Search Results

Search found 8467 results on 339 pages for 'alternate elements'.

Page 316/339 | < Previous Page | 312 313 314 315 316 317 318 319 320 321 322 323  | Next Page >

• XSLT: How to remove the self-closed elment

  - by Daoming Yang

  I have a large xml file which contents a lot of self-closed tags. How could remove all them by using XSLT. eg. <?xml version="1.0" encoding="utf-8" ?> <Persons> <Person> <Name>user1</Name> <Tel /> <Mobile>123</Mobile> </Person> <Person> <Name>user2</Name> <Tel>456</Tel> <Mobile /> </Person> <Person> <Name /> <Tel>123</Tel> <Mobile /> </Person> <Person> <Name>user4</Name> <Tel /> <Mobile /> </Person> </Persons> I'm expecting the result: <?xml version="1.0" encoding="utf-8" ?> <Persons> <Person> <Name>user1</Name> <Mobile>123</Mobile> </Person> <Person> <Name>user2</Name> <Tel>456</Tel> </Person> <Person> <Tel>123</Tel> </Person> <Person> <Name>user4</Name> </Person> </Persons> Note: there are thousands of different elements, how can I programmatically remove all the self-closed tags. Another question is how to remove the empty element such as <name></name> as well. Can anyone help me on this? Many thanks.

  Read the article

• Generating custom-form documents from base-form plus XML?

  - by KlaymenDK

  Hi all, this is my first stack overflow, and it's a complex one. Sorry. My task is to generate custom documents from a basic template plus some XML without having a custom form design element for each case. Here's the whole picture: We are building a Lotus Notes (client, not web) application for world-wide application access control; the scope is something like 400.000 users being able to request access to any of 1000+ applications. Each application needs its own request form -- different number of approvers, various info required, that sort of thing. We simply can't have a thousand forms in a database (one per application), and anyway their maintenance really needs to be pushed from the developers to the application owners. So instead of custom forms, we'd like to create a generic "template" form that stores a block of basic fields, but then allows application owners to define another block of fields dynamically -- "I want a mandatory plain-text field named 'Name' here, and then a date field named 'Due' here that must be later than today's date, and then ...". I hope this makes sense (if not, think of it as a generic questionnaire application). I pretty much have the structure in place for designing the dynamic fields (form builder GUI - XML-encoded data - pre-rendered DXL for injecting into a form), including mark-up for field types, value options, and rudimentary field validation instructions. My problem is generating a document with this dynamic content injected at the proper location (without needing a custom form design element for each case). Doing the dynamic content via HTML is out. The Notes client web rendering is simply way too poor, and it would be quite a challenge to implement things like field validation instructions, date selectors, and name look-ups. DXL, on the other hand, would allow us to use native Notes fields and code. As a tech demo, I've managed to implement a custom form generator that injects the pre-rendered DXL for the dynamic content into a base form; but as I said, we don't want a ton of custom form design elements. I've tried to implement a way to create a document with the "store form in document" flag set, but once I've created the document from the base form, I can't get DXL access to the stored form design, and so I can't inject my dynamic content. I know this is not something Notes was ever intended to do. Has anyone ever tried something like it (and gotten away with it)? Thanks for reading this far. With a boatload of thanks in advance, Jan Gundtofte-Bruun

  Read the article

• Assign an existing click event function to another click event using jquery

  - by Peter Delahunty

  Ok so i have some html like this: <div id="navigation"> <ul> <li> <a>tab name</a> <span class="delete-tab">X</span> </li> <li> <a>tab name</a> <span class="delete-tab">X</span> </li> <li> <a>tab name</a> <span class="delete-tab">X</span> </li> <li class="selected"> <a>tab name</a> <span class="tab-del-btn">X</span> </li> </ul> </div> I then have javascript that is excuted on the page that i do not control (this is in liferay portal). I want to then manipulate things afterwards with my own custom javascript. SO... For each of the span.delete-tab elements an on-click event function has been assign earlier. It is the same function call for each span. I want to take that function (any) and call it from the click event of the span.tab-del-btn ? This is what i tried to do: var navigation = jQuery('#navigation'); var navTabs = navigation.find('.delete-tab'); var existingDeleteFunction = null; navTabs.each(function (i){ var tab = jQuery(this); existingDeleteFunction = tab.click; }); var selectedTab = jQuery('#navigation li.selected'); var deleteBtn = selectedTab.find('.tab-del-btn'); deleteBtn.click(function(event){ existingDeleteFunction.call(this); }); It does not work though. existingDeleteFunction is not the original function it is some jquery default function. Any ideas?

