Search Results

Search found 74171 results on 2967 pages for 'file structure'.

Page 320/2967 | < Previous Page | 316 317 318 319 320 321 322 323 324 325 326 327  | Next Page >

  • How to play small sound file continuously in Silverlight?

    - by ash
    Hello, I have two questions regarding Silverlight's SoundPlay action and properties. My scenario is like: I have two story board: The first story board has an image and a sound file; when the silverlight application gets loaded, the sound starts to play automatically, but if someone clicks the image, the sound file will stop and the second storyboard will start with a new sound file. 1) My first question is how to stop the first sound file of first story board when the second story board starts with the second sound file. 2) My second question is how to play a sound file continuously; for example, in Silverlight we can play a story board continuously with RepeatBehavior="Forever"; but I cannot find a way to play my 10 second sound file forever or continuously. Note: I have attached a small XAML file to show what I am talking about; I am also stating that if instead of an image file, if there were a button, then I can stop the first music file after I click the button and start my second story board with a new sound file, but I would like to use image file instead of a button. Is it possible? If it is, how to do it? Therefore, please answer my following two questions or give big hint or website tutorial links on 1) How to stop the first sound file of first story board when the second story board starts with the second sound file ( When the clickable element is an image instead of a button) 2) How to play a 10 second sound file continuously? ............Code Snippet...................... XAML ............ <Grid x:Name="LayoutRoot" Background="Red"> <Button HorizontalAlignment="Left" Margin="212,0,0,111" VerticalAlignment="Bottom" Width="75" Content="Button" Click="onClick"/> <MediaElement x:Name="sound2_mp3" Height="0" HorizontalAlignment="Left" Margin="105,230,0,0" VerticalAlignment="Top" Width="0" Source="/sound2.mp3" Stretch="Fill"/> <MediaElement x:Name="sound1_mp1" Height="0" HorizontalAlignment="Left" Margin="190,164,0,0" VerticalAlignment="Top" Width="0" Source="/sound1.mp3" Stretch="Fill" AutoPlay="False"/> </Grid> ..................................................................................................................................................................................................................... using System; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Ink; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; namespace testPrj { public partial class MainPage : UserControl { public MainPage() { // Required to initialize variables InitializeComponent(); } private void onClick(object sender, System.Windows.RoutedEventArgs e) { Storyboard1.Stop(); sound2_mp3.Stop(); sound1_mp1.Play(); } } } ...................................................................................................

    Read the article

  • Rails 3: How do I call a javascript function from a js.erb file

    - by user321775
    Now that I've upgraded to Rails 3, I'm trying to figure out the proper way to separate and reuse pieces of javascript. Here's the scenario I'm dealing with: I have a page with two areas: one with elements that should be draggable, the other with droppables. When the page loads I use jQuery to setup the draggables and droppables. Currently I have the script in the head portion of application.html.erb, which I'm sure is not the right solution but at least works. When I press a button on the page, an ajax call is made to my controller that replaces the draggables with a new set of elements that should also be draggable. I have a js.erb file that renders a partial in the correct location. After rendering I need to make the new elements draggable, so I'd like to reuse the code that currently lives in application.html.erb, but I haven't found the right way to do it. I can only make the new elements draggable by pasting the code directly into my js.erb file (yuck). What I'd like to have: - a javascript file that contains the functions prepdraggables() and prepdroppables() - a way to call either function from application.html.erb or from a js.erb file I've tried using :content_for to store and reuse the code, but can't seem to get it working correctly. What I currently have in the head section of application.html.erb <% content_for :drag_drop_prep do %> <script type="text/javascript" charset="utf-8"> $(document).ready(function () { // declare all DOM elements with class draggable to be draggable $( ".draggable" ).draggable( { revert : 'invalid' }); // declare all DOM elements with class legal to be droppable $(".legal").droppable({ hoverClass : 'legal_hover', drop : function(event, ui) { var c = new Object(); c['die'] = ui.draggable.attr("id"); c['cell'] = $(this).attr("id"); c['authenticity_token'] = encodeURIComponent(window._token); $.ajax({ type: "POST", url: "/placeDie", data: c, timeout: 5000 }); }}); }); </script> <% end %> undo.js.erb $("#board").html("<%= escape_javascript(render :partial => 'shared/board', :locals => { :playable => true, :restartable => !session[:challenge]}) %>") // This is where I want to prepare draggables. <%= javascript_include_tag "customdragdrop.js" %> // assuming this file had the draggables code from above in a prepdraggables() function prepdraggables();

    Read the article

  • Binary file reading problem

    - by ScReYm0
    Ok i have problem with my code for reading binary file... First i will show you my writing code: void book_saving(char *file_name, struct BOOK *current) { FILE *out; BOOK buf; out = fopen(file_name, "wb"); if(out != NULL) { printf_s("Writting to file..."); do { if(current != NULL) { strcpy(buf.catalog_number, current->catalog_number); strcpy(buf.author, current->author); buf.price = current->price; strcpy(buf.publisher, current->publisher); strcpy(buf.title, current->title); buf.price = current->year_published; fwrite(&buf, sizeof(BOOK), 1, out); } current = current->next; }while(current != NULL); printf_s("Done!\n"); fclose(out); } } and here is my "version" for reading it back: int book_open(struct BOOK *current, char *file_name) { FILE *in; BOOK buf; BOOK *vnext; int count; int i; in = fopen("west", "rb"); printf_s("Reading database from %s...", file_name); if(!in) { printf_s("\nERROR!"); return 1; } i = fread(&buf,sizeof(BOOK), 1, in); while(!feof(in)) { if(current != NULL) { current = malloc(sizeof(BOOK)); current->next = NULL; } strcpy(current->catalog_number, buf.catalog_number); strcpy(current->title, buf.title); strcpy(current->publisher, buf.publisher); current->price = buf.price; current->year_published = buf.year_published; fread(&buf, 1, sizeof(BOOK), in); while(current->next != NULL) current = current->next; fclose(in); } printf_s("Done!"); return 0; } I just need to save my linked list in binary file and to be able to read it back ... please help me. The program just don't read it or its crash every time different situation ...

