Search Results

Search found 22613 results on 905 pages for 'variable length arguments'.

Page 326/905 | < Previous Page | 322 323 324 325 326 327 328 329 330 331 332 333  | Next Page >

  • Running Java CORBA Client on Unix

    - by Benny
    I'm trying to run a Java application I wrote to subscribe to a CORBA event service. It runs OK on my Windows machine, but as soon as I deploy it to the UNIX server, it gives me an org.omg.CORBA.NO_IMPLEMENT exception. Any ideas as to why this might be happening? I'm using JacORB on my Windows machine and passing VM arguments to initialize the client ORB, but I'm not sure how to do that on UNIX and if it's even necessary. Thanks in advance!

    Read the article

  • How can I implement NotOfType<T> in LINQ that has a nice calling syntax?

    - by Lette
    I'm trying to come up with an implementation for NotOfType, which has a readable call syntax. NotOfType should be the complement to OfType<T> and would consequently yield all elements that are not of type T My goal was to implement a method which would be called just like OfType<T>, like in the last line of this snippet: public abstract class Animal {} public class Monkey : Animal {} public class Giraffe : Animal {} public class Lion : Animal {} var monkey = new Monkey(); var giraffe = new Giraffe(); var lion = new Lion(); IEnumerable<Animal> animals = new Animal[] { monkey, giraffe, lion }; IEnumerable<Animal> fewerAnimals = animals.NotOfType<Giraffe>(); However, I can not come up with an implementation that supports that specific calling syntax. This is what I've tried so far: public static class EnumerableExtensions { public static IEnumerable<T> NotOfType<T>(this IEnumerable<T> sequence, Type type) { return sequence.Where(x => x.GetType() != type); } public static IEnumerable<T> NotOfType<T, TExclude>(this IEnumerable<T> sequence) { return sequence.Where(x => !(x is TExclude)); } } Calling these methods would look like this: // Animal is inferred IEnumerable<Animal> fewerAnimals = animals.NotOfType(typeof(Giraffe)); and // Not all types could be inferred, so I have to state all types explicitly IEnumerable<Animal> fewerAnimals = animals.NotOfType<Animal, Giraffe>(); I think that there are major drawbacks with the style of both of these calls. The first one suffers from a redundant "of type/type of" construct, and the second one just doesn't make sense (do I want a list of animals that are neither Animals nor Giraffes?). So, is there a way to accomplish what I want? If not, could it be possible in future versions of the language? (I'm thinking that maybe one day we will have named type arguments, or that we only need to explicitly supply type arguments that can't be inferred?) Or am I just being silly?

    Read the article

  • Passing BLOB/CLOB as parameter to PL/SQL function

    - by Ula Krukar
    I have this procedure i my package: PROCEDURE pr_export_blob( p_name IN VARCHAR2, p_blob IN BLOB, p_part_size IN NUMBER); I would like for parameter p_blob to be either BLOB or CLOB. When I call this procedure with BLOB parameter, everything is fine. When I call it with CLOB parameter, I get compilation error: PLS-00306: wrong number or types of arguments in call to 'pr_export_blob' Is there a way to write a procedure, that can take either of those types as parameter? Some kind of a superclass maybe?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Memory Allocation Error in MySQL

    - by Chinjoo
    I am using MySql ODBC driver with .Net 3.5. I have created a stored procedure in MySQl which accepts around 15 parameters with types like datetime, varchar, Int32, Int64 etc.. When I run the SP from the query window with the arguments provided, it runs fine. But whwn I test using the .Net application, it gives exception with "Memory allocation error", MySQL native error code is 4001. Any help will be much appreciated.

    Read the article

  • Are GUID primary keys bad in theory, or just practice?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • Find the version of an installed npm package

    - by Laurent Couvidou
    How to find the local version of an installed node.js/npm package? This prints the version of npm itself: npm -v <package-name> This prints a cryptic error: npm version <package-name> For some reason, probably because of the weird arguments ordering, or because of the false positives mentioned above, I just can't remember the proper command. So this question is a note for self that might help others.