  Read the article

• Navigation bar(s) disappear when the window gets too small

  - by Leron

  The title maybe is a little misleading but I'm not 100% sure how this effect is called. I'm pretty sure what I meant is that my navigation bar is disappearing instead of collapsing. However my set up is this - I am working on the Layout view of ASP.NET MVC 4 project. I'm using bootstrap 3x but also have included jQuery libs so my <head> part is like this: @Scripts.Render("~/Scripts/bootstrap.min.js") @Styles.Render("~/Content/bootstrap.css") @Styles.Render("~/Content/themes/base/jquery.ui.smoothness.css") @Scripts.Render("~/Scripts/jquery-2.0.3.min.js") @Scripts.Render("~/Scripts/jquery-ui-1.10.3.min.js") //just skipped the standard stuff In the body I want to have two navbars and one side menu which will be the same for all my pages but I've noticed that when I start to narrow the window at some point instead of getting an effect similar to this example (noticed how the elements get repositioned) I just got both my navbars gone, I can't see them. The markup for my first navbar is this : <div class="navbar navbar-static-top navbar-inverse navbar-collapse collapse" role="navigation"> <ul class="nav navbar-nav "> <li><a href="#">Info</a></li> <li><a href="#">Info</a></li> </ul> </div> and the second one is : <div class="navbar navbar-collapse collapse" role="navigation" id="main-navigation-bar"> <ul class="nav nav-pills nav-justified"> <li style="border: 1px solid grey"><a href="#">Link</a></li> <li><a href="#">Link</a></li> <li><a href="#">Link</a></li> </ul> In fact the only thing left in my _Layout body is this: <div class="container-fluid"> @RenderBody() </div> which is just for compiling purposes and renders this view : <p>1</p> <p>2</p> <p>3</p> <p>4</p> <p>5</p> So when I make the window small enough so that my navbars disappear the only thing left is 1..5 numbers from the rendered view. I tested with only one navbar (commented the other) - no matter which one is commented, when I narrow the window I loose the navbar. How can I keep them using bootstrap 3x?

  Read the article

• JButton Image Ignoring GridBagConstraints

  - by daemor

  I am working on an application and have a screen that needs to have elements (namely some custom JButtons) appear and disappear based on a user selection. However for some reason, when I add these buttons to their pane, the buttton image goes to the top corner, and leaves the text in the center, completely ignoring GridBagConstraints. I am completely stumped on this one as I have done this same exact thing dozens of times earlier in the program without any issues. Here is an image of the problem: The problem is in this method here, and occurs down towards the bottom. public void init(){ contentPane.removeAll(); // Setup jlabels JLabel countyLabel = new JLabel("County"); countyLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); JLabel measureByLabel = new JLabel("Measure By: "); measureByLabel.setFont(new Font("Times New Roman", Font.PLAIN, 18)); String[] countyChoices = {"Washtenaw", "Oakland", "Livingston"}; // setup components JComboBox<String> countyCombo = new JComboBox<String>(countyChoices); // place baseComponents c.weightx = 0.5; c.weighty = 0.5; c.gridx = 0; c.gridy = 0; c.anchor = GridBagConstraints.NORTH; contentPane.add(countyLabel, c); c.gridx = 2; contentPane.add(countyCombo, c); c.gridy = 1; c.gridx = 0; contentPane.add(trenchButton, c); c.gridx = 2; contentPane.add(bedButton, c); c.gridy = 2; c.gridx = 1; contentPane.add(systemSelection, c); c.gridy = 3; c.gridx = 0; contentPane.add(lengthButton, c); c.fill = GridBagConstraints.BOTH; c.gridwidth = 4; c.gridy = 4; c.gridx = 0; contentPane.add(choicePane, c); GridBagConstraints con = new GridBagConstraints(); con.weightx = 0.5; con.weighty = 0.5; con.gridx = 0; con.gridy = 0; choicePane.add(lengthButton, c); // revalidate and repaint choicePane.revalidate(); choicePane.repaint(); contentPane.revalidate(); contentPane.repaint(); } I have tried doing this in separate methods, the button looks fine when added to the contentPane, the pane is for sure set to gridbagconstraints as I used the expression JPanel choicePane = new JPanel(new GridBagLayout()) to initialize it.