    Read the article

  • Is it possible to mod_rewrite BASED on the existence of a file/directory and uniqueID?

    - by JM4
    My site currently forces all non www. pages to use www. Ultimately, I am able to handle all unique subdomains and parse correctly but I am trying to achieve the following: (ideally with mod_rewrite): when a consumer visits www.site.com/john4, the server processes that request as: www.site.com?Agent=john4 Our requirements are: The URL should continue to show www.site.com/john4 even though it was redirected to www.site.com?index.php?Agent=john4 If a file (of any extension OR a directory) exists with the name, the entire process stops an it tries to pull that file instead: for example: www.site.com/file would pull up (www.site.com/file.php if file.php existed on the server. www.site.com/pages would go to www.site.com/pages/index.php if the pages directory exists). Thank you ahead of time. I am completely at a crapshot right now.

    Read the article

  • How to change icons of specific file types on Ubuntu 11.10?

    - by Curious Apprentice
    I want to change file icons of some specific file types like- .html, .css etc. I have tried using "File Type Editor (assogiate)" which is not working. I have also tried using "Gnome Tweak Tool" using icon themes. But that also does not worked properly (Though I can change folder icons , dash menu icons but not file icons). Please suggest me a way so that I can change file icons properly. I have read some of the articles saying about some mime type changes. I could not get proper guide from any of those articles. If there is such a way then please write in detail. Many Many Thanks in Advance :)

    Read the article

  • Server Error Message: No File Access

    - by iMayne
    Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

    Read the article

  • php download file slows

    - by hobbywebsite
    OK first off thanks for your time I wish I could give more than one point for this question. Problem: I have some music files on my site (.mp3) and I am using a php file to increment a database to count the number of downloads and to point to the file to download. For some reason this method starts at 350kb/s then slowly drops to 5kb/s which then the file says it will take 11hrs to complete. BUT if I go directly to the .mp3 file my browser brings up a player and then I can right click and "save as" which works fine complete download in 3mins. (Yes both during the same time for those that are thinking it's my connection or ISP and its not my server either.) So the only thing that I've been playing around with recently is the php.ini and the .htcaccess files. So without further ado, the php file, php.ini, and the .htcaccess: download.php <?php include("config.php"); include("opendb.php"); $filename = 'song_name'; $filedl = $filename . '.mp3'; $query = "UPDATE songs SET song_download=song_download+1 WHER song_linkname='$filename'"; mysql_query($query); header('Content-Disposition: attachment; filename='.basename($filedl)); header('Content-type: audio/mp3'); header('Content-Length: ' . filesize($filedl)); readfile('/music/' . $filename . '/' . $filedl); include("closedb.php"); ?> php.ini register_globals = off allow_url_fopen = off expose_php = Off max_input_time = 60 variables_order = "EGPCS" extension_dir = ./ upload_tmp_dir = /tmp precision = 12 SMTP = relay-hosting.secureserver.net url_rewriter.tags = "a=href,area=href,frame=src,input=src,form=,fieldset=" ; Defines the default timezone used by the date functions date.timezone = "America/Los_Angeles" .htaccess Options +FollowSymLinks RewriteEngine on RewriteCond %{HTTP_HOST} !^(www.MindCollar.com)?$ [NC] RewriteRule (.*) http://www.MindCollar.com/$1 [R=301,L] <IfModule mod_rewrite.c> RewriteEngine On ErrorDocument 404 /errors/404.php ErrorDocument 403 /errors/403.php ErrorDocument 500 /errors/500.php </IfModule> Options -Indexes Options +FollowSymlinks <Files .htaccess> deny from all </Files> thanks for you time

    Read the article

  • Use matching value of a RegExp to name the output file.

    - by fx42
    I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Will the app file be sync from dmgr side after we remove it from installedApps path in Websphere?

    - by wing2ofsky
    do you know whether the app file will be sync from dmgr side and regenerated after we remove it from installedApps path? i've got one issue recently from customer. That is, they uploaded one image file into WASNode installedApps app path manually. Afterwards, they removed that file manually again from installedApps app path. But after restarting the Application server process, that file has been regenerated under same installedApps path. So i suspect that file maybe has been resync from dmgr node, like app file under applications folder. However, first of all, i don't see that image file within application ear file from DMGR applications folder. Moreover, i made a test myself, if i deleted file from installedApps app path, that file never be regenerated any more even though the node sync completed. So does anybody know why? Thanks in advance

    Read the article

  • Is there a way to recover a file that I have deleted but is still open somewhere?

    - by George Edison
    This question is related to How to recover deleted files? but it is slightly different in nature. Suppose I have a file named ~/something open in a text editor. Further suppose that I open a terminal and run the following command while the file is still open in the text editor: rm ~/something This will delete the file. Now suppose that I changed my mind and wanted to get the file back. The file is still open in the text editor, so it hasn't been removed from the disk or filesystem yet. Is there any way to recover it?

    Read the article

  • Can I copy large files faster without using the file cache?

    - by Veazer
    After adding the preload package, my applications seem to speed up but if I copy a large file, the file cache grows by more than double the size of the file. By transferring a single 3-4 GB virtualbox image or video file to an external drive, this huge cache seems to remove all the preloaded applications from memory, leading to increased load times and general performance drops. Is there a way to copy large, multi-gigabyte files without caching them (i.e. bypassing the file cache)? Or a way to whitelist or blacklist specific folders from being cached?