    Read the article

  • Filling an Area in .NET

    - by lajoo
    I'm drawing a circle in C# and i have divided it into some parts,i want to fill different parts with different colors,is there anyway to do this? and how?i tried using fillpie() but i couldn't get the arguments to work.

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

  • Only error showing is null, rss feed reader not working

    - by Callum
    I have been following a tutorial which is showing me how to create an rssfeed reader, I come to the end of the tutorial; and the feed is not displaying in the listView. So I am looking for errors in logCat, but the only one I can find is one just saying 'null', which is not helpful at all. Can anyone spot a potential problem with the code I have written? Thanks. DirectRSS(main class): package com.example.rssapplication; import java.util.List; import android.app.ListActivity; import android.content.pm.ActivityInfo; import android.os.Bundle; import android.util.Log; import android.widget.ArrayAdapter; import android.widget.ListView; public class DirectRSS extends ListActivity{ @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.directrss); //Set to portrait, so that every time the view changes; it does not run the DB query again... setRequestedOrientation (ActivityInfo.SCREEN_ORIENTATION_PORTRAIT); try{ RssReader1 rssReader = new RssReader1("http://www.skysports.com/rss/0,20514,11661,00.xml"); ListView list = (ListView)findViewById(R.id.list); ArrayAdapter<RssItem1> adapter = new ArrayAdapter<RssItem1>(this, android.R.layout.simple_list_item_1); list.setAdapter(adapter); list.setOnItemClickListener(new ListListener1(rssReader.getItems(),this)); }catch(Exception e) { String err = (e.getMessage()==null)?"SD Card failed": e.getMessage(); Log.e("sdcard-err2:",err + " " + e.getMessage()); // Log.e("Error", e.getMessage()); Log.e("LOGCAT", "" + e.getMessage()); } } } ListListener1: package com.example.rssapplication; import java.util.List; import android.app.Activity; import android.content.Intent; import android.net.Uri; import android.view.View; import android.widget.AdapterView; import android.widget.AdapterView.OnItemClickListener; public class ListListener1 implements OnItemClickListener{ List<RssItem1> listItems; Activity activity; public ListListener1(List<RssItem1> listItems, Activity activity) { this.listItems = listItems; this.activity = activity; } @Override public void onItemClick(AdapterView<?> parent, View view, int pos, long id) { // TODO Auto-generated method stub Intent i = new Intent(Intent.ACTION_VIEW); i.setData(Uri.parse(listItems.get(pos).getLink())); activity.startActivity(i); } } RssItem1: package com.example.rssapplication; public class RssItem1 { private String title; private String link; public String getTitle() { return title; } public void setTitle(String title) { this.title = title; } public String getLink() { return link; } public void setLink(String link) { this.link = link; } } RssParseHandler1: package com.example.rssapplication; import java.util.ArrayList; import java.util.List; import org.xml.sax.Attributes; import org.xml.sax.SAXException; import org.xml.sax.helpers.DefaultHandler; public class RssParseHandler1 extends DefaultHandler{ private List<RssItem1> rssItems; private RssItem1 currentItem; private boolean parsingTitle; private boolean parsingLink; public RssParseHandler1(){ rssItems = new ArrayList<RssItem1>(); } public List<RssItem1> getItems(){ return rssItems; } @Override public void startElement(String uri, String localName, String qName, Attributes attributes) throws SAXException { if("item".equals(qName)){ currentItem = new RssItem1(); } else if("title".equals(qName)){ parsingTitle = true; } else if("link".equals(qName)){ parsingLink = true; } // TODO Auto-generated method stub super.startElement(uri, localName, qName, attributes); } @Override public void endElement(String uri, String localName, String qName) throws SAXException { if("item".equals(qName)){ rssItems.add(currentItem); currentItem = null; } else if("title".equals(qName)){ parsingTitle = false; } else if("link".equals(qName)){ parsingLink = false; } // TODO Auto-generated method stub super.endElement(uri, localName, qName); } @Override public void characters(char[] ch, int start, int length) throws SAXException { if(parsingTitle) { if(currentItem!=null) { currentItem.setTitle(new String(ch,start,length)); } } else if(parsingLink) { if(currentItem!=null) { currentItem.setLink(new String(ch,start,length)); parsingLink = false; } } // TODO Auto-generated method stub super.characters(ch, start, length); } } RssReader1: package com.example.rssapplication; import java.util.List; import javax.xml.parsers.SAXParser; import javax.xml.parsers.SAXParserFactory; public class RssReader1 { private String rssUrl; public RssReader1(String rssUrl) { this.rssUrl = rssUrl; } public List<RssItem1> getItems() throws Exception { SAXParserFactory factory = SAXParserFactory.newInstance(); SAXParser saxParser = factory.newSAXParser(); RssParseHandler1 handler = new RssParseHandler1(); saxParser.parse(rssUrl, handler); return handler.getItems(); } } Here is the logCat also: 08-25 11:13:20.803: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.803: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.803: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.813: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.813: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.813: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.813: W/ApplicationPackageManager(26291): getCSCPackageItemText() 08-25 11:13:20.843: D/AbsListView(26291): Get MotionRecognitionManager 08-25 11:13:20.843: E/sdcard-err2:(26291): SD Card failed null 08-25 11:13:20.843: E/LOGCAT(26291): null 08-25 11:13:20.843: D/AbsListView(26291): onVisibilityChanged() is called, visibility : 4 08-25 11:13:20.843: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.873: D/AbsListView(26291): onVisibilityChanged() is called, visibility : 0 08-25 11:13:20.883: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.903: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.933: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.963: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:20.973: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:21.323: D/AbsListView(26291): onVisibilityChanged() is called, visibility : 4 08-25 11:13:21.323: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:21.323: D/AbsListView(26291): onVisibilityChanged() is called, visibility : 4 08-25 11:13:21.323: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:21.323: D/AbsListView(26291): onVisibilityChanged() is called, visibility : 4 08-25 11:13:21.323: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:21.323: D/AbsListView(26291): onVisibilityChanged() is called, visibility : 4 08-25 11:13:21.323: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:21.323: D/AbsListView(26291): onVisibilityChanged() is called, visibility : 4 08-25 11:13:21.323: D/AbsListView(26291): unregisterIRListener() is called 08-25 11:13:21.333: D/AbsListView(26291): onVisibilityChanged() is called, visibility : 4 08-25 11:13:21.333: D/AbsListView(26291): unregisterIRListener() is called