  Read the article

• Hide jQuery Accordion while loading

  - by zac

  I am testing a site build with a slow connection and I noticed the jQuery Accordion stays expanded for a long time, until the rest of the site is loaded, and then finally collapses. Not very pretty. I was wondering how I could keep it collapsed through the loading process and only expand when clicked. I am working with the standalone 1.6 version of the accordion plugin. The basic structure : <div class="sidebar"> <ul id="navigation" class="ui-accordion-container"> <li><a class="head" href="#">1</a> <ul class="sub"> <li><a href="#">1a</a></li> <li><a href="#">2a</a></li> </ul> </li> </ul> </div> and the script jQuery().ready(function(){ jQuery('#navigation').accordion({ active: 'false', header: '.head', navigation: true, animated: 'easeslide', collapsible: true }); }); I tried to hide the elements in the CSS to keep them from appearing while loading but all that achieved is in having them always hidden. Maybe the problem is in the CSS I have a background image in each of the sub menus: #navigation{ margin:0px; margin-left: 10px; padding:0px; text-indent:0px; font-size: 1.1em; width:200px; text-transform: uppercase; padding-bottom: 30px; } #navigation ul{ border-width:0px; margin:0px; padding:0px; text-indent:0px; } #navigation li{ list-style:none outside none; } #navigation li ul{ height:185px; overflow:auto; } #navigation li ul.sub{ background:url('../images/sub.jpg') no-repeat; dispaly: block; } #navigation li li a{ color:#000000; display:block; text-indent:20px; text-decoration: none; padding: 6px 0; } #navigation li li a:hover{ background-color:#FFFF99; color:#FF0000; } Thanks in advance for any advice on how to have this thing run a little smoother and having the accordion always collapsed. -edit - I forgot to mention that I am also hoping for a solution that will allow the nav to still be accessible for those without javscript.

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• jquery, manipulate content inserted by ajax, without using the callback

  - by Cody

  I am using ajax to insert a series of informational blocks via a loop. The blocks each have a title, and long description in them that is hidden by default. They function like an accordion, only showing one description at a time amongst all of the blocks. The problem is opening the description on the first block. I would REALLY like to do it with javascript right after the loop that is creating them is done. Is it possible to manipulate elements created ofter an ajax call without using the callback? <!-- example code--> <style> .placeholder, .long_description{ display:none;} </style> </head><body> <script> /* yes, this script is in the body, dont know if it matters */ $(document).ready(function() { $(".placeholder").each(function(){ // Use the divs to get the blocks var blockname = $(this).html(); // the contents if the div is the ID for the ajax POST $.post("/service_app/dyn_block",'form='+blockname, function(data){ var divname = '#div_' + blockname; $(divname).after(data); $(this).setupAccrdFnctly(); //not the actual code }); }); /* THIS LINE IS THE PROBLEM LINE, is it possible to reference the code ajax inserted */ /* Display the long description in the first dyn_block */ $(".dyn_block").first().find(".long_description").addClass('active').slideDown('fast'); }); </script> <!-- These lines are generated by PHP --> <!-- It is POSSIBLE to display the dyn_blocks --> <!-- here but I would really rather not --> <div id="div_servicetype" class="placeholder">servicetype</div> <div id="div_custtype" class="placeholder">custtype</div> <div id="div_custinfo" class="placeholder">custinfo</div> <div id="div_businfo" class="placeholder">businfo</div> </body>

  Read the article

• Mootools 1.2.4 delegation not working in IE8...?

  - by michael

  Hey there everybody-- So I have a listbox next to a form. When the user clicks an option in the select box, I make a request for the related data, returned in a JSON object, which gets put into the form elements. When the form is saved, the request goes thru and the listbox is rebuilt with the updated data. Since it's being rebuilt I'm trying to use delegation on the listbox's parent div for the onchange code. The trouble I'm having is with IE8 (big shock) not firing the delegated event. I have the following HTML: <div id="listwrapper" class="span-10 append-1 last"> <select id="list" name="list" size="20"> <option value="86">Adrian Franklin</option> <option value="16">Adrian McCorvey</option> <option value="196">Virginia Thomas</option> </select> </div> and the following script to go with it: window.addEvent('domready', function() { var jsonreq = new Request.JSON(); $('listwrapper').addEvent('change:relay(select)', function(e) { alert('this doesn't fire in IE8'); e.stop(); var status= $('statuswrapper').empty().addClass('ajax-loading'); jsonreq.options.url = 'de_getformdata.php'; jsonreq.options.method = 'post'; jsonreq.options.data = {'getlist':'<?php echo $getlist ?>','pkey':$('list').value}; jsonreq.onSuccess = function(rObj, rTxt) { status.removeClass('ajax-loading'); for (key in rObj) { status.set('html','You are currently editing '+rObj['cname']); if ($chk($(key))) $(key).value = rObj[key]; } $('lalsoaccomp-yes').set('checked',(($('naccompkey').value > 0)?'true':'false')); $('lalsoaccomp-no').set('checked',(($('naccompkey').value > 0)?'false':'true')); } jsonreq.send(); }); }); (I took out a bit of unrelated stuff). So this all works as expected in firefox, but IE8 refuses to fire the delegated change event on the select element. If I attach the change function directly to the select, then it works just fine. Am I missing something? Does IE8 just not like the :relay? Sidenote: I'm very new to mootools and javascripting, etc, so if there's something that can be improved code-wise, please let me know too.. Thanks!