    Read the article

  • Save file in a different location in iPhone App

    - by zp26
    Hi, I have a problem. My proget create a xml file. In the iPhone this file was store in the NSDocumentDirectory. I wanna save this file in another directory like Desktop(where there are the apps) or another visible folder. Thanks. This is my code: -(void)saveInXML:(NSString*)name:(float)x:(float)y:(float)z{ //NSDocumentDirectory put the file in the app directory NSArray *paths = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES); NSString *documentsDirectoryPath = [paths objectAtIndex:0]; NSString *filePath = [documentsDirectoryPath stringByAppendingPathComponent:@"filePosizioni.xml"]; NSFileHandle *myHandle; NSFileManager *fileManager = [NSFileManager defaultManager]; NSString *titoloXML = [NSString stringWithFormat:@"File Xml delle posizioni del iPhone"]; NSString *inizioTag = [NSString stringWithFormat:@"\n\n\n<posizione>"]; NSString *tagName = [NSString stringWithFormat:@"\n <name>%@</name>", name]; NSString *tagX = [NSString stringWithFormat:@"\n <x>%f</x>", x]; NSString *tagY = [NSString stringWithFormat:@"\n <y>%f</y>", y]; NSString *tagZ = [NSString stringWithFormat:@"\n <z>%f</z>", z]; NSString *fineTag= [NSString stringWithFormat:@"\n</posizione>"]; NSData* dataTitoloXML = [titoloXML dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataInizioTag = [inizioTag dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataName = [tagName dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataX = [tagX dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataY = [tagY dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataZ = [tagZ dataUsingEncoding: NSASCIIStringEncoding]; NSData* dataFineTag = [fineTag dataUsingEncoding: NSASCIIStringEncoding]; if(![fileManager fileExistsAtPath:filePath]) [fileManager createFileAtPath:filePath contents:dataTitoloXML attributes:nil]; myHandle = [NSFileHandle fileHandleForUpdatingAtPath:filePath]; [myHandle seekToEndOfFile]; [myHandle writeData:dataInizioTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataName]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataX]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataY]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataZ]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; [myHandle writeData:dataFineTag]; NSLog(@"writeok"); [myHandle seekToEndOfFile]; NSLog(@"zp26 %@",filePath); }

    Read the article

  • could not save the file /usr/... permission denied (13.04)

    - by plaguedoctor
    I am running Ubuntu 13.04 and am trying to create an .sh file for conky in /usr/bin using gedit. When trying to save I get the error dialogue: Could not save the file /usr/bin/conky-start.sh You do not have the permissions necessary to save the file. Please check that you typed the location correctly and try again." From searching, I think I have to run a command in terminal to allow permission, but I couldn't find out what that is. Edit: I'm trying to create the file conky-start.sh, not change or run it. Thus far, I've opened gedit, copied and pasted some required info from the net, and I'm trying to save-as /usr/bin/conky-start.sh Perhaps I need to create the file first in terminal, then edit it? How would I do that?

    Read the article

  • A question about making a C# class persistent during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • sharpziplib - can you add a file without it copying the entire zip first?

    - by schmoopy
    Im trying to add an existing file to a .zip file using sharpziplib - problem is, the zip file is 1GB in size. When i try to add 1 small file (400k) sharpziplib creates a copy/temp of the orig zip file before adding the new file - this poses a problem when the amount of free disk space is less than 2x the zip file you are trying to update. for example: 1GB zip myfile.zip 1GB zip myfile.zip.tmp.293 ZipFile zf = new ZipFile(path); zf.BeginUpdate(); zf.Add(file); // Adding a 400k file here causes a 1GB temp file to be created zf.EndUpdate(); zf.Close(); Is there a more efficient way to do this? Thanks :-)

    Read the article

  • How can I make a web browser view my .h file as text?

    - by drewbenn
    I want to post a .h file from a project I'm working on. I set a simple href link to it, like: <p>Click here to download the <a href=project_strings.h>strings file</a>. When I click on it, though, my web browser (Iceweasel 12) gives me a prompt to download the file, instead of just displaying it: Is there any magic I can add to the web page, or as a header to the file (that will still allow it to be included by a .c compiled with gcc), to get the .h file to be displayed in the web browser?

    Read the article

  • Creating and Saving an Excel File

    - by Kris
    I have the following code that creates a new Excel file in my C# code behind. When I attempt to save the file I would like the user to select the location of the save. In Method #1, I can save the file my using the workbook SaveCopyAs without prompting the user for a location. This saves one file to the C:\Temp directory. Method #2 will save the file in my Users\Documents folder, then prompt the user to select the location and save a second copy. How can I eliminate the first copy from saving in the Users\Documents folder? Excel.Application oXL; Excel._Workbook oWB; Excel._Worksheet oSheet; Excel.Range oRng; try { //Start Excel and get Application object. oXL = new Excel.Application(); oXL.Visible = false; //Get a new workbook. oWB = (Excel._Workbook)(oXL.Workbooks.Add(Missing.Value)); oSheet = (Excel._Worksheet)oWB.ActiveSheet; // ***** oSheet.Cells[2, 6] = "Ship To:"; oSheet.get_Range("F2", "F2").Font.Bold = true; oSheet.Cells[2, 7] = sShipToName; oSheet.Cells[3, 7] = sAddress; oSheet.Cells[4, 7] = sCityStateZip; oSheet.Cells[5, 7] = sContactName; oSheet.Cells[6, 7] = sContactPhone; oSheet.Cells[9, 1] = "Shipment No:"; oSheet.get_Range("A9", "A9").Font.Bold = true; oSheet.Cells[9, 2] = sJobNumber; oSheet.Cells[9, 6] = "Courier:"; oSheet.get_Range("F9", "F9").Font.Bold = true; oSheet.Cells[9, 7] = sCarrierName; oSheet.Cells[11, 1] = "Requested Delivery Date:"; oSheet.get_Range("A11", "A11").Font.Bold = true; oSheet.Cells[11, 2] = sRequestDeliveryDate; oSheet.Cells[11, 6] = "Courier Acct No:"; oSheet.get_Range("F11", "F11").Font.Bold = true; oSheet.Cells[11, 7] = sCarrierAcctNum; // ***** Method #1 //oWB.SaveCopyAs(@"C:\Temp\" + sJobNumber +".xls"); Method #2 oXL.SaveWorkspace(sJobNumber + ".xls"); } catch (Exception theException) { String errorMessage; errorMessage = "Error: "; errorMessage = String.Concat(errorMessage, theException.Message); errorMessage = String.Concat(errorMessage, " Line: "); errorMessage = String.Concat(errorMessage, theException.Source); }

    Read the article

  • How can I delete a file in Sinatra after it has been sent via send_file?

