.prettyPrint(); } int main(int argc, char* argv[]) { Client client("127.0.0.1", 61613, *this); return 0; } }; i'm sending this to the client because this is a listener object, i get the following error : /Users/mzruya/Documents/STOMPCPP/main.cpp:18: error: no matching function for call to 'Client::Client(const char [10], int, test&)' /Users/mzruya/Documents/STOMPCPP/Client.h:43: note: candidates are: Client::Client(std::string&, short int, std::string&, std::string&, Listener&) /Users/mzruya/Documents/STOMPCPP/Client.h:37: note: Client::Client(const Client&)

    Read the article

  • Vba to Access record Insert Issue

    - by raam
    I want to insert Values to access table by using VBA control is there is any simple way to do this. i try this code but it does not work properly if i run this code it give the error 'variable not set' can anyone help me. thanks in advance Private Sub CommandButton1_Click() Dim cn As ADODB.Connection Dim strSql As String Dim lngKt As Long Dim dbConnectStr As String Dim Catalog As Object Dim cnt As ADODB.Connection Dim dbPath As String Dim myRecordset As New ADODB.Recordset Dim SQL As String, SQL2 As String dbPath = "table.accdb" dbConnectStr = "Provider=Microsoft.Jet.OLEDB.4.0;Data Source=" & dbPath & ";" SQL = "INSERT INTO Jun_pre (ProductName,DESCRIPTION,SKU,MT,(mt),MRP,Remark,no_of_units_in_a_case) VALUES (""aa"",""bb"",""test"",""testUnit"",""1"",""2"",,""3"",,""4"");" With cnt .Open dbConnectStr 'some other string was there .Execute (SQL) .Close End With End Sub

    Read the article

  • How to dispose off custom object from within custom membership provider

    - by IrfanRaza
    I have created my custom MembershipProvider. I have used an instance of the class DBConnect within this provider to handle database functions. Please look at the code below: public class SGIMembershipProvider : MembershipProvider { #region "[ Property Variables ]" private int newPasswordLength = 8; private string connectionString; private string applicationName; private bool enablePasswordReset; private bool enablePasswordRetrieval; private bool requiresQuestionAndAnswer; private bool requiresUniqueEmail; private int maxInvalidPasswordAttempts; private int passwordAttemptWindow; private MembershipPasswordFormat passwordFormat; private int minRequiredNonAlphanumericCharacters; private int minRequiredPasswordLength; private string passwordStrengthRegularExpression; private MachineKeySection machineKey; **private DBConnect dbConn;** #endregion ....... public override bool ChangePassword(string username, string oldPassword, string newPassword) { if (!ValidateUser(username, oldPassword)) return false; ValidatePasswordEventArgs args = new ValidatePasswordEventArgs(username, newPassword, true); OnValidatingPassword(args); if (args.Cancel) { if (args.FailureInformation != null) { throw args.FailureInformation; } else { throw new Exception("Change password canceled due to new password validation failure."); } } SqlParameter[] p = new SqlParameter[3]; p[0] = new SqlParameter("@applicationName", applicationName); p[1] = new SqlParameter("@username", username); p[2] = new SqlParameter("@password", EncodePassword(newPassword)); bool retval = **dbConn.ExecuteSP("User_ChangePassword", p);** return retval; } //ChangePassword public override void Initialize(string name, NameValueCollection config) { if (config == null) { throw new ArgumentNullException("config"); } ...... ConnectionStringSettings ConnectionStringSettings = ConfigurationManager.ConnectionStrings[config["connectionStringName"]]; if ((ConnectionStringSettings == null) || (ConnectionStringSettings.ConnectionString.Trim() == String.Empty)) { throw new ProviderException("Connection string cannot be blank."); } connectionString = ConnectionStringSettings.ConnectionString; **dbConn = new DBConnect(connectionString); dbConn.ConnectToDB();** ...... } //Initialize ...... } // SGIMembershipProvider I have instantiated dbConn object within Initialize() event. My problem is that how could i dispose off this object when object of SGIMembershipProvider is disposed off. I know the GC will do this all for me, but I need to explicitly dispose off that object. Even I tried to override Finalize() but there is no such overridable method. I have also tried to create destructor for SGIMembershipProvider. Can anyone provide me solution.

    Read the article

  • Resharper code format linebreaks

    - by mizipzor
    Im trying to setup the code formatting in ReSharper. Limiting each line to a maximum count of characters, it seems to want to place casts on a separate line. Like so: string mystring = (string) MyStringConverter.convert(toconvert, typeof(string), null, null); I cant seem to be able to find the correct combination of settings to not have this on three lines. Im looking for something like this: string mystring = (string) MyStringConverter.convert( toconvert, typeof(string), null, null); Where the linebreak occurs is not that important, I guess I cant be to picky when I want to limit the line length. But three lines is a bit much. Does anyone know the/any correct combination of settings to make it only cut the line once?

    Read the article

  • Excel - referenced values via OleDB from .Net client

    - by ho
    I'm trying to read an Excel file (.xls, I think Excel 2003 compatible) via OleDB, but it fails to get the values for referenced fields. This is my current test code (please note, this is just part of the class): Private m_conn As OleDbConnection Public Sub New(ByVal fileName As String) Dim connString As String = String.Format("Provider=Microsoft.Jet.OLEDB.4.0;Data Source={0};Extended Properties=Excel 8.0;", fileName) m_conn = New OleDbConnection(connString) m_conn.Open() End Sub Public Sub GetSheet(ByVal sheet As String) Dim query As String = String.Format("SELECT * FROM [{0}]", sheet) Using cmd As OleDbCommand = m_conn.CreateCommand() cmd.CommandText = query Dim ds As New DataSet() Dim a As New OleDbDataAdapter(cmd) Using rdr As OleDbDataReader = cmd.ExecuteReader() While rdr.Read() Debug.WriteLine(rdr.Item(0).ToString()) End While End Using End Using End Sub But if the value is a reference (something like =+'MySheetName'!K37), I just get a DBNull from the call to rdr.Item(0). I can get around this by automating Excel instead, but would prefer not to have to use Excel automation so wondering if anyone knows how to do it.

    Read the article

< Previous Page | 304 305 306 307 308 309 310 311 312 313 314 315  | Next Page >