  Read the article

• What makes great software?

  - by VirtuosiMedia

  From the perspective of an end user, what makes a software great rather than just good or functional? What are some fundamental principles that can shift the way a software is used and perceived? What are some of the little finishing touches that help put an application over the top? I'm in the later stages of developing a web app and I'm looking for ideas or concepts that I may have missed. If you have specific examples of software or apps that you absolutely love, please share the reasons or features that make it special. Keep in mind that I'm looking for examples that directly affect the end user, but not necessarily just UI suggestions. Here are some of the principles and little touches I'm trying to use: Keep the UI as simple as possible. Remove absolutely everything that isn't necessary. Use progressive disclosure when more information can be needed sometimes but isn't needed all the time. Provide inline help and useful error messages. Verbs on buttons wherever possible. Make anything that's clickable obvious. Fast, responsive UI. Accessibility (this is a work in progress). Reusable UI patterns. Once a user learns a skill, they will be able to use it in multiple places. Intelligent default settings. Auto-focusing forms when filling out the form is the primary action to be taken on the page. Clear metaphors (like tabs) and headings indicating location within the app. Automating repetitive tasks (with the ability to disable the automation). Use standardized or accepted metaphors for icons (like an "x" for delete). Larger text sizes for improved readability. High contrast so that each section is distinct. Making sure that it's obvious on every page what the user is supposed to do by establishing a clear information hierarchy and drawing the eye to the call to action. Most deletions can be undone. Discoverability - Make it easy to learn how to do new tasks. Group similar elements together.

  Read the article

• If we don't like it for the presentation layer, then why do we tolerate it for the behavior layer?

  - by greim

  Suppose CSS as we know it had never been invented, and the closest we could get was to do this: <script> // this is the page's stylesheet $(document).ready(function(){ $('.error').css({'color':'red'}); $('a[href]').css({'textDecoration':'none'}); ... }); </script> If this was how we were forced to write code, would we put up with it? Or would every developer on Earth scream at browser vendors until they standardized upon CSS, or at least some kind of declarative style language? Maybe CSS isn't perfect, but hopefully it's obvious how it's better than the find things, do stuff method shown above. So my question is this. We've seen and tasted of the glory of declarative binding with CSS, so why, when it comes to the behavioral/interactive layer, does the entire JavaScript community seem complacent about continuing to use the kludgy procedural method described above? Why for example is this considered by many to be the best possible way to do things: <script> $(document).ready(function(){ $('.widget').append("<a class='button' href='#'>...</div>"); $('a[href]').click(function(){...}); ... }); </script> Why isn't there a massive push to get XBL2.0 or .htc files or some kind of declarative behavior syntax implemented in a standard way across browsers? Is this recognized as a need by other web development professionals? Is there anything on the horizon for HTML5? (Caveats, disclaimers, etc: I realize that it's not a perfect world and that we're playing the hand we've been dealt. My point isn't to criticize the current way of doing things so much as to criticize the complacency that exists about the current way of doing things. Secondly, event delegation, especially at the root level, is a step closer to having a declarative behavior layer. It solves a subset of the problem, but it can't create UI elements, so the overall problem remains.)

  Read the article

• Python: How best to parse a simple grammar?

  - by Rosarch

  Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

  Read the article

• Find next and previous link in a hierarchy

  - by rebellion

  I have a hierarchy with links nested in list element like this: <ul> <li><a href="#">Page 1</a> <ul> <li><a href="#">Page 1.1</a></li> <li><a href="#">Page 1.2</a> <ul> <li><a href="#">Page 1.2.1</a></li> <li><a href="#">Page 1.2.2</a></li> </ul> </li> <li><a href="#">Page 1.3</a></li> </ul> </li> <li><a href="#">Page 2</a> <ul> <li><a href="#">Page 2.1</a></li> <li><a href="#">Page 2.2</a></li> </ul> </li> <li><a href="#">Page 3</a> <ul> <li><a href="#">Page 3.1</a> <ul> <li><a href="#">Page 3.1.1</a></li> <li><a href="#">Page 3.1.2</a></li> </ul> <li><a href="#">Page 3.2</a></li> <li><a href="#">Page 3.3</a></li> <ul> <li><a href="#">Page 3.1.1</a></li> <li><a href="#">Page 3.1.2</a></li> </ul> </li> </ul> </li> </ul> Basically just a sitemap. But I want to make next and previous links with jQuery, which finds the active page you're on (probably by checking for a class), and finding the previous and next anchor element (taking no regards of the hierarchy). I've tried with next(), previous() and find() but can't seem to get it to work. What is the easiest way to get the anchor elements before and after the current one?

  Read the article

• Can this be imporved? Scrubing of dangerous html tags.

  - by chobo2

  Hi I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

  Read the article

• Swapping two jQuery draggable list items not working properly (with jsFiddle example)

  - by Tony_Henrich

  The minimalist working example below swaps the two boxes when box 'one' is dragged and dropped on box 'two'. The problem is that when box 'one' is dropped, its style has 'top' & 'left' values causing it to be placed away from where it should drop. Its class includes 'ui-draggable-dragging'. It seems the top & left values are related to the amount the elements were dragged before the drop. And the dragging was 'interrupted' hence the residual 'ui-draggable-dragging' class? What am I missing to make the swap work seamlessly? full jsfiddle example here <html> <head> <script type="text/javascript" src="includes/jquery-1.4.2.min.js"></script> <script type="text/javascript" src="includes/jquery-ui-1.8.2.custom.min.js"></script> <script type="text/javascript"> jQuery.fn.swapWith = function(to) { return this.each(function() { var copy_to = $(to).clone(true); var copy_from = $(this).clone(true); $(to).replaceWith(copy_from); $(this).replaceWith(copy_to); }); }; $(document).ready(function() { options = {revert: true}; $("li").draggable(options) $('#wrapper').droppable({ drop: function(event, ui) { $(ui.draggable).swapWith($('#two')); } }); }); </script> </head> <body> <form> <ul id="wrapper"> <li id='one'> <div style="width: 100px; height: 100px; border: 1px solid green"> one<br /></div> </li> <li id='two'> <div style="width: 110px; height: 110px; border: 1px solid red"> two<br /></div> </li> </ul> <br /> </form> </body> </html>

  Read the article

• Flex/Air/AS3 Selecting and Populating a unFocused tab.

  - by Deyon

  I'm having a problem displaying data from a function to text box within a tab. If you run the code and click "Select Tab 2 and Fill..." I get an error; "TypeError: Error #1009: Cannot access a property or method of a null object reference." I'm guessing this is because "Tab 2" is/was not rendered yet. Now if I run the code, select "Tab 2" then select "Tab 1" and click "Select Tab 2 and Fill..." it works the way I would like. Dose any one know a way around this problem. ----Full Flex 4/Flash Builder Code just copy paste---- <?xml version="1.0" encoding="utf-8"?> <s:WindowedApplication xmlns:fx="http://ns.adobe.com/mxml/2009" xmlns:s="library://ns.adobe.com/flex/spark" xmlns:mx="library://ns.adobe.com/flex/halo" creationComplete=" "> <fx:Script> <![CDATA[ public function showtab2():void { mytextbox.text="I made it!"; tn.selectedIndex=1; } ]]> </fx:Script> <fx:Declarations> <!-- Place non-visual elements (e.g., services, value objects) here --> </fx:Declarations> <mx:Panel title="TabNavigator Container Example" height="90%" width="90%" paddingTop="10" paddingLeft="10" paddingRight="10" paddingBottom="10"> <mx:Label width="100%" color="blue" text="Select the tabs to change the panel."/> <mx:TabNavigator id="tn" width="100%" height="100%"> <!-- Define each panel using a VBox container. --> <mx:VBox label="Panel 1"> <mx:Label text="TabNavigator container panel 1"/> <mx:Button label="Select Tab 2 and Fill with Text" click="showtab2()"/> </mx:VBox> <mx:VBox label="Panel 2"> <mx:Label text="TabNavigator container panel 2"/> <s:TextInput id="mytextbox" /> </mx:VBox> </mx:TabNavigator> <mx:HBox> </mx:HBox> </mx:Panel> </s:WindowedApplication>

  Read the article

• Can this be improved? Scrubing of dangerous html tags.

  - by chobo2

  I been finding that for something that I consider pretty import there is very little information or libraries on how to deal with this problem. I found this while searching. I really don't know all the million ways that a hacker could try to insert the dangerous tags. I have a rich html editor so I need to keep non dangerous tags but strip out bad ones. So is this script missing anything? It uses html agility pack. public string ScrubHTML(string html) { HtmlDocument doc = new HtmlDocument(); doc.LoadHtml(html); //Remove potentially harmful elements HtmlNodeCollection nc = doc.DocumentNode.SelectNodes("//script|//link|//iframe|//frameset|//frame|//applet|//object|//embed"); if (nc != null) { foreach (HtmlNode node in nc) { node.ParentNode.RemoveChild(node, false); } } //remove hrefs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//a[starts-with(translate(@href, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("href", "#"); } } //remove img with refs to java/j/vbscript URLs nc = doc.DocumentNode.SelectNodes("//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'javascript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'jscript')]|//img[starts-with(translate(@src, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'vbscript')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.SetAttributeValue("src", "#"); } } //remove on<Event> handlers from all tags nc = doc.DocumentNode.SelectNodes("//*[@onclick or @onmouseover or @onfocus or @onblur or @onmouseout or @ondoubleclick or @onload or @onunload]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("onFocus"); node.Attributes.Remove("onBlur"); node.Attributes.Remove("onClick"); node.Attributes.Remove("onMouseOver"); node.Attributes.Remove("onMouseOut"); node.Attributes.Remove("onDoubleClick"); node.Attributes.Remove("onLoad"); node.Attributes.Remove("onUnload"); } } // remove any style attributes that contain the word expression (IE evaluates this as script) nc = doc.DocumentNode.SelectNodes("//*[contains(translate(@style, 'ABCDEFGHIJKLMNOPQRSTUVWXYZ', 'abcdefghijklmnopqrstuvwxyz'), 'expression')]"); if (nc != null) { foreach (HtmlNode node in nc) { node.Attributes.Remove("stYle"); } } return doc.DocumentNode.WriteTo(); }

  Read the article

• Writing to a xml file in java

  - by user243680

  import java.io.*; import javax.xml.parsers.*; import javax.xml.transform.*; import javax.xml.transform.dom.*; import javax.xml.transform.stream.*; import org.w3c.dom.*; public class CreatXMLFile { public static void main(String[] args) throws Exception { BufferedReader bf = new BufferedReader(new InputStreamReader(System.in)); // System.out.print("Enter number to add elements in your XML file: "); // String str = bf.readLine(); int no=2; // System.out.print("Enter root: "); String root = "SMS"; DocumentBuilderFactory documentBuilderFactory =DocumentBuilderFactory.newInstance(); DocumentBuilder documentBuilder =documentBuilderFactory.newDocumentBuilder(); Document document = documentBuilder.newDocument(); Element rootElement = document.createElement(root); document.appendChild(rootElement); // for (int i = 1; i <= no; i++) // System.out.print("Enter the element: "); // String element = bf.readLine(); String element ="Number"; System.out.print("Enter the Number: "); String data = bf.readLine(); Element em = document.createElement(element); em.appendChild(document.createTextNode(data)); rootElement.appendChild(em); String element1 ="message"; System.out.print("Enter the SMS: "); String data1 = bf.readLine(); Element em1 = document.createElement(element1); em1.appendChild(document.createTextNode(data1)); rootElement.appendChild(em1); TransformerFactory transformerFactory = TransformerFactory.newInstance(); Transformer transformer = transformerFactory.newTransformer(); DOMSource source = new DOMSource(document); StreamResult result = new StreamResult(System.out); transformer.transform(source, result); } } i am working on the above code and it gives the following output run: Enter the Number: 768678 Enter the SMS: ytu <?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>BUILD SUCCESSFUL (total time: 8 seconds) Now i want to write the output generated(<?xml version="1.0" encoding="UTF-8" standalone="no"?><SMS><Number>768678</Number><message>ytu</message></SMS>) to a XML file on the hard disk.How do i do it?

  Read the article

• Showing div based on filled form field

  - by Fabio

  I have this script where I use a slider to show some elements of a form. So far so good. The way I'm doing it is by having a slider (can't use a multistep form since it uses a plugin not allowing multistep forms, plus some graphic behaviors) and a button that goes to the next slider. So now I need that button (not part of the form) to show only if a certain field is filled. I tried teh following, but it's not working, I assume some error but can't figure what. My code is as follows: $('#clientname').change(function() { var clientVal = $("input").val() == ''; $(".next").hide(); if ($('#clientname').val() != '').show(); else $('.next').hide(); }); and the html as follows: <div class="b40-right"> <h3>The Basics</h3> <div class="label"> Your Name (required)</div> <div class="inputes"> <span class="wpcf7-form-control-wrap your-name"><input id="clientname" type="text" name="your-name" value="" class="wpcf7-form-control wpcf7-text wpcf7-validates-as-required" size="40" /></span> </div> <div class="label">Your Email (required)</div> <div class="inputes"> <span class="wpcf7-form-control-wrap your-email"><input type="text" name="your-email" value="" class="wpcf7-form-control wpcf7-text wpcf7-email wpcf7-validates-as-required wpcf7-validates-as-email" size="40" /></span> </div> <div class="label">Type of Business</div> <div class="inputes"> <span class="wpcf7-form-control-wrap type-of-business"><textarea name="type-of-business" class="wpcf7-form-control wpcf7-textarea" cols="40" rows="10"></textarea></span> </div> </div> <a class="next" href="javascript:stepcarousel.stepBy('mygallery2', 1)"><img id="nextbut1" src="<?php bloginfo('template_directory'); ?>/images/next.png" alt="" /></a> any help on what am I doing wrong? Is there a better approach/solution? (I'm not a programmer as you may figure) Thank you in advance!

  Read the article

• div popup inside td

  - by sims

  I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

  Read the article

• Invoke wso2 admin services SOAPUI

  - by NGoyal

  I m working on wso2 admin services. I get url as http://localhost:9763/services/AuthenticationAdmin?wsdl for AuthencticationAdmin. Now, when I hit the login operation, with admin,admin,127.0.0.1, I get true as return. ESB console shows logged in. Now, when I hit logout operation, I dont get any response. Also I notice that header of the response does not contain any session ID. 0down voteaccept My ESB is 4.6.0. login request : <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:aut="http://authentication.services.core.carbon.wso2.org"> <soapenv:Header/> <soapenv:Body> <aut:login> <!--Optional:--> <aut:username>admin</aut:username> <!--Optional:--> <aut:password>admin</aut:password> <!--Optional:--> <aut:remoteAddress>127.0.0.1</aut:remoteAddress> </aut:login> </soapenv:Body> </soapenv:Envelope> login response <soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/"> <soapenv:Body> <ns:loginResponse xmlns:ns="http://authentication.services.core.carbon.wso2.org"> <ns:return>true</ns:return> </ns:loginResponse> </soapenv:Body> </soapenv:Envelope> In the response, when I hit login I see, at bottom I only get 6 elements in header as follows : > Date Tue, 25 Jun 2013 14:31:42 GMT > > Transfer-Encoding chunked > > #status# HTTP/1.1 200 OK > > Content-Type text/xml; charset=UTF-8 > > Connection Keep-Alive > > Server WSO2-PassThrough-HTTP Now, I dont get session ID. Can you please point out where m I going wrong? My scenario is that I want to login to WSO2 and then hit some other admin service operation.

  Read the article

• Modify audio pitch of recorded clip (m4v)

  - by devcube

  I'm writing an app in which I'm trying to change the pitch of the audio when I'm recording a movie (.m4v). Or by modifying the audio pitch of the movie afterwards. I want the end result to be a movie (.m4v) that has the original length (i.e. same visual as original) but with modified sound pitch, e.g. a "chipmunk voice". A realtime conversion is to prefer if possible. I've read alot about changing audio pitch in iOS but most examples focus on playback, i.e. playing the sound with a different pitch. In my app I'm recording a movie (.m4v / AVFileTypeQuickTimeMovie) and saving it using standard AVAssetWriter. When saving the movie I have access to the following elements where I've tried to manipulate the audio (e.g. modify the pitch): audio buffer (CMSampleBufferRef) audio input writer (AVAssetWriterAudioInput) audio input writer options (e.g. AVNumberOfChannelsKey, AVSampleRateKey, AVChannelLayoutKey) asset writer (AVAssetWriter) I've tried to hook into the above objects to modify the audio pitch, but without success. I've also tried with Dirac as described here: Real Time Pitch Change In iPhone Using Dirac And OpenAL with AL_PITCH as described here: Piping output from OpenAL into a buffer And the "BASS" library from un4seen: Change Pitch/Tempo In Realtime I haven't found success with any of the above libs, most likely because I don't really know how to use them, and where to hook them into the audio saving code. There seems to be alot of librarys that have similar effects but focuses on playback or custom recording code. I want to manipulate the audio stream I've already got (AVAssetWriterAudioInput) or modify the saved movie clip (.m4v). I want the video to be unmodifed visually, i.e. played at the same speed. But I want the audio to go faster (like a chipmunk) or slower (like a ... monster? :)). Do you have any suggestions how I can modify the pitch in either real time (when recording the movie) or afterwards by converting the entire movie (.m4v file)? Should I look further into Dirac, OpenAL, SoundTouch, BASS or some other library? I want to be able to share the movie to others with modified audio, that's the reason I can't rely on modifying the pitch for playback only. Any help is appreciated, thanks!

  Read the article

• Sorted sets and comparators

  - by Jack

  Hello, I'm working with a TreeSetthat is meant to store pathfind locations used during the execution of a A* algorithm. Basically until there are "open" elements (still to be exhaustively visited) the neighbours of every open element are taken into consideration and added to a SortedSetthat keeps them ordered by their cost and heuristic cost. This means that I have a class like: public class PathTileInfo implements Comparable<PathTileInfo> { int cost; int hCost; final int x, y; @Override public int compareTo(PathTileInfo t2) { int c = cost + hCost; int c2 = t2.cost + t2.hCost; int costComp = c < c2 ? -1 : (c > c2 ? 1: 0); return costComp != 0 ? costComp : (x < t2.x || y < t2.y ? -1 : (x > t2.x || y > t2.y ? 1 : 0)); } @Override public boolean equals(Object o2) { if (o2 instanceof PathTileInfo) { PathTileInfo i = (PathTileInfo)o2; return i.cost + i.hCost == cost + hCost && x == i.x && y == i.y; } return false; } } In this way first the total cost is considered, then, since a total ordering is needed (consistency with equals) a ordering according to the x,y coordinate is taken into account. This should work but simply it doesn't, if I iterate over the TreeSet during the algorithm execution like in for (PathTileInfo t : openSet) System.out.print("("+t.x+","+t.y+","+(t.cost+t.hCost)+") "); I get results in which the right ordering is not kept, eg: (7,7,6) (7,6,7) (6,8,6) (6,6,7) (5,8,7) (5,7,7) (6,7,6) (6,6,7) (6,5,7) (5,7,7) (5,5,8) (4,7,7) (4,6,8) (4,5,8) is there something subtle I am missing? Thanks!

  Read the article

• Emacs, C++ code completion for vectors

  - by Caglar Toklu

  Hi, I am new to Emacs, and I have the following code as a sample. I have installed GNU Emacs 23.1.1 (i386-mingw-nt6.1.7600), installed cedet-1.0pre7.tar.gz. , installed ELPA, and company. You can find my simple Emacs configuration at the bottom. The problem is, when I type q[0] in main() and press . (dot), I see the 37 members of the vector, not Person although first_name and last_name are expected. The completion works as expected in the function greet() but it has nothing to do with vector. My question is, how can I accomplish code completion for vector elements too? #include <iostream> #include <vector> using namespace std; class Person { public: string first_name; string last_name; }; void greet(Person a_person) { // a_person.first_name is completed as expected! cout << a_person.first_name << "|"; cout << a_person.last_name << endl; }; int main() { vector<Person> q(2); Person guy1; guy1.first_name = "foo"; guy1.last_name = "bar"; Person guy2; guy2.first_name = "stack"; guy2.last_name = "overflow"; q[0] = guy1; q[1] = guy2; greet(guy1); greet(guy2); // cout q[0]. I want to see first_name or last_name here! } My Emacs configuration: ;;; This was installed by package-install.el. ;;; This provides support for the package system and ;;; interfacing with ELPA, the package archive. ;;; Move this code earlier if you want to reference ;;; packages in your .emacs. (when (load (expand-file-name "~/.emacs.d/elpa/package.el")) (package-initialize)) (load-file "~/.emacs.d/cedet/common/cedet.el") (semantic-load-enable-excessive-code-helpers) (require 'semantic-ia) (global-srecode-minor-mode 1) (semantic-add-system-include "/gcc/include/c++/4.4.2" 'c++-mode) (semantic-add-system-include "/gcc/i386-pc-mingw32/include" 'c++-mode) (semantic-add-system-include "/gcc/include" 'c++-mode) (defun my-semantic-hook () (imenu-add-to-menubar "TAGS")) (add-hook 'semantic-init-hooks 'my-semantic-hook)

  Read the article

• [CakePHP] I am so confused. What should I write in the default.ctp

  - by kwokwai

  Hi all, I am learning cakePHP, everything seems alright except that I am very confused of how to make use of the default.ctp and what should be put inside the Elements folder. Here is the default.ctp file that I have been using since my very first lesson on learning cakePHP: (I copied from this URL http://book.cakephp.org/view/96/Layouts) <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title><?php echo $title_for_layout?></title> <link rel="shortcut icon" href="favicon.ico" type="image/x-icon"> <!-- Include external files and scripts here (See HTML helper for more info.) --> <?php echo $scripts_for_layout ?> </head> <body> <!-- If you'd like some sort of menu to show up on all of your views, include it here --> <div id="header"> <div id="menu">...</div> </div> <!-- Here's where I want my views to be displayed --> <?php echo $content_for_layout ?> <!-- Add a footer to each displayed page --> <div id="footer">...</div> </body> </html> But the problem is that the layout will take effect to all web pages that I have created. Let's see the case that I have recently encountered. In one of the .ctp files, I need to use JQuery function and I need to ass some and tags in the .ctp file. Here are the and tags I used: <Script language="javascript"> $(document).ready(function() { // some functions here }); </Script> <style type="text/css"> { #toppage{ width:800px; } But when I followed the default.ctp file, I noticed that these tags (i.e. and ) happened to appear below the tag. As far as I know, the and self-defined Javascript functions should be put inside the tag of the HTML instead. I have considered to add the and in the default.ctp file, but then these codes would appear in every web pages instead of just a particular web page. Please help.

  Read the article

< Previous Page | 312 313 314 315 316 317 318 319 320 321 322 323  | Next Page >