    - by John Reilly
    I have a simple sinatra application that needs to generate a file (via an external process), send that file to the browser, and finally, delete the file from the filesystem. Something along these lines: class MyApp < Sinatra::Base get '/generate-file' do # calls out to an external process, # and returns the path to the generated file file_path = generate_the_file() # send the file to the browser send_file(file_path) # remove the generated file, so we don't # completely fill up the filesystem. File.delete(file_path) # File.delete is never called. end end It seems, however, that the send_file call completes the request, and any code after it does not get run. Is there some way to ensure that the generated file is cleaned up after it has been successfully sent to the browser? Or will I need to resort to a cron job running a cleanup script on some interval?

    Read the article

  • How can I do individual file encryption on Dropbox?

    - by Scaine
    I'd like to set a single directory inside Dropbox in which files are encrypted on a file-by-file basis. At the moment, I use a 2Mb Truecrypt container inside my Dropbox which I then have to mount manually, access/change the files within, then unmount manually. At that point, the entire 2Mb uploads to Dropbox. This is a pain for a number of reasons : Dropbox sync will only occur when the Truecrypt container is unmounted, because Dropbox only syncs files that aren't locked and mounting a container locks it. A single byte change to one file inside that container results in the whole 2Mb being uploaded again. It doesn't scale - I was originally using a 10Mb container, but obviously the bigger the container, the longer it takes to sync when it's unmounted. I was wondering if I can somehow use LUKS to implement file-by-file encryption to get round the "container" issues.

    Read the article

  • A question about making a C# class persistant during a file load

    - by Adam
    Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

    Read the article

  • Fedora error log file

    - by user111196
    I am running a java application using this wrapper service yajsw. The problem it just stopped without any error in its logs file. So I was wondering will there be any system log file which will indicate the cause of it going down? Partial of the log file. Apr 6 00:12:20 localhost kernel: imklog 3.22.1, log source = /proc/kmsg started. Apr 6 00:12:20 localhost rsyslogd: [origin software="rsyslogd" swVersion="3.22.1" x-pid="2234" x-info="http://www.rsyslog.com"] (re)start Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys cpuset Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys cpu Apr 6 00:12:20 localhost kernel: Linux version 2.6.27.41-170.2.117.fc10.x86_64 ([email protected]) (gcc version 4.3.2 20081105 (Red Hat 4.3.2-7) (GCC) ) #1 SMP Thu Dec 10 10:36:29 EST 2009 Apr 6 00:12:20 localhost kernel: Command line: ro root=UUID=722ebf87-437f-4634-9c68-a82d157fa948 rhgb quiet Apr 6 00:12:20 localhost kernel: KERNEL supported cpus: Apr 6 00:12:20 localhost kernel: Intel GenuineIntel Apr 6 00:12:20 localhost kernel: AMD AuthenticAMD Apr 6 00:12:20 localhost kernel: Centaur CentaurHauls Apr 6 00:12:20 localhost kernel: BIOS-provided physical RAM map: Apr 6 00:12:20 localhost kernel: BIOS-e820: 0000000000000000 - 00000000000a0000 (usable) Apr 6 00:12:20 localhost kernel: BIOS-e820: 0000000000100000 - 00000000cfb50000 (usable) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000cfb50000 - 00000000cfb66000 (reserved) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000cfb66000 - 00000000cfb85c00 (ACPI data) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000cfb85c00 - 00000000d0000000 (reserved) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000e0000000 - 00000000f0000000 (reserved) Apr 6 00:12:20 localhost kernel: BIOS-e820: 00000000fe000000 - 0000000100000000 (reserved) Apr 6 00:12:20 localhost kernel: BIOS-e820: 0000000100000000 - 0000000330000000 (usable) Apr 6 00:12:20 localhost kernel: DMI 2.5 present. Apr 6 00:12:20 localhost kernel: last_pfn = 0x330000 max_arch_pfn = 0x3ffffffff Apr 6 00:12:20 localhost kernel: x86 PAT enabled: cpu 0, old 0x7040600070406, new 0x7010600070106 Apr 6 00:12:20 localhost kernel: last_pfn = 0xcfb50 max_arch_pfn = 0x3ffffffff Apr 6 00:12:20 localhost kernel: init_memory_mapping Apr 6 00:12:20 localhost kernel: last_map_addr: cfb50000 end: cfb50000 Apr 6 00:12:20 localhost kernel: init_memory_mapping Apr 6 00:12:20 localhost kernel: last_map_addr: 330000000 end: 330000000 Apr 6 00:12:20 localhost kernel: RAMDISK: 37bfc000 - 37fef6c8 Apr 6 00:12:20 localhost kernel: ACPI: RSDP 000F21B0, 0024 (r2 DELL ) Apr 6 00:12:20 localhost kernel: ACPI: XSDT 000F224C, 0084 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: FACP CFB83524, 00F4 (r3 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: DSDT CFB66000, 4974 (r1 DELL PE_SC3 1 INTL 20050624) Apr 6 00:12:20 localhost kernel: ACPI: FACS CFB85C00, 0040 Apr 6 00:12:20 localhost kernel: ACPI: APIC CFB83078, 00B6 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: SPCR CFB83130, 0050 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: HPET CFB83184, 0038 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: MCFG CFB831C0, 003C (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: WD__ CFB83200, 0134 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: SLIC CFB83338, 0176 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: ERST CFB6AAF4, 0210 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: HEST CFB6AD04, 027C (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: BERT CFB6A974, 0030 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: EINJ CFB6A9A4, 0150 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: ACPI: TCPA CFB834BC, 0064 (r1 DELL PE_SC3 1 DELL 1) Apr 6 00:12:20 localhost kernel: No NUMA configuration found Apr 6 00:12:20 localhost kernel: Faking a node at 0000000000000000-0000000330000000 Apr 6 00:12:20 localhost kernel: Bootmem setup node 0 0000000000000000-0000000330000000 Apr 6 00:12:20 localhost kernel: NODE_DATA [0000000000015000 - 0000000000029fff] Apr 6 00:12:20 localhost kernel: bootmap [000000000002a000 - 000000000008ffff] pages 66 Apr 6 00:12:20 localhost kernel: (7 early reservations) ==> bootmem [0000000000 - 0330000000] Apr 6 00:12:20 localhost kernel: #0 [0000000000 - 0000001000] BIOS data page ==> [0000000000 - 0000001000] Apr 6 00:12:20 localhost kernel: #1 [0000006000 - 0000008000] TRAMPOLINE ==> [0000006000 - 0000008000] Apr 6 00:12:20 localhost kernel: #2 [0000200000 - 0000a310cc] TEXT DATA BSS ==> [0000200000 - 0000a310cc] Apr 6 00:12:20 localhost kernel: #3 [0037bfc000 - 0037fef6c8] RAMDISK ==> [0037bfc000 - 0037fef6c8] Apr 6 00:12:20 localhost kernel: #4 [000009f000 - 0000100000] BIOS reserved ==> [000009f000 - 0000100000] Apr 6 00:12:20 localhost kernel: #5 [0000008000 - 000000c000] PGTABLE ==> [0000008000 - 000000c000] Apr 6 00:12:20 localhost kernel: #6 [000000c000 - 0000015000] PGTABLE ==> [000000c000 - 0000015000] Apr 6 00:12:20 localhost kernel: found SMP MP-table at [ffff8800000fe710] 000fe710 Apr 6 00:12:20 localhost kernel: Zone PFN ranges: Apr 6 00:12:20 localhost kernel: DMA 0x00000000 -> 0x00001000 Apr 6 00:12:20 localhost kernel: DMA32 0x00001000 -> 0x00100000 Apr 6 00:12:20 localhost kernel: Normal 0x00100000 -> 0x00330000 Apr 6 00:12:20 localhost kernel: Movable zone start PFN for each node Apr 6 00:12:20 localhost kernel: early_node_map[3] active PFN ranges Apr 6 00:12:20 localhost kernel: 0: 0x00000000 -> 0x000000a0 Apr 6 00:12:20 localhost kernel: 0: 0x00000100 -> 0x000cfb50 Apr 6 00:12:20 localhost kernel: 0: 0x00100000 -> 0x00330000 Apr 6 00:12:20 localhost kernel: ACPI: PM-Timer IO Port: 0x808 Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x01] lapic_id[0x00] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x02] lapic_id[0x04] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x03] lapic_id[0x02] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x04] lapic_id[0x06] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x05] lapic_id[0x01] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x06] lapic_id[0x05] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x07] lapic_id[0x03] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC (acpi_id[0x08] lapic_id[0x07] enabled) Apr 6 00:12:20 localhost kernel: ACPI: LAPIC_NMI (acpi_id[0xff] high edge lint[0x1]) Apr 6 00:12:20 localhost kernel: ACPI: IOAPIC (id[0x08] address[0xfec00000] gsi_base[0]) Apr 6 00:12:20 localhost kernel: IOAPIC[0]: apic_id 8, version 0, address 0xfec00000, GSI 0-23 Apr 6 00:12:20 localhost kernel: ACPI: IOAPIC (id[0x09] address[0xfec81000] gsi_base[64]) Apr 6 00:12:20 localhost kernel: IOAPIC[1]: apic_id 9, version 0, address 0xfec81000, GSI 64-87 Apr 6 00:12:20 localhost kernel: ACPI: IOAPIC (id[0x0a] address[0xfec84000] gsi_base[160]) Apr 6 00:12:20 localhost kernel: IOAPIC[2]: apic_id 10, version 0, address 0xfec84000, GSI 160-183 Apr 6 00:12:20 localhost kernel: ACPI: IOAPIC (id[0x0b] address[0xfec84800] gsi_base[224]) Apr 6 00:12:20 localhost kernel: IOAPIC[3]: apic_id 11, version 0, address 0xfec84800, GSI 224-247 Apr 6 00:12:20 localhost kernel: ACPI: INT_SRC_OVR (bus 0 bus_irq 0 global_irq 2 dfl dfl) Apr 6 00:12:20 localhost kernel: ACPI: INT_SRC_OVR (bus 0 bus_irq 9 global_irq 9 high level) Apr 6 00:12:20 localhost kernel: Setting APIC routing to flat Apr 6 00:12:20 localhost kernel: ACPI: HPET id: 0x8086a201 base: 0xfed00000 Apr 6 00:12:20 localhost kernel: Using ACPI (MADT) for SMP configuration information Apr 6 00:12:20 localhost kernel: SMP: Allowing 8 CPUs, 0 hotplug CPUs Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000000a0000 - 0000000000100000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000cfb50000 - 00000000cfb66000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000cfb66000 - 00000000cfb85000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000cfb85000 - 00000000cfb86000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000cfb86000 - 00000000d0000000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000d0000000 - 00000000e0000000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000e0000000 - 00000000f0000000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000f0000000 - 00000000fe000000 Apr 6 00:12:20 localhost kernel: PM: Registered nosave memory: 00000000fe000000 - 0000000100000000 Apr 6 00:12:20 localhost kernel: Allocating PCI resources starting at d1000000 (gap: d0000000:10000000) Apr 6 00:12:20 localhost kernel: PERCPU: Allocating 65184 bytes of per cpu data Apr 6 00:12:20 localhost kernel: Built 1 zonelists in Zone order, mobility grouping on. Total pages: 3096524 Apr 6 00:12:20 localhost kernel: Policy zone: Normal Apr 6 00:12:20 localhost kernel: Kernel command line: ro root=UUID=722ebf87-437f-4634-9c68-a82d157fa948 rhgb quiet Apr 6 00:12:20 localhost kernel: Initializing CPU#0 Apr 6 00:12:20 localhost kernel: PID hash table entries: 4096 (order: 12, 32768 bytes) Apr 6 00:12:20 localhost kernel: Extended CMOS year: 2000 Apr 6 00:12:20 localhost kernel: TSC: PIT calibration confirmed by PMTIMER. Apr 6 00:12:20 localhost kernel: TSC: using PMTIMER calibration value Apr 6 00:12:20 localhost kernel: Detected 1994.992 MHz processor. Apr 6 00:12:20 localhost kernel: Console: colour VGA+ 80x25 Apr 6 00:12:20 localhost kernel: console [tty0] enabled Apr 6 00:12:20 localhost kernel: Checking aperture... Apr 6 00:12:20 localhost kernel: No AGP bridge found Apr 6 00:12:20 localhost kernel: PCI-DMA: Using software bounce buffering for IO (SWIOTLB) Apr 6 00:12:20 localhost kernel: Placing software IO TLB between 0x20000000 - 0x24000000 Apr 6 00:12:20 localhost kernel: Memory: 12324244k/13369344k available (3311k kernel code, 253484k reserved, 1844k data, 1296k init) Apr 6 00:12:20 localhost kernel: SLUB: Genslabs=13, HWalign=64, Order=0-3, MinObjects=0, CPUs=8, Nodes=1 Apr 6 00:12:20 localhost kernel: Calibrating delay loop (skipped), value calculated using timer frequency.. 3989.98 BogoMIPS (lpj=1994992) Apr 6 00:12:20 localhost kernel: Security Framework initialized Apr 6 00:12:20 localhost kernel: SELinux: Initializing. Apr 6 00:12:20 localhost kernel: Dentry cache hash table entries: 2097152 (order: 12, 16777216 bytes) Apr 6 00:12:20 localhost kernel: Inode-cache hash table entries: 1048576 (order: 11, 8388608 bytes) Apr 6 00:12:20 localhost kernel: Mount-cache hash table entries: 256 Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys ns Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys cpuacct Apr 6 00:12:20 localhost kernel: Initializing cgroup subsys devices Apr 6 00:12:20 localhost kernel: CPU: L1 I cache: 32K, L1 D cache: 32K Apr 6 00:12:20 localhost kernel: CPU: L2 cache: 4096K Apr 6 00:12:20 localhost kernel: CPU 0/0 -> Node 0 Apr 6 00:12:20 localhost kernel: CPU: Physical Processor ID: 0 Apr 6 00:12:20 localhost kernel: CPU: Processor Core ID: 0 Apr 6 00:12:20 localhost kernel: CPU0: Thermal monitoring enabled (TM1) Apr 6 00:12:20 localhost kernel: using mwait in idle threads. Apr 6 00:12:20 localhost kernel: ACPI: Core revision 20080609 Apr 6 00:12:20 localhost kernel: ..TIMER: vector=0x30 apic1=0 pin1=2 apic2=-1 pin2=-1 Apr 6 00:12:20 localhost kernel: CPU0: Intel(R) Xeon(R) CPU E5335 @ 2.00GHz stepping 07 Apr 6 00:12:20 localhost kernel: Using local APIC timer interrupts. Apr 6 00:12:20 localhost kernel: Detected 20.781 MHz APIC timer. Apr 6 00:12:20 localhost kernel: Booting processor 1/4 ip 6000 Apr 6 00:12:20 localhost kernel: Initializing CPU#1 Apr 6 00:12:20 localhost kernel: Calibrating delay using timer specific routine.. 3990.05 BogoMIPS (lpj=1995026) Apr 6 00:12:20 localhost kernel: CPU: L1 I cache: 32K, L1 D cache: 32K Apr 6 00:12:20 localhost kernel: CPU: L2 cache: 4096K Apr 6 00:12:20 localhost kernel: CPU 1/4 -> Node 0 Apr 6 00:12:20 localhost kernel: CPU: Physical Processor ID: 1 Apr 6 00:12:20 localhost kernel: CPU: Processor Core ID: 0 Apr 6 00:12:20 localhost kernel: CPU1: Thermal monitoring enabled (TM2) Apr 6 00:12:20 localhost kernel: x86 PAT enabled: cpu 1, old 0x7040600070406, new 0x7010600070106 Apr 6 00:12:20 localhost kernel: CPU1: Intel(R) Xeon(R) CPU E5335 @ 2.00GHz stepping 07 Apr 6 00:12:20 localhost kernel: checking TSC synchronization [CPU#0 -> CPU#1]: passed. Apr 6 00:12:20 localhost kernel: Booting processor 2/2 ip 6000 Apr 6 00:12:20 localhost kernel: Initializing CPU#2 Apr 6 00:12:20 localhost kernel: Calibrating delay using timer specific routine.. 3990.05 BogoMIPS (lpj=1995029)

    Read the article

  • UnicodeEncodeError when uploading files in Django admin

    - by Samuel Linde
    Note: I asked this question on StackOverflow, but I realize this might be a more proper place to ask this kind of question. I'm trying to upload a file called 'Testaråäö.txt' via the Django admin app. I'm running Django 1.3.1 with Gunicorn 0.13.4 and Nginx 0.7.6.7 on a Debian 6 server. Database is PostgreSQL 8.4.9. Other Unicode data is saved to the database with no problem, so I guess the problem must be with the filesystem somehow. I've set http { charset utf-8; } in my nginx.conf. LC_ALL and LANG is set to 'sv_SE.UTF-8'. Running 'locale' verifies this. I even tried setting LC_ALL and LANG in my nginx init script just to make sure locale is set properly. Here's the traceback: Traceback (most recent call last): File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/handlers/base.py", line 111, in get_response response = callback(request, *callback_args, **callback_kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 307, in wrapper return self.admin_site.admin_view(view)(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 93, in _wrapped_view response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/views/decorators/cache.py", line 79, in _wrapped_view_func response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/sites.py", line 197, in inner return view(request, *args, **kwargs) File "/srv/django/letebo/app/cms/admin.py", line 81, in change_view return super(PageAdmin, self).change_view(request, obj_id) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 28, in _wrapper return bound_func(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 93, in _wrapped_view response = view_func(request, *args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/utils/decorators.py", line 24, in bound_func return func(self, *args2, **kwargs2) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/transaction.py", line 217, in inner res = func(*args, **kwargs) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 985, in change_view self.save_formset(request, form, formset, change=True) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/contrib/admin/options.py", line 677, in save_formset formset.save() File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 482, in save return self.save_existing_objects(commit) + self.save_new_objects(commit) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 613, in save_new_objects self.new_objects.append(self.save_new(form, commit=commit)) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/forms/models.py", line 717, in save_new obj.save() File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 460, in save self.save_base(using=using, force_insert=force_insert, force_update=force_update) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 504, in save_base self.save_base(cls=parent, origin=org, using=using) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/base.py", line 543, in save_base for f in meta.local_fields if not isinstance(f, AutoField)] File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/fields/files.py", line 255, in pre_save file.save(file.name, file, save=False) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/db/models/fields/files.py", line 92, in save self.name = self.storage.save(name, content) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 48, in save name = self.get_available_name(name) File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 74, in get_available_name while self.exists(name): File "/srv/.virtualenvs/letebo/lib/python2.6/site-packages/django/core/files/storage.py", line 218, in exists return os.path.exists(self.path(name)) File "/srv/.virtualenvs/letebo/lib/python2.6/genericpath.py", line 18, in exists st = os.stat(path) UnicodeEncodeError: 'ascii' codec can't encode characters in position 52-54: ordinal not in range(128) I tried running Gunicorn with debugging turned on, and the file uploads without any problem at all. I suppose this must mean that the issue is with Nginx. Still beats me where to look, though. Here are the raw response headers from Gunicorn and Nginx, if it makes any sense: Gunicorn: HTTP/1.1 302 FOUND Server: gunicorn/0.13.4 Date: Thu, 09 Feb 2012 14:50:27 GMT Connection: close Transfer-Encoding: chunked Expires: Thu, 09 Feb 2012 14:50:27 GMT Vary: Cookie Last-Modified: Thu, 09 Feb 2012 14:50:27 GMT Location: http://my-server.se:8000/admin/cms/page/15/ Cache-Control: max-age=0 Content-Type: text/html; charset=utf-8 Set-Cookie: messages="yada yada yada"; Path=/ Nginx: HTTP/1.1 500 INTERNAL SERVER ERROR Server: nginx/0.7.67 Date: Thu, 09 Feb 2012 14:50:57 GMT Content-Type: text/html; charset=utf-8 Transfer-Encoding: chunked Connection: close Vary: Cookie 500 UPDATE: Both locale.getpreferredencoding() and sys.getfilesystemencoding() outputs 'UTF-8'. locale.getdefaultlocale() outputs ('sv_SE', 'UTF8'). This seem correct to me, so I'm still not sure why I keep getting these errors.

    Read the article

  • Warning message during boot after installation of kernel 3.3: Kernel needs AppArmor 2.4 compatibility patch

    - by Matus Frisik
    I have Ubuntu Server 11.10 and after installation of kernel 3.3 (I just followed instructions from site www.upbuntu.com - How To Install Linux 3.3 Kernel In Ubuntu 11.10/12.04) It shows me following message during boot: fsck from util-linux 2.19.1 fsck from util-linux 2.19.1 /dev/sda5: clean, 204099/1152816 files, 988854/4608639 blocks /dev/sda6: clean, 2345/1281120 files, 142711/5120710 blocks modem-manager[830]: ModemManager (version 0.5) starting... * Starting mDNS/DNS-SD daemon [154G[ OK ] * Starting CUPS printing spooler/server [154G[ OK ] * Starting Mount network filesystems [154G[ OK ] * Stopping Mount network filesystems [154G[ OK ] * Starting System V initialisation compatibility [154G[ OK ] * Stopping Failsafe Boot Delay [154G[ OK ] Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/bin.ping (/etc/apparmor.d/bin.ping line 28): profile /bin/ping network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/lightdm-guest-session (/etc/apparmor.d/lightdm-guest-session line 71): profile /usr/lib/lightdm/lightdm-guest-session-wrapper network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/sbin.dhclient (/etc/apparmor.d/sbin.dhclient line 73): profile /sbin/dhclient network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/sbin.klogd (/etc/apparmor.d/sbin.klogd line 35): profile /sbin/klogd network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/sbin.syslog-ng (/etc/apparmor.d/sbin.syslog-ng line 52): profile /sbin/syslog-ng network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/sbin.syslogd (/etc/apparmor.d/sbin.syslogd line 40): profile /sbin/syslogd network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.bin.chromium-browser (/etc/apparmor.d/usr.bin.chromium-browser line 165): profile /usr/lib/chromium-browser/chromium-browser network rules not enforced Warning from /etc/apparmor.d/usr.bin.chromium-browser (/etc/apparmor.d/usr.bin.chromium-browser line 165): profile browser_java network rules not enforced Warning from /etc/apparmor.d/usr.bin.chromium-browser (/etc/apparmor.d/usr.bin.chromium-browser line 165): profile browser_openjdk network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.bin.evince (/etc/apparmor.d/usr.bin.evince line 142): profile /usr/bin/evince network rules not enforced Warning from /etc/apparmor.d/usr.bin.evince (/etc/apparmor.d/usr.bin.evince line 142): profile /usr/bin/evince-previewer network rules not enforced Warning from /etc/apparmor.d/usr.bin.evince (/etc/apparmor.d/usr.bin.evince line 142): profile /usr/bin/evince-thumbnailer network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Skipping profile in /etc/apparmor.d/disable: usr.bin.firefox Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.lib.dovecot.deliver (/etc/apparmor.d/usr.lib.dovecot.deliver line 24): profile /usr/lib/dovecot/deliver network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.lib.dovecot.dovecot-auth (/etc/apparmor.d/usr.lib.dovecot.dovecot-auth line 24): profile /usr/lib/dovecot/dovecot-auth network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.lib.dovecot.imap (/etc/apparmor.d/usr.lib.dovecot.imap line 23): profile /usr/lib/dovecot/imap network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.lib.dovecot.imap-login (/etc/apparmor.d/usr.lib.dovecot.imap-login line 22): profile /usr/lib/dovecot/imap-login network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.lib.dovecot.managesieve-login (/etc/apparmor.d/usr.lib.dovecot.managesieve-login line 22): profile /usr/lib/dovecot/managesieve-login network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.lib.dovecot.pop3 (/etc/apparmor.d/usr.lib.dovecot.pop3 line 22): profile /usr/lib/dovecot/pop3 network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.lib.dovecot.pop3-login (/etc/apparmor.d/usr.lib.dovecot.pop3-login line 21): profile /usr/lib/dovecot/pop3-login network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.lib.telepathy (/etc/apparmor.d/usr.lib.telepathy line 86): profile /usr/lib/telepathy/mission-control-5 network rules not enforced Warning from /etc/apparmor.d/usr.lib.telepathy (/etc/apparmor.d/usr.lib.telepathy line 86): profile /usr/lib/telepathy/telepathy-* network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.avahi-daemon (/etc/apparmor.d/usr.sbin.avahi-daemon line 30): profile /usr/sbin/avahi-daemon network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.cupsd (/etc/apparmor.d/usr.sbin.cupsd line 170): profile /usr/lib/cups/backend/cups-pdf network rules not enforced Warning from /etc/apparmor.d/usr.sbin.cupsd (/etc/apparmor.d/usr.sbin.cupsd line 170): profile /usr/sbin/cupsd network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.dnsmasq (/etc/apparmor.d/usr.sbin.dnsmasq line 51): profile /usr/sbin/dnsmasq network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.dovecot (/etc/apparmor.d/usr.sbin.dovecot line 37): profile /usr/sbin/dovecot network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.identd (/etc/apparmor.d/usr.sbin.identd line 31): profile /usr/sbin/identd network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.mdnsd (/etc/apparmor.d/usr.sbin.mdnsd line 35): profile /usr/sbin/mdnsd network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.mysqld (/etc/apparmor.d/usr.sbin.mysqld line 44): profile /usr/sbin/mysqld network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.nmbd (/etc/apparmor.d/usr.sbin.nmbd line 21): profile /usr/sbin/nmbd network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.nscd (/etc/apparmor.d/usr.sbin.nscd line 46): profile /usr/sbin/nscd network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.smbd (/etc/apparmor.d/usr.sbin.smbd line 40): profile /usr/sbin/smbd network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.tcpdump (/etc/apparmor.d/usr.sbin.tcpdump line 64): profile /usr/sbin/tcpdump network rules not enforced Cache read/write disabled: /sys/kernel/security/apparmor/features interface file missing. (Kernel needs AppArmor 2.4 compatibility patch.) Warning from /etc/apparmor.d/usr.sbin.traceroute (/etc/apparmor.d/usr.sbin.traceroute line 26): profile /usr/sbin/traceroute network rules not enforced * Starting AppArmor profiles [160G [154G[ OK ] speech-dispatcher disabled; edit /etc/default/speech-dispatcher Checking for running unattended-upgrades: What does this warnings mean and how can I fix it? Informations about my system: response@response:~$ uname -a Linux response 3.3.0-030300-generic #201203182135 SMP Mon Mar 19 01:43:18 UTC 2012 i686 i686 i386 GNU/Linux

    Read the article

  • Python unicode Decode Error SUDs

    - by PylonsN00b
    OK so I have # -*- coding: utf-8 -*- at the top of my script and it worked for being able to pull data from the database that had funny chars(Ñ ,Õ,é,—,–,’,…) in it and store that data into variables...but I have run into other problems, see I pull my data, organize it, and then dump it into a variables like so: title = product[1] Where product[1] is from my database result set Then I load it up for Suds like so: array_of_inventory_item_submit = ca_client_inventory.factory.create('ArrayOfInventoryItemSubmit') for product in products: inventory_item_submit = ca_client_inventory.factory.create('InventoryItemSubmit') inventory_item_list = get_item_list(product) inventory_item_submit = [inventory_item_list] array_of_inventory_item_submit.InventoryItemSubmit.append(inventory_item_submit) #Call that service baby! ca_client_inventory.service.SynchInventoryItemList(accountID, array_of_inventory_item_submit) Where get_item_list sets product[1] to title and (including a whole bunch of other nodes): inventory_item_submit.Title = title So everything runs fine until I call ca_client_inventory.service.SynchInventoryItemList that contains array_of_inventory_item_submit which contains the title w/ the funky char...here is the error: Traceback (most recent call last): File "upload_all_inventory_ebay.py", line 421, in <module> ca_client_inventory.service.SynchInventoryItemList(accountID, array_of_inventory_item_submit) File "build/bdist.macosx-10.6-i386/egg/suds/client.py", line 539, in __call__ File "build/bdist.macosx-10.6-i386/egg/suds/client.py", line 592, in invoke File "build/bdist.macosx-10.6-i386/egg/suds/bindings/binding.py", line 118, in get_message File "build/bdist.macosx-10.6-i386/egg/suds/bindings/document.py", line 63, in bodycontent File "build/bdist.macosx-10.6-i386/egg/suds/bindings/document.py", line 105, in mkparam File "build/bdist.macosx-10.6-i386/egg/suds/bindings/binding.py", line 260, in mkparam File "build/bdist.macosx-10.6-i386/egg/suds/mx/core.py", line 62, in process File "build/bdist.macosx-10.6-i386/egg/suds/mx/core.py", line 75, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 102, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 243, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 182, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/core.py", line 75, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 102, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 298, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 182, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/core.py", line 75, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 102, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 298, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 182, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/core.py", line 75, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 102, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 243, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 182, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/core.py", line 75, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 102, in append File "build/bdist.macosx-10.6-i386/egg/suds/mx/appender.py", line 198, in append File "build/bdist.macosx-10.6-i386/egg/suds/sax/element.py", line 251, in setText File "build/bdist.macosx-10.6-i386/egg/suds/sax/text.py", line 43, in __new__ UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 116: ordinal not in range(128) Now what? My guess is my script can take in these funky chars because I have # -*- coding: utf-8 -*- at the top but Suds does NOT have that at the top of its files. Do I really want to go and change the Suds files...we all know this is the least desired last possible solution...what can I do?

    Read the article

< Previous Page | 316 317 318 319 320 321 322 323 324 325 326 327  | Next Page >