Search Results

Search found 9970 results on 399 pages for 'regular john'.

Page 327/399 | < Previous Page | 323 324 325 326 327 328 329 330 331 332 333 334  | Next Page >

• Apply a class to a <h1> based on the site url

  - by user1870639

  I'm new to PHP and want to apply a specific class to the title of my page depending on what part of the site the viewer is browsing. For instance, I want to apply the class "blog" to the if the viewer is at domain.com/blog OR domain.com/blog/post-1 so on and so forth BUT apply the class "pics" if they're viewing domain.com/pics or domain.com/pics/gallery-1 etc etc. I found something that could be modified to serve my needs using javascript here but I figured seeing as I'm using PHP already, it'd make more sense to keep this sort of thing server side. As I say, I'm new to PHP. I've experimented with some regular expressions, but to no avail.

  Read the article

• boost test case for function taking user input

  - by oadams

  I have a function that takes in user input via std::cin: std::getline(std::cin, in); and creates a corresponding data structure by matching it with a regular expression. The function then returns this data structure. I'm using boost.test and I want to create a unit test to check that the output data type is correct given some inputs. However I don't know how to go about it since the input isn't passed as an argument to the function. EDIT: Is there a simple way to create a boost test case that feeds the function a string via standard input?

  Read the article

• Yet another URL prefix regex question (to be used in C#).

  - by Hamish Grubijan

  Hi, I have seen many regular expressions for Url validation. In my case I want the Url to be simpler, so the regex should be tighter: Valid Url prefixes look like: http[s]://[www.]addressOrIp[.something]/PageName.aspx[?] This describe a prefix. I will be appending ?x=a&y=b&z=c later. I just want to check if the web page is live before accessing it, but even before that I want to make sure that it is properly configured. I want to treat bad url and host is down conditions differently, although when in doubt, I'd rather give a host is down message, because that is an ultimate test anyway. Hopefully that makes sense. I guess what I am trying to say - the regex does not need be too aggressive, I just want it to cover say 95% of the cases. This is C# - centric, so Perl regex extensions are not helpful to me; let's stick to the lowest common denominator. Thanks!

  Read the article

• Regex doesn't work properly

  - by oneofthelions

  I am trying to implement a regular expression to allow only one or two digits after a hyphen '-' and it doesn't work properly. It allows as many digits as user types after '-' Please suggest my ExtJS Ext.apply(Ext.form.VTypes, { hyphenText: "Number and hyphen", hyphenMask: /[\d\-]/, hyphenRe: /^\d+-\d{1,2}$/, hyphen: function(v){ return Ext.form.VTypes.hyphenRe.test(v); } }); //Input Field for Issue no var <portlet:namespace/>issueNoField = new Ext.form.TextField({ fieldLabel: 'Issue No', width: 120, valueField:'IssNo', vtype: 'hyphen' }); This works only to the limit that it allows digits and -. But it also has to allow only 1 to 2 digits after - at most. Is something wrong in my regex? hyphenRe: /^\d+-\d{1,2}$/,

  Read the article

• Are there design-time watch windows for Visual Studio 2008/2010?

  - by Jeff

  There are many times when I need to test a little snippet of .net code but rebuilding and publishing the entire project or writing a suite of unit tests just seems like overkill. For example, I am writing a regular expression right now and I want to see if it the pattern is matching on the right parts. I could go and find a million other utilities that do that sort of thing, but that is not exactly my point. FireBug has an exact analogue to what I want - the FireBug console. There is a text box where the user can enter some JavaScript and FireBug will execute it on the spot and display the return value. I would love to be able to enter something like (new Regex("b+")).Replace("abc", "x") and see the results without having to do all the overhead. Does VS have anything like this?

  Read the article

• HandsOnTable - using date functions with methods

  - by briansol

  I have a function used on the datepicker to limit dates selected to the first of the month... I invoke it by setting a class and listener, such as: $( ".datepickfom" ).datepicker( { beforeShowDay: fom, showOn: "both", buttonImage: "/images/calendar.png", buttonImageOnly: true, changeMonth: true, changeYear: true, dateFormat: "m/d/yy", yearRange: "-25:+100", constrainInput: true } ); the fom call: function fom(date){ if (date.getDate() != 1) { return [false, "", "Specify 1st of Month"]; } return [true, ""]; } This works great for regular forms. I'm looking to extend this functionality to the HandsOnTable 'date' cell data types. var $container_1 = $("#datatable_1"); var handsontable_1 = $container_1.data('handsontable'); $("#datatable_1").handsontable( { columns: [ {}, {}, { type: 'date', dateFormat: 'm/d/yy' }, {}, { type: 'dropdown', source: ["","Y","N"] }, {}, {} ] }); This also works as it should, but the date lets me pick other dates besides the first. Is there a way to attach the beforeShowDay option to the HOT cell call as well?