    Read the article

  • Can this jQuery/Javascript functionality be replicated with PHP

    - by benhowdle89
    This is the code to grab tweets, but i need this in PHP, can anybody offer any insight? $(document).ready( function() { var url = "http://twitter.com/status/user_timeline/joebloggs.json?count=1&callback=?"; $.getJSON(url, function(data){ $.each(data, function(i, item) { $("#twitter-posts").append("<p>" + item.text.linkify() + " <span class='created_at'>" + relative_time(item.created_at) + " via " + item.source + "</span></p>"); }); }); }); String.prototype.linkify = function() { return this.replace(/[A-Za-z]+:\/\/[A-Za-z0-9-_]+\.[A-Za-z0-9-_:%&\?\/.=]+/, function(m) { return m.link(m); }); }; function relative_time(time_value) { var values = time_value.split(" "); time_value = values[1] + " " + values[2] + ", " + values[5] + " " + values[3]; var parsed_date = Date.parse(time_value); var relative_to = (arguments.length > 1) ? arguments[1] : new Date(); var delta = parseInt((relative_to.getTime() - parsed_date) / 1000); delta = delta + (relative_to.getTimezoneOffset() * 60); var r = ''; if (delta < 60) { r = 'a minute ago'; } else if(delta < 120) { r = 'couple of minutes ago'; } else if(delta < (45*60)) { r = (parseInt(delta / 60)).toString() + ' minutes ago'; } else if(delta < (90*60)) { r = 'an hour ago'; } else if(delta < (24*60*60)) { r = '' + (parseInt(delta / 3600)).toString() + ' hours ago'; } else if(delta < (48*60*60)) { r = '1 day ago'; } else { r = (parseInt(delta / 86400)).toString() + ' days ago'; } return r; } function twitter_callback () { return true; }

    Read the article

  • What are the reasons *not* to use a GUID for a primary key?