  Read the article

• PHP reg expr. replace ALL URLs except img src URLs

  - by zilveer

  Hi, I have searched but havent been able to find my answer. It follows like: I would like to replace all URL in a string to links except the URLs within img src tag. I have a regular expression for replacing all the URLs to links, but would like it to NOT replace the URLs within img src="" attribute. How can i do this? Here is the code for replacing all URLs: /*** make sure there is an http:// on all URLs ***/ $str = preg_replace("/([^\w\/])(www\.[a-z0-9\-]+\.[a-z0-9\-]+)/i", "$1http://$2",$str); /*** make all URLs links ***/ $str = preg_replace("/([\w]+:\/\/[\w-?&;#~=\.\/\@]+[\w\/])/i","<a target=\"_blank\" href=\"$1\">$1</a>",$str); /Regards

  Read the article

• Zend Framework: How to handle exceptions in Ajax requests?

  - by understack

  Normally when an exception is thrown, Error controller takes command and displays error page with regular common header and footer. This behavior is not wanted in Ajax request. Because in case of error, whole html page is sent over. And in cases where I'm directly loading the content of http response in a div, this is even more unwanted. Instead in case of Ajax request, I just want to receive 'the actual error' thrown by exception. How can I do this? I think, one dirty way could be: set a var in ajax request and process accordingly. Not a good solution.

  Read the article

• How to publish to Facebook fan/business pages (not user profiles)

  - by Jeff Putz

  I'm trying to figure out if fan/business pages are conceptually similar to regular user pages. My end goal is to publish events from a third-party Web site (new content, announcements, etc.) into the FB page that promotes the third-party site. I'm not sure where to start exactly. Been looking at the .NET Facebook SDK, and it seems focused on FB apps and authentication. Not sure where I should be looking. Help is appreciated!

  Read the article

• How do I link (dependency) properties in my ViewModel?

  - by mos

  Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

  Read the article

• JQuery create new select option

  - by nav

  Hi I have the below functions in regular javascript creating select options. Is there a way I can do this with JQuery without having to use the form object? function populate(form) { form.options.length = 0; form.options[0] = new Option("Select a city / town in Sweden",""); form.options[1] = new Option("Melbourne","Melbourne"); } Below is how I call the function above: populate(document.form.county); //county is the id of the dropdownlist to populate. Many Thanks,

  Read the article

• Change selected value of drop down list with jQuery

  - by Phairoh

  I have a drop down list with known values. What I'm trying to do is set the drop down list to a particular value that I know exists using jQuery. Using regular JavaScript, I would do something like: ddl = document.getElementById("ID of element goes here"); ddl.value = 2; // 2 being the value I want to set it to. However, I need to do this with jQuery because I'm using a CSS class for my selector (stupid ASP.NET client ids...). Here are a few things I've tried: $("._statusDDL").val(2); // doesn't find 2 as a value $("._statusDDL").children("option").val(2) // also failed. How can I do it with jQuery?

  Read the article

• Prevent RegEx Hang on Large Matches...

  - by developerjay

  This is a great regular expression for dates... However it hangs indefinitely on this one page I tried... I wanted to try this page ( http://pleac.sourceforge.net/pleac%5Fpython/datesandtimes.html ) for the fact that it does have lots of dates on it and I want to grab all of them. I don't understand why it is hanging when it doesn't on other pages... Why is my regexp hanging and/or how could I clean it up to make it better/efficient ? Python Code: monthnames = "(?:Jan\w*|Feb\w*|Mar\w*|Apr\w*|May|Jun\w?|Jul\w?|Aug\w*|Sep\w*|Oct\w*|Nov(?:ember)?|Dec\w*)" pattern1 = re.compile(r"(\d{1,4}[\/\\\-]+\d{1,2}[\/\\\-]+\d{2,4})") pattern4 = re.compile(r"(?:[\d]*[\,\.\ \-]+)*%s(?:[\,\.\ \-]+[\d]+[stndrh]*)+[:\d]*[\ ]?(PM)?(AM)?([\ \-\+\d]{4,7}|[UTCESTGMT\ ]{2,4})*"%monthnames, re.I) patterns = [pattern4, pattern1] for pattern in patterns: print re.findall(pattern, s) btw... when i say im trying it against this site.. I'm trying it against the webpage source.

  Read the article

• Question in Flex (parser)

  - by shkk

  Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

  Read the article

• Splitting Nucleotide Sequences in JS with Regexp

  - by TEmerson

  I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

  Read the article

• XAMPP on windows 7 not working properly

  - by 404Error

  Hey there, I just installed XAMPP lite on Windows 7. I have two drives - C: for the OS and regular files, and an external drive E:. I installed XAMPP lite on E: (on the root), and its been giving me problems. Apache works well enough, but MySQL doesn't work. When I go to http://localhost/phpmyadmin/, it gives me the following error: Error MySQL said: #2003 - Can't connect to MySQL server on 'localhost' (10061) Connection for controluser as defined in your configuration failed. Any ideas as to what could be the problem? I used the zip file for XAMPP lite, the 32 bit version. This is on Windows 7 Home premium. Thanks!

  Read the article

• Magento - how to create different prices for different sizes of a products?

  - by Lisa Li

  Hi, I am trying to set different prices for different sizes of a few products I have in my store. I am not really sure how to do that propely. The problem is that I already have the regular size defined as a simple product. Now, I want to add a smaller size as well, that can be chosen from the same product page, and I need to set the weight of the smaller size, so postage is calculated properly. Any suggestions? Many thanks!

  Read the article

• Java Util Linked List - how to find next?

  - by drozzy

  When using Java LinkedList how do you find out the element's next or previous relationships? I mean, in a regular linked list I would do something like this: Node node1 = new Node(); Node node2 = new Node(); LinkedList list = new LinkedList(); list.add(node1); list.add(node2); //then my node1 will know who it's next is: assertEquals(node2, node1.next()); But in Java's LinkedList, the data does not seem to be modified. So how do I actually find out who the "next" (or "previous" in the case of doubly-linked lists) element is?

  Read the article

• Get "2:35pm" instead of "02:35PM" from Python date/time?

  - by anonymous coward

  I'm still a bit slow with Python, so I haven't got this figured out beyond what's obviously in the docs, etc. I've worked with Django a bit, where they've added some datetime formatting options via template tags, but in regular python code how can I get the 12-hour hour without a leading zero? Is there a straightforward way to do this? I'm looking at the 2.5 and 2.6 docs for "strftime()" and there doesn't seem to be a formatting option there for this case. Should I be using something else? Feel free to include any other time-formatting tips that aren't obvious from the docs. =)

  Read the article

• Creating Slugs from Titles?

  - by James Jeffery

  I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

  Read the article

• How do I compute a variable in Javascript if and only if it is used?

  - by LLer

  This is what I'm doing right now. var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = function() { return x; }; return x; } It works but only if foo is called as a function like so foo(); But what if I want to call it as a normal variable with a value? I could modify the code to be var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = x; return x; } That would allow me to only call it once as a function and after that as a regular variable. But it's still not what I want. Plus it gets complicated if it accidentally gets called as a function again, returning an error. Is this even possible in Javascript?

  Read the article

• Removing words from a file

  - by user1765792

  I'm trying to take a regular text file and remove words identified in a separate file (stopwords) containing the words to be removed separated by carriage returns ("\n"). Right now I'm converting both files into lists so that the elements of each list can be compared. I got this function to work, but it doesn't remove all of the words I have specified in the stopwords file. Any help is greatly appreciated. def elimstops(file_str): #takes as input a string for the stopwords file location stop_f = open(file_str, 'r') stopw = stop_f.read() stopw = stopw.split('\n') text_file = open('sample.txt') #Opens the file whose stop words will be eliminated prime = text_file.read() prime = prime.split(' ') #Splits the string into a list separated by a space tot_str = "" #total string i = 0 while i < (len(stopw)): if stopw[i] in prime: prime.remove(stopw[i]) #removes the stopword from the text else: pass i += 1 # Creates a new string from the compilation of list elements # with the stop words removed for v in prime: tot_str = tot_str + str(v) + " " return tot_str

  Read the article

• Assign RegEx submatches to variables or map (C++/C)

  - by Michael

  I need to extract the SAME type of information (e.g. First name, Last Name, Telephone, ...), from numerous different text sources (each with a different format & different order of the variables of interest). I want a function that does the extraction based on a regular expression and returns the result as DESCRIPTIVE variables. In other words, instead of returning each match result as submatch[0], submatch[1], submatch[2], ..., have it do EITHER of the following: 1.) return std::map so that the submatches can be accessed via: submatch["first_name"], submatch["last_name"], submatch["telephone"] 2.) return a variables with the submatches so that the submatches can be accessed via: submatch_first_name, submatch_last_name, submatch_telephone I can write a wrapper class around boost::regex to do #1, but I was hoping there would be a built-in or a more elegant way to do this in C++/Boost/STL/C.

  Read the article

• Just how much do I want to make virtual?

  - by Alex

  I am writing an abstract superclass where literally every method is going to be overridden. There is some default functionality I could implement, but most of the time it's enough to leave the implementation to the subclass writer. Since just about every method is going to be overwritten, how much should I make virtual and how much should I just leave as regular methods? In the current incarnation, everything is virtual, but I still haven't let this loose to anyone to use, so the design is flexible. What advantages/disadvantages are there to virtual functions? Links to good reading material about this would be appreciated.

  Read the article

• Given a user control with a form containing validation can I validate entirely server side?

  - by JoshBaltzell

  We have an existing User Control that was built to dynamically generate a web form for an end user. This form includes required field validators, custom validators that use server side code and Regular Expression validatiors. We now have a need to use all these validators to verify that all the needed data is entered when using a separate ordering process that cannot be validated in the same way, but has the same validation requirements before it is added to the database. I would like to use this user control to validate the input by passing it all the values and checking the validation summary. The only way I know how to do this is to render it to a page on the client side and trigger the form submit. Is there any way to populate and validate a web form entirely on the server side?

  Read the article

< Previous Page | 323 324 325 326 327 328 329 330 331 332 333 334  | Next Page >