    - by Yarin
    Whenever I design a database I automatically start with an auto-generating GUID primary key for each of my tables (excepting look-up tables) I know I'll never lose sleep over duplicate keys, merging tables, etc. To me it just makes sense philosophically that any given record should be unique across all domains, and that that uniqueness should be represented in a consistent way from table to table. I realize it will never be the most performant option, but putting performance aside, I'd like to know if there are philosophical arguments against this practice?

    Read the article

  • getting Null pointer exception

    - by Abhijeet
    Hi I am getting this message on emulator when I run my android project: The application MediaPlayerDemo_Video.java (process com.android.MediaPlayerDemo_Video) has stopped unexpectedly. Please try again I am trying to run the MediaPlayerDemo_Video.java given in ApiDemos in the Samples given on developer.android.com. The code is : package com.android.MediaPlayerDemo_Video; import android.app.Activity; import android.media.AudioManager; import android.media.MediaPlayer; import android.media.MediaPlayer.OnBufferingUpdateListener; import android.media.MediaPlayer.OnCompletionListener; import android.media.MediaPlayer.OnPreparedListener; import android.media.MediaPlayer.OnVideoSizeChangedListener; import android.os.Bundle; import android.util.Log; import android.view.SurfaceHolder; import android.view.SurfaceView; import android.widget.Toast; public class MediaPlayerDemo_Video extends Activity implements OnBufferingUpdateListener, OnCompletionListener, OnPreparedListener, OnVideoSizeChangedListener, SurfaceHolder.Callback { private static final String TAG = "MediaPlayerDemo"; private int mVideoWidth; private int mVideoHeight; private MediaPlayer mMediaPlayer; private SurfaceView mPreview; private SurfaceHolder holder; private String path; private Bundle extras; private static final String MEDIA = "media"; // private static final int LOCAL_AUDIO = 1; // private static final int STREAM_AUDIO = 2; // private static final int RESOURCES_AUDIO = 3; private static final int LOCAL_VIDEO = 4; private static final int STREAM_VIDEO = 5; private boolean mIsVideoSizeKnown = false; private boolean mIsVideoReadyToBePlayed = false; /** * * Called when the activity is first created. */ @Override public void onCreate(Bundle icicle) { super.onCreate(icicle); setContentView(R.layout.mediaplayer_2); mPreview = (SurfaceView) findViewById(R.id.surface); holder = mPreview.getHolder(); holder.addCallback(this); holder.setType(SurfaceHolder.SURFACE_TYPE_PUSH_BUFFERS); extras = getIntent().getExtras(); } private void playVideo(Integer Media) { doCleanUp(); try { switch (Media) { case LOCAL_VIDEO: // Set the path variable to a local media file path. path = ""; if (path == "") { // Tell the user to provide a media file URL. Toast .makeText( MediaPlayerDemo_Video.this, "Please edit MediaPlayerDemo_Video Activity, " + "and set the path variable to your media file path." + " Your media file must be stored on sdcard.", Toast.LENGTH_LONG).show(); } break; case STREAM_VIDEO: /* * Set path variable to progressive streamable mp4 or * 3gpp format URL. Http protocol should be used. * Mediaplayer can only play "progressive streamable * contents" which basically means: 1. the movie atom has to * precede all the media data atoms. 2. The clip has to be * reasonably interleaved. * */ path = ""; if (path == "") { // Tell the user to provide a media file URL. Toast .makeText( MediaPlayerDemo_Video.this, "Please edit MediaPlayerDemo_Video Activity," + " and set the path variable to your media file URL.", Toast.LENGTH_LONG).show(); } break; } // Create a new media player and set the listeners mMediaPlayer = new MediaPlayer(); mMediaPlayer.setDataSource(path); mMediaPlayer.setDisplay(holder); mMediaPlayer.prepare(); mMediaPlayer.setOnBufferingUpdateListener(this); mMediaPlayer.setOnCompletionListener(this); mMediaPlayer.setOnPreparedListener(this); mMediaPlayer.setOnVideoSizeChangedListener(this); mMediaPlayer.setAudioStreamType(AudioManager.STREAM_MUSIC); } catch (Exception e) { Log.e(TAG, "error: " + e.getMessage(), e); } } public void onBufferingUpdate(MediaPlayer arg0, int percent) { Log.d(TAG, "onBufferingUpdate percent:" + percent); } public void onCompletion(MediaPlayer arg0) { Log.d(TAG, "onCompletion called"); } public void onVideoSizeChanged(MediaPlayer mp, int width, int height) { Log.v(TAG, "onVideoSizeChanged called"); if (width == 0 || height == 0) { Log.e(TAG, "invalid video width(" + width + ") or height(" + height + ")"); return; } mIsVideoSizeKnown = true; mVideoWidth = width; mVideoHeight = height; if (mIsVideoReadyToBePlayed && mIsVideoSizeKnown) { startVideoPlayback(); } } public void onPrepared(MediaPlayer mediaplayer) { Log.d(TAG, "onPrepared called"); mIsVideoReadyToBePlayed = true; if (mIsVideoReadyToBePlayed && mIsVideoSizeKnown) { startVideoPlayback(); } } public void surfaceChanged(SurfaceHolder surfaceholder, int i, int j, int k) { Log.d(TAG, "surfaceChanged called"); } public void surfaceDestroyed(SurfaceHolder surfaceholder) { Log.d(TAG, "surfaceDestroyed called"); } public void surfaceCreated(SurfaceHolder holder) { Log.d(TAG, "surfaceCreated called"); playVideo(extras.getInt(MEDIA)); } @Override protected void onPause() { super.onPause(); releaseMediaPlayer(); doCleanUp(); } @Override protected void onDestroy() { super.onDestroy(); releaseMediaPlayer(); doCleanUp(); } private void releaseMediaPlayer() { if (mMediaPlayer != null) { mMediaPlayer.release(); mMediaPlayer = null; } } private void doCleanUp() { mVideoWidth = 0; mVideoHeight = 0; mIsVideoReadyToBePlayed = false; mIsVideoSizeKnown = false; } private void startVideoPlayback() { Log.v(TAG, "startVideoPlayback"); holder.setFixedSize(mVideoWidth, mVideoHeight); mMediaPlayer.start(); } } I think the above message is due to Null pointer exception , however I may be false. I am unable to find where the error is . So , Please someone help me out .

    Read the article

  • Execute a Application On The Server Using VBScript

    - by Nathan Campos
    I have an application on my server that is called leaf.exe, that haves two arguments needed to run, they are: inputfile and outputfile, that will be like this example: leaf.exe input.jpg output.leaf They are all on the same directory as my home page file(the executable and the input file). But I need that a VBScript could run the application like that, then I want to know how could I do this.

    Read the article

  • Usable mainmenu when sheet is shown

    - by neoneye
    How does one react to menuitems that are clicked via mouse or invoked via keyboard, e.g: CMD+Q ? [NSApp beginSheet:my_sheet ...arguments... ]; /* The sheet is now shown and the mainmenu isn't usable. How does one make it usable? */ [NSApp endSheet:my_sheet returnCode:0];

    Read the article

  • how to call update query in procedure of oracle

    - by Deven
    how to call update query in procedure of oracle hello friends i am having one table t1 in which i am having userid, week and year fields r there if i want to call procedure which takes all three values as arguments and fire update query how can i do it my update query should be like update t1 set week = (value of procedure argument) , year = (value of procedure argument) where userid=(value of procedure argument);

    Read the article

< Previous Page | 322 323 324 325 326 327 328 329 330 331 332 333  | Next